summaryrefslogtreecommitdiffstats
path: root/contrib/awk/doc
diff options
context:
space:
mode:
authorobrien <obrien@FreeBSD.org>2001-11-02 21:06:08 +0000
committerobrien <obrien@FreeBSD.org>2001-11-02 21:06:08 +0000
commit223f0286ad0612783e0da01de3b5bfdc52e3b25c (patch)
treecd2c7fd87952f47d303b90e49b90c14bccf7e292 /contrib/awk/doc
parent4e5281d00b8fa7447d70020d36660157e7e43626 (diff)
downloadFreeBSD-src-223f0286ad0612783e0da01de3b5bfdc52e3b25c.zip
FreeBSD-src-223f0286ad0612783e0da01de3b5bfdc52e3b25c.tar.gz
Update vendor branch to gawk-3.1.0.
Diffstat (limited to 'contrib/awk/doc')
-rw-r--r--contrib/awk/doc/ChangeLog43
-rw-r--r--contrib/awk/doc/Makefile.am80
-rw-r--r--contrib/awk/doc/Makefile.in480
-rw-r--r--contrib/awk/doc/ad.block7
-rw-r--r--contrib/awk/doc/awkcard.in919
-rw-r--r--contrib/awk/doc/cardfonts2
-rw-r--r--contrib/awk/doc/gawk.11453
-rw-r--r--contrib/awk/doc/gawk.texi23639
-rw-r--r--contrib/awk/doc/gawkinet.texi5075
-rw-r--r--contrib/awk/doc/no.colors2
-rw-r--r--contrib/awk/doc/texinfo.tex368
11 files changed, 22008 insertions, 10060 deletions
diff --git a/contrib/awk/doc/ChangeLog b/contrib/awk/doc/ChangeLog
index 2d8e520..79dac76 100644
--- a/contrib/awk/doc/ChangeLog
+++ b/contrib/awk/doc/ChangeLog
@@ -1,3 +1,44 @@
+Sun Jun 3 13:04:44 2001 Arnold D. Robbins <arnold@skeeve.com>
+
+ * Release 3.1.0: Release tar file made. And there was
+ rejoicing.
+
+Mon May 14 19:57:31 2001 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi, gawkinet.texi: Versions for distribution
+ put in place.
+ * gawk.1, awkcard.in: Minor edits for consistency of
+ usage, formatting.
+
+Wed Nov 22 14:57:59 2000 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi, gawk.1, awkcard.in: Removed all documentation
+ of abort.
+
+Sun Aug 13 11:23:50 2000 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi, gawk.1, awkcard.in: documented sort function
+ and optional third argument to match.
+
+Sun Aug 13 00:40:41 2000 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: hardwired publisher info.
+ * publisher.texi: Removed. Not needed any more.
+ * gawkinet.texi: Added title page stuff.
+
+Thu Jul 5 21:05:57 2000 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: moved to use of @command, @option everywhere
+ appropriate. Removed all @page and @group in anticipation
+ of re-page breaking. Updated stuff for install-info.
+ Added FDL.
+
+Tue Nov 10 11:42:26 1998 Arnold D. Robbins <arnold@gnu.org>
+
+ * publisher.texi: new file with publisher related info.
+ * Makefile.in: updated dvi and postscript targets to make
+ them lots smarter about not reformatting if need be.
+
Mon Aug 7 15:23:00 2000 Arnold D. Robbins <arnold@skeeve.com>
* Release 3.0.6: Release tar file made.
@@ -52,7 +93,7 @@ Thu Jul 29 23:15:34 1999 Arnold D. Robbins <arnold@skeeve.com>
install it directly.
Wed Jun 30 16:14:36 1999 Arnold D. Robbins <arnold@gnu.org>
-
+
* Release 3.0.4: Release tar file made. This time for sure.
Wed Oct 7 21:59:33 1998 Arnold D. Robbins <arnold@gnu.org>
diff --git a/contrib/awk/doc/Makefile.am b/contrib/awk/doc/Makefile.am
new file mode 100644
index 0000000..3a9e4b4
--- /dev/null
+++ b/contrib/awk/doc/Makefile.am
@@ -0,0 +1,80 @@
+#
+# doc/Makefile.am --- automake input file for gawk
+#
+# Copyright (C) 2000, 2001 the Free Software Foundation, Inc.
+#
+# This file is part of GAWK, the GNU implementation of the
+# AWK Programming Language.
+#
+# GAWK is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2 of the License, or
+# (at your option) any later version.
+#
+# GAWK is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA
+#
+
+## process this file with automake to produce Makefile.in
+
+info_TEXINFOS = gawk.texi gawkinet.texi
+
+man_MANS = gawk.1 igawk.1
+
+EXTRA_DIST = ChangeLog README.card ad.block setter.outline \
+ awkcard.in awkforai.txt texinfo.tex cardfonts \
+ macros colors no.colors $(man_MANS) \
+ uf002331.eps uf002331.jpg lflashlight.eps rflashlight.eps \
+ statist.jpg statist.eps
+
+MAKEINFO = @MAKEINFO@ --no-split
+
+TROFF = groff -t -Tps
+SEDME = sed -e "s/^level0 restore/level0 restore flashme 100 72 moveto (Copyright `date '+%m-%d-%y %T'`, FSF, Inc. (all)) show/" \
+ -e "s/^\/level0 save def/\/level0 save def 30 -48 translate/"
+
+CARDSRC = $(srcdir)/macros $(srcdir)/cardfonts $(srcdir)/colors awkcard.tr
+CARDSRC_N = $(srcdir)/macros $(srcdir)/cardfonts $(srcdir)/no.colors awkcard.tr
+CARDFILES= $(CARDSRC) ad.block awkcard.in setter.outline
+
+# Use this if your troff can correctly handle macros from 'colors' file
+AWKCARD = awkcard.ps
+
+# Uncomment the following definition of AWKCARD if your troff can produce
+# Postscript but still has troubles with macros from 'colors'. As this
+# is not groff you will have to change TROFF macro as well. Do not forget
+# to ensure that awkcard.tr is processed by tbl.
+#AWKCARD = awkcard.nc
+
+postscript: gawk.ps gawkinet.ps gawk.1.ps igawk.1.ps $(AWKCARD)
+
+gawk.ps: gawk.dvi
+ dvips -o gawk.ps gawk.dvi
+
+gawkinet.ps: gawkinet.dvi
+ dvips -o gawkinet.ps gawkinet.dvi
+
+gawk.1.ps: gawk.1
+ -groff -man $(srcdir)/gawk.1 > gawk.1.ps
+
+igawk.1.ps: igawk.1
+ -groff -man $(srcdir)/igawk.1 > igawk.1.ps
+
+awkcard.tr: awkcard.in
+ sed 's:SRCDIR:$(srcdir):' < $(srcdir)/awkcard.in > awkcard.tr
+
+awkcard.ps: $(CARDFILES)
+ $(TROFF) $(CARDSRC) | $(SEDME) | cat $(srcdir)/setter.outline - > awkcard.ps
+
+awkcard.nc: $(CARDFILES)
+ $(TROFF) $(CARDSRC_N) | $(SEDME) | cat $(srcdir)/setter.outline - > awkcard.ps && touch awkcard.nc
+
+clean:
+ rm -f *.ps *~ awkcard.nc
+
diff --git a/contrib/awk/doc/Makefile.in b/contrib/awk/doc/Makefile.in
index edcf404..555450d 100644
--- a/contrib/awk/doc/Makefile.in
+++ b/contrib/awk/doc/Makefile.in
@@ -1,112 +1,450 @@
-# Makefile for GNU Awk documentation.
+# Makefile.in generated automatically by automake 1.4a from Makefile.am
+
+# Copyright 1994, 1995, 1996, 1997, 1998, 1999, 2000
+# Free Software Foundation, Inc.
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+SHELL = @SHELL@
+
+srcdir = @srcdir@
+top_srcdir = @top_srcdir@
+VPATH = @srcdir@
+prefix = @prefix@
+exec_prefix = @exec_prefix@
+
+bindir = @bindir@
+sbindir = @sbindir@
+libexecdir = @libexecdir@
+datadir = @datadir@
+sysconfdir = @sysconfdir@
+sharedstatedir = @sharedstatedir@
+localstatedir = @localstatedir@
+libdir = @libdir@
+infodir = @infodir@
+mandir = @mandir@
+includedir = @includedir@
+oldincludedir = /usr/include
+
+pkgdatadir = $(datadir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+
+top_builddir = ..
+
+ACLOCAL = @ACLOCAL@
+AUTOCONF = @AUTOCONF@
+AUTOMAKE = @AUTOMAKE@
+AUTOHEADER = @AUTOHEADER@
+
+INSTALL = @INSTALL@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_FLAG =
+transform = @program_transform_name@
+
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+
+@SET_MAKE@
+AMDEP = @AMDEP@
+AMTAR = @AMTAR@
+AWK = @AWK@
+CATALOGS = @CATALOGS@
+CATOBJEXT = @CATOBJEXT@
+CC = @CC@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CXX = @CXX@
+CXXCPP = @CXXCPP@
+DATADIRNAME = @DATADIRNAME@
+DEPDIR = @DEPDIR@
+GENCAT = @GENCAT@
+GMOFILES = @GMOFILES@
+GMSGFMT = @GMSGFMT@
+GT_NO = @GT_NO@
+GT_YES = @GT_YES@
+INCLUDE_LOCALE_H = @INCLUDE_LOCALE_H@
+INSTOBJEXT = @INSTOBJEXT@
+INTLDEPS = @INTLDEPS@
+INTLLIBS = @INTLLIBS@
+INTLOBJS = @INTLOBJS@
+LN_S = @LN_S@
+MKINSTALLDIRS = @MKINSTALLDIRS@
+MSGFMT = @MSGFMT@
+PACKAGE = @PACKAGE@
+POFILES = @POFILES@
+POSUB = @POSUB@
+RANLIB = @RANLIB@
+SOCKET_LIBS = @SOCKET_LIBS@
+U = @U@
+USE_INCLUDED_LIBINTL = @USE_INCLUDED_LIBINTL@
+USE_NLS = @USE_NLS@
+VERSION = @VERSION@
+YACC = @YACC@
+install_sh = @install_sh@
+l = @l@
+
+#
+# doc/Makefile.am --- automake input file for gawk
+#
+# Copyright (C) 2000, 2001 the Free Software Foundation, Inc.
#
-# Copyright (C) 1993-2000 the Free Software Foundation, Inc.
-#
# This file is part of GAWK, the GNU implementation of the
# AWK Programming Language.
-#
+#
# GAWK is free software; you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
# the Free Software Foundation; either version 2 of the License, or
# (at your option) any later version.
-#
+#
# GAWK is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
-#
+#
# You should have received a copy of the GNU General Public License
# along with this program; if not, write to the Free Software
# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA
+#
-SHELL = /bin/sh
-srcdir = @srcdir@
-VPATH = @srcdir@
+info_TEXINFOS = gawk.texi gawkinet.texi
-INSTALL = @INSTALL@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_DATA = @INSTALL_DATA@
+man_MANS = gawk.1 igawk.1
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-binprefix =
-manprefix =
+EXTRA_DIST = ChangeLog README.card ad.block setter.outline \
+ awkcard.in awkforai.txt texinfo.tex cardfonts \
+ macros colors no.colors $(man_MANS) \
+ uf002331.eps uf002331.jpg lflashlight.eps rflashlight.eps \
+ statist.jpg statist.eps
-bindir = @bindir@
-libdir = @libdir@
-mandir = @mandir@/man1
-manext = .1
-infodir = @infodir@
-datadir = @datadir@/awk
-TEXI2DVI = texi2dvi
-TEX = tex
-MAKEINFO = makeinfo --no-split
+MAKEINFO = @MAKEINFO@ --no-split
+
TROFF = groff -t -Tps
SEDME = sed -e "s/^level0 restore/level0 restore flashme 100 72 moveto (Copyright `date '+%m-%d-%y %T'`, FSF, Inc. (all)) show/" \
-e "s/^\/level0 save def/\/level0 save def 30 -48 translate/"
-DOCS= gawk.1 igawk.1 gawk.texi
-
-TEXFILES= gawk.aux gawk.cp gawk.cps gawk.fn gawk.fns gawk.ky gawk.kys \
- gawk.pg gawk.pgs gawk.toc gawk.tp gawk.tps gawk.vr gawk.vrs
-
-ALLDOC= gawk.dvi $(TEXFILES) gawk.log awkcard.tr
CARDSRC = $(srcdir)/macros $(srcdir)/cardfonts $(srcdir)/colors awkcard.tr
CARDSRC_N = $(srcdir)/macros $(srcdir)/cardfonts $(srcdir)/no.colors awkcard.tr
-CARDFILES= $(CARDSRC) ad.block awkcard.in setter.outline
+CARDFILES = $(CARDSRC) ad.block awkcard.in setter.outline
# Use this if your troff can correctly handle macros from 'colors' file
AWKCARD = awkcard.ps
+subdir = doc
+mkinstalldirs = $(SHELL) $(top_srcdir)/mkinstalldirs
+CONFIG_HEADER = ../config.h
+CONFIG_CLEAN_FILES =
+DIST_SOURCES =
+TEXI2DVI = texi2dvi
+INFO_DEPS = gawk.info gawkinet.info
+DVIS = gawk.dvi gawkinet.dvi
+TEXINFOS = gawk.texi gawkinet.texi
+man1dir = $(mandir)/man1
+MANS = $(man_MANS)
-# Uncomment the following definition of AWKCARD if your troff can produce
-# Postscript but still has troubles with macros from 'colors'. As this
-# is not groff you will have to change TROFF macro as well. Do not forget
-# to ensure that awkcard.tr is processed by tbl.
-#AWKCARD = awkcard.nc
+NROFF = nroff
+DIST_COMMON = ChangeLog Makefile.am Makefile.in texinfo.tex
-all: $(DOCS) info
-install: $(mandir)/gawk$(manext) $(mandir)/igawk$(manext) $(infodir)/gawk.info
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-$(infodir)/gawk.info::
- -if test -f gawk.info; then d=.; \
- else d=$(srcdir); fi; \
- if [ -f $(infodir)/dir -a -f $(infodir)/gawk.info ] \
- && cmp $$d/gawk.info $(infodir)/gawk.info > /dev/null \
- && grep '(gawk)' $(infodir)/dir > /dev/null; then \
- exit 0; \
- fi; \
- $(INSTALL_DATA) $$d/gawk.info $(infodir)/gawk.info ; \
- if $(SHELL) -c 'install-info --version' > /dev/null 2>&1 ; \
- then install-info --info-dir=$(infodir) gawk.info ; \
- else true ; fi; exit 0
+GZIP_ENV = --best
+all: all-redirect
+.SUFFIXES:
+.SUFFIXES: .dvi .info .ps .texi .texinfo .txi
+$(srcdir)/Makefile.in: Makefile.am $(top_srcdir)/configure.in $(ACLOCAL_M4)
+ cd $(top_srcdir) && $(AUTOMAKE) --gnu doc/Makefile
-$(mandir)/gawk$(manext):: gawk.1
- $(INSTALL_DATA) $(srcdir)/gawk.1 $(mandir)/gawk$(manext)
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ cd $(top_builddir) \
+ && CONFIG_FILES=$(subdir)/$@ CONFIG_HEADERS= $(SHELL) ./config.status
-$(mandir)/igawk$(manext):: igawk.1
- $(INSTALL_DATA) $(srcdir)/igawk.1 $(mandir)/igawk$(manext)
-uninstall:
- rm -f $(mandir)/gawk$(manext) $(mandir)/igawk$(manext) $(infodir)/gawk.info*
+gawk.info: gawk.texi
+gawk.dvi: gawk.texi
-dvi: gawk.dvi
-gawk.dvi: gawk.texi
- -TEXINPUTS=$(srcdir):$$TEXINPUTS $(TEXI2DVI) $(srcdir)/gawk.texi
+gawkinet.info: gawkinet.texi
+gawkinet.dvi: gawkinet.texi
-info: gawk.info
-gawk.info: gawk.texi
- $(MAKEINFO) $(srcdir)/gawk.texi
+DVIPS = dvips
+
+.texi.info:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+
+.texi.dvi:
+ TEXINPUTS=$(srcdir):$$TEXINPUTS \
+ MAKEINFO='$(MAKEINFO) -I $(srcdir)' $(TEXI2DVI) $<
+
+.texi:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+
+.texinfo.info:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+
+.texinfo:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+
+.texinfo.dvi:
+ TEXINPUTS=$(srcdir):$$TEXINPUTS \
+ MAKEINFO='$(MAKEINFO) -I $(srcdir)' $(TEXI2DVI) $<
+
+.txi.info:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+
+.txi.dvi:
+ TEXINPUTS=$(srcdir):$$TEXINPUTS \
+ MAKEINFO='$(MAKEINFO) -I $(srcdir)' $(TEXI2DVI) $<
+
+.txi:
+ @cd $(srcdir) && rm -f $@ $@-[0-9] $@-[0-9][0-9]
+ cd $(srcdir) \
+ && $(MAKEINFO) `echo $< | sed 's,.*/,,'`
+.dvi.ps:
+ $(DVIPS) $< -o $@
+
+install-info-am: $(INFO_DEPS)
+ @$(NORMAL_INSTALL)
+ $(mkinstalldirs) $(DESTDIR)$(infodir)
+ @list='$(INFO_DEPS)'; \
+ for file in $$list; do \
+ d=$(srcdir); \
+ for ifile in `CDPATH=: && cd $$d && echo $$file $$file-[0-9] $$file-[0-9][0-9]`; do \
+ if test -f $$d/$$ifile; then \
+ echo " $(INSTALL_DATA) $$d/$$ifile $(DESTDIR)$(infodir)/$$ifile"; \
+ $(INSTALL_DATA) $$d/$$ifile $(DESTDIR)$(infodir)/$$ifile; \
+ else : ; fi; \
+ done; \
+ done
+ @$(POST_INSTALL)
+ @if $(SHELL) -c 'install-info --version | sed 1q | fgrep -s -v -i debian' >/dev/null 2>&1; then \
+ list='$(INFO_DEPS)'; \
+ for file in $$list; do \
+ echo " install-info --info-dir=$(DESTDIR)$(infodir) $(DESTDIR)$(infodir)/$$file";\
+ install-info --info-dir=$(DESTDIR)$(infodir) $(DESTDIR)$(infodir)/$$file || :;\
+ done; \
+ else : ; fi
+
+uninstall-info:
+ $(PRE_UNINSTALL)
+ @if $(SHELL) -c 'install-info --version | sed 1q | fgrep -s -v -i debian' >/dev/null 2>&1; then \
+ list='$(INFO_DEPS)'; \
+ for file in $$list; do \
+ echo " install-info --info-dir=$(DESTDIR)$(infodir) --remove $(DESTDIR)$(infodir)/$$file"; \
+ install-info --info-dir=$(DESTDIR)$(infodir) --remove $(DESTDIR)$(infodir)/$$file; \
+ done; \
+ else :; fi
+ @$(NORMAL_UNINSTALL)
+ @list='$(INFO_DEPS)'; \
+ for file in $$list; do \
+ (if cd $(DESTDIR)$(infodir); then \
+ echo " rm -f $$file $$file-[0-9] $$file-[0-9][0-9])"; \
+ rm -f $$file $$file-[0-9] $$file-[0-9][0-9]; \
+ else :; fi); \
+ done
+
+dist-info: $(INFO_DEPS)
+ list='$(INFO_DEPS)'; \
+ for base in $$list; do \
+ d=$(srcdir); \
+ for file in `CDPATH=: && cd $$d && eval echo $$base*`; do \
+ test -f $(distdir)/$$file \
+ || cp -p $$d/$$file $(distdir)/$$file; \
+ done; \
+ done
+
+mostlyclean-aminfo:
+ -rm -f gawk.aux gawk.cp gawk.cps gawk.dvi gawk.fn gawk.fns gawk.pgs \
+ gawk.ky gawk.kys gawk.ps gawk.log gawk.pg gawk.toc gawk.tp \
+ gawk.tps gawk.vr gawk.vrs gawk.op gawk.tr gawk.cv gawk.cn \
+ gawk.cm gawk.ov gawkinet.aux gawkinet.cp gawkinet.cps \
+ gawkinet.dvi gawkinet.fn gawkinet.fns gawkinet.pgs \
+ gawkinet.ky gawkinet.kys gawkinet.ps gawkinet.log gawkinet.pg \
+ gawkinet.toc gawkinet.tp gawkinet.tps gawkinet.vr \
+ gawkinet.vrs gawkinet.op gawkinet.tr gawkinet.cv gawkinet.cn \
+ gawkinet.cm gawkinet.ov
+
+clean-aminfo:
+
+distclean-aminfo:
+
+maintainer-clean-aminfo:
+ cd $(srcdir) && for i in $(INFO_DEPS); do \
+ rm -f $$i; \
+ if test "`echo $$i-[0-9]*`" != "$$i-[0-9]*"; then \
+ rm -f $$i-[0-9]*; \
+ fi; \
+ done
+
+install-man1:
+ $(mkinstalldirs) $(DESTDIR)$(man1dir)
+ @list='$(man1_MANS)'; \
+ l2='$(man_MANS)'; for i in $$l2; do \
+ case "$$i" in \
+ *.1*) list="$$list $$i" ;; \
+ esac; \
+ done; \
+ for i in $$list; do \
+ if test -f $(srcdir)/$$i; then file=$(srcdir)/$$i; \
+ else file=$$i; fi; \
+ ext=`echo $$i | sed -e 's/^.*\\.//'`; \
+ inst=`echo $$i | sed -e 's/\\.[0-9a-z]*$$//'`; \
+ inst=`echo $$inst | sed -e 's/^.*\///'`; \
+ inst=`echo $$inst | sed '$(transform)'`.$$ext; \
+ echo " $(INSTALL_DATA) $$file $(DESTDIR)$(man1dir)/$$inst"; \
+ $(INSTALL_DATA) $$file $(DESTDIR)$(man1dir)/$$inst; \
+ done
+
+uninstall-man1:
+ @list='$(man1_MANS)'; \
+ l2='$(man_MANS)'; for i in $$l2; do \
+ case "$$i" in \
+ *.1*) list="$$list $$i" ;; \
+ esac; \
+ done; \
+ for i in $$list; do \
+ ext=`echo $$i | sed -e 's/^.*\\.//'`; \
+ inst=`echo $$i | sed -e 's/\\.[0-9a-z]*$$//'`; \
+ inst=`echo $$inst | sed -e 's/^.*\///'`; \
+ inst=`echo $$inst | sed '$(transform)'`.$$ext; \
+ echo " rm -f $(DESTDIR)$(man1dir)/$$inst"; \
+ rm -f $(DESTDIR)$(man1dir)/$$inst; \
+ done
+install-man: $(MANS)
+ @$(NORMAL_INSTALL)
+ $(MAKE) $(AM_MAKEFLAGS) install-man1
+uninstall-man:
+ @$(NORMAL_UNINSTALL)
+ $(MAKE) $(AM_MAKEFLAGS) uninstall-man1
+tags: TAGS
+TAGS:
+
+
+distdir = $(top_builddir)/$(PACKAGE)-$(VERSION)/$(subdir)
+
+distdir: $(DISTFILES)
+ @for file in $(DISTFILES); do \
+ d=$(srcdir); \
+ if test -d $$d/$$file; then \
+ cp -pR $$d/$$file $(distdir) \
+ || exit 1; \
+ else \
+ test -f $(distdir)/$$file \
+ || cp -p $$d/$$file $(distdir)/$$file \
+ || exit 1; \
+ fi; \
+ done
+ $(MAKE) $(AM_MAKEFLAGS) top_distdir="$(top_distdir)" distdir="$(distdir)" dist-info
+info-am: $(INFO_DEPS)
+info: info-am
+dvi-am: $(DVIS)
+dvi: dvi-am
+check-am: all-am
+check: check-am
+installcheck-am:
+installcheck: installcheck-am
+install-exec-am:
+install-exec: install-exec-am
+
+install-data-am: install-info-am install-man
+install-data: install-data-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+install: install-am
+uninstall-am: uninstall-info uninstall-man
+uninstall: uninstall-am
+all-am: Makefile $(INFO_DEPS) $(MANS)
+all-redirect: all-am
+install-strip:
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_STRIP_FLAG=-s install
+installdirs:
+ $(mkinstalldirs) $(DESTDIR)$(infodir) $(DESTDIR)$(mandir)/man1
+
+
+mostlyclean-generic:
-postscript: dvi gawk.1 igawk.1 $(AWKCARD)
+clean-generic:
+
+distclean-generic:
+ -rm -f Makefile $(CONFIG_CLEAN_FILES)
+ -rm -f config.cache config.log stamp-h stamp-h[0-9]*
+
+maintainer-clean-generic:
+ -rm -f Makefile.in
+mostlyclean-am: mostlyclean-aminfo mostlyclean-generic
+
+mostlyclean: mostlyclean-am
+
+clean-am: clean-aminfo clean-generic mostlyclean-am
+
+clean: clean-am
+
+distclean-am: distclean-aminfo distclean-generic clean-am
+
+distclean: distclean-am
+
+maintainer-clean-am: maintainer-clean-aminfo maintainer-clean-generic \
+ distclean-am
+ @echo "This command is intended for maintainers to use;"
+ @echo "it deletes files that may require special tools to rebuild."
+
+maintainer-clean: maintainer-clean-am
+
+.PHONY: install-info-am uninstall-info mostlyclean-aminfo \
+distclean-aminfo clean-aminfo maintainer-clean-aminfo install-man1 \
+uninstall-man1 install-man uninstall-man tags distdir info-am info \
+dvi-am dvi check check-am installcheck-am installcheck install-exec-am \
+install-exec install-data-am install-data install-am install \
+uninstall-am uninstall all-redirect all-am all install-strip \
+installdirs mostlyclean-generic distclean-generic clean-generic \
+maintainer-clean-generic clean mostlyclean distclean maintainer-clean
+
+
+# Uncomment the following definition of AWKCARD if your troff can produce
+# Postscript but still has troubles with macros from 'colors'. As this
+# is not groff you will have to change TROFF macro as well. Do not forget
+# to ensure that awkcard.tr is processed by tbl.
+#AWKCARD = awkcard.nc
+
+postscript: gawk.ps gawkinet.ps gawk.1.ps igawk.1.ps $(AWKCARD)
+
+gawk.ps: gawk.dvi
+ dvips -o gawk.ps gawk.dvi
+
+gawkinet.ps: gawkinet.dvi
+ dvips -o gawkinet.ps gawkinet.dvi
+
+gawk.1.ps: gawk.1
-groff -man $(srcdir)/gawk.1 > gawk.1.ps
+
+igawk.1.ps: igawk.1
-groff -man $(srcdir)/igawk.1 > igawk.1.ps
- dvips -o gawk.ps gawk.dvi
awkcard.tr: awkcard.in
sed 's:SRCDIR:$(srcdir):' < $(srcdir)/awkcard.in > awkcard.tr
@@ -118,12 +456,8 @@ awkcard.nc: $(CARDFILES)
$(TROFF) $(CARDSRC_N) | $(SEDME) | cat $(srcdir)/setter.outline - > awkcard.ps && touch awkcard.nc
clean:
- rm -f *.ps $(ALLDOC) *~ awkcard.nc
-
-distclean: clean
- rm -f Makefile
+ rm -f *.ps *~ awkcard.nc
-maintainer-clean: distclean
- @echo "This command is intended for maintainers to use; it"
- @echo "deletes files that may require special tools to rebuild."
- rm -f gawk.info
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/contrib/awk/doc/ad.block b/contrib/awk/doc/ad.block
index d31f5d5..ee99a5a 100644
--- a/contrib/awk/doc/ad.block
+++ b/contrib/awk/doc/ad.block
@@ -1,7 +1,7 @@
.\" AWK Reference Card --- Arnold Robbins, arnold@gnu.org
.\" This file is the Ad block (included in cover)
.\"
-.\" Copyright (C) 1996, 98 Free Software Foundation, Inc.
+.\" Copyright (C) 1996, 1998, 2000, 2001 Free Software Foundation, Inc.
.\"
.\" Permission is granted to make and distribute verbatim copies of
.\" this reference card provided the copyright notice and this permission
@@ -37,10 +37,9 @@ Fax (including Japan): +1-617-542-2652
E-mail: gnu@gnu.org
URL: http://www.gnu.org
-.ce 7
+.ce 5
.ft HB
-\*(CGFree Software
-Source Distributions on CD-ROM
+\*(CGSource Distributions on CD-ROM
Deluxe Distributions
Emacs, Gawk, Make and GDB Manuals
Emacs and GDB References\*(CX
diff --git a/contrib/awk/doc/awkcard.in b/contrib/awk/doc/awkcard.in
index ac1e8e5..43f73fb 100644
--- a/contrib/awk/doc/awkcard.in
+++ b/contrib/awk/doc/awkcard.in
@@ -1,6 +1,6 @@
.\" AWK Reference Card --- Arnold Robbins, arnold@gnu.org
.\"
-.\" Copyright (C) 1996, 1997, 1998, 1999, 2000 Free Software Foundation, Inc.
+.\" Copyright (C) 1996-2001 Free Software Foundation, Inc.
.\"
.\" Permission is granted to make and distribute verbatim copies of
.\" this reference card provided the copyright notice and this permission
@@ -45,57 +45,59 @@
.ES
.in +.2i
.nf
-\*(FRAWK Program Execution 4
-Action Statements 7
-Arrays 9
-Bug Reports 15
+\*(FRAction Statements 7
+Arrays 11
+Awk Program Execution 4
+Bit Manipulation Functions (\*(GK) 16
+Bug Reports 2
+Closing Redirections 12
Command Line Arguments (standard) 2
Command Line Arguments (\*(GK) 3
Command Line Arguments (\*(MK) 4
-Conversions And Comparisons 10
-Copying Permissions 16
+Conversions And Comparisons 9
+Copying Permissions 18
Definitions 2
-Environment Variables 16
-Escape Sequences 7
-Expressions 9
+Dynamic Extensions (\*(GK) 18
+Environment Variables (\*(GK) 18
+Escape Sequences 8
+Expressions 11
Fields 6
-FTP Information 16
-Historical Features (\*(GK) 16
-Input Control 11
+FTP/HTTP Information 18
+Historical Features (\*(GK) 18
+Input Control 12
+Internationalization (\*(GK) 16
Lines And Statements 5
-.ig
-Localization 10
-..
-Numeric Functions 13
-Output Control 11
+Localization (\*(GK) 17
+Numeric Functions 14
+Output Control 12
Pattern Elements 7
POSIX Character Classes (\*(GK) 6
-Printf Formats 12
+Printf Formats 13
Records 6
Regular Expressions 5
-Special Filenames 13
-String Functions 14
-Time Functions (\*(GK) 15
-User-defined Functions 15
+Special Filenames 14
+String Functions 15
+Time Functions (\*(GK) 16
+User-defined Functions 17
Variables 8\*(CX
.in -.2i
.EB "\s+2\f(HBCONTENTS\*(FR\s0"
-.sp
+.sp .4
.TD
.fi
-\*(CD\*(FRThis reference card was written by Arnold Robbins.
-Brian Kernighan and Michael Brennan reviewed it; we thank them
-for their help.
-.sp
+\*(CD\*(FRArnold Robbins wrote this reference card.
+We thank
+Brian Kernighan and Michael Brennan who reviewed it.
+.sp .4
.SL
-.sp
+.sp .4
.so SRCDIR/ad.block
.\" a subtlety here; this line changes color. We rely on it
.\" also to provide a blank line.
\*(CD
.SL
.nf
-\*(FR\(co Copyright 1996-2000, Free Software Foundation
+\*(FR\(co Copyright 1996-2001, Free Software Foundation
59 Temple Place \(em Suite 330
Boston, MA 02111-1307 USA
.nf
@@ -124,7 +126,7 @@ Several type faces are used to clarify the meaning:
.fi
.in +\n(INu
.ti -\n(INu
-\(bu\|\^\*(FI\*(IN\fP is used to indicate user input and for syntactic
+\(bu\|\^\*(FI\*(IN\fP is used for emphasis, to indicate user input and for syntactic
placeholders, such as \*(FIvariable\fP or \*(FIaction\fP.
.in -\n(INu
.br
@@ -137,6 +139,8 @@ placeholders, such as \*(FIvariable\fP or \*(FIaction\fP.
\*(FC1.4e2\*(FR
or
\*(FC4.1E5\*(FR.
+\*(CBNumbers may also be given in octal or hexadecimal: e.g.,
+\*(FC011\*(FR or \*(FC0x11\*(FR.\*(CD
.sp .5
\*(FIescape sequences\fP \- a special sequence of characters beginning
with a backslash, used to describe otherwise unprintable characters.
@@ -160,8 +164,10 @@ UNIX reference manual.
.sp .5
\*(FIrule\fP \- a pattern-action pair, where the pattern or action may
be missing.\*(CX
-.EB \s+2\f(HBDEFINITIONS\*(FR\s0
+.EB "\s+2\f(HBDEFINITIONS\*(FR\s0"
+.\"
+.\"
.\" --- Command Line Arguments
.ES
.fi
@@ -176,7 +182,7 @@ expand;
l lw(2.2i).
\*(FC\-F \*(FIfs\*(FR use \*(FIfs\fP for the input field separator.
\*(FC\-v\*(FI var\*(FC\^=\^\*(FIval\*(FR T{
-assign the value \*(FIval\*(FR, to the variable \*(FIvar\*(FR,
+assign the value \*(FIval\*(FR to the variable \*(FIvar\*(FR
before execution of the program begins. Such
variable values are available to the \*(FCBEGIN\fP rule.
T}
@@ -201,79 +207,145 @@ l lw(2.2i).
.TE
.EB "\s+2\f(HBCOMMAND LINE ARGUMENTS (standard)\*(FR\s0"
+.\" --- Bug Reports
+.ES
+.fi
+\*(CDIf you find a bug in this reference card, please report it via electronic
+mail to \*(FCbug-gawk@gnu.org\*(FR.\*(CX
+.EB "\s+2\f(HBBUG REPORTS\*(FR\s0"
+
.BT
+.\"
+.\"
+.\" --- Command Line Arguments (gawk)
.ES
.fi
-\*(CDThe following options are specific to \*(GK. The \*(FC\-W\*(FR
-forms are for full POSIX compliance.
+\*(CDThe following options are specific to \*(GK.
+You may also use ``\*(FC\-W \*(FIoption\*(FR''
+for full POSIX compliance.
+Long options may abbreviated as long as the abbreviation
+remains unique.
.sp .5
.ig
.\" This option is left undocumented, on purpose.
-\*(FC\-\^\-nostalgia\*(FR
-\*(FC\-W nostalgia\*(FR%T{
+\*(FC\-\^\-nostalgia\*(FR%T{
provide a moment of nostalgia for
long time \*(AK users.
T}
..
.TS
expand, tab(%);
+l lw(1.3i).
+\*(FC\-\^\-assign \*(FIvar\*(FC\^=\^\*(FIval\*(FR%just like \*(FC\-v\fP.
+\*(FC\-\^\-field-separator \*(FIfs\*(FR%just like \*(FC\-F\fP.
+\*(FC\-\^\-file \*(FIprog-file%\*(FRjust like \*(FC\-f\fP.
+.TE
+.TS
+expand, tab(%);
ls
-l lw(1.8i).
-\*(FC\-\^\-field-separator \*(FIfs\*(FR
-%just like \*(FC\-F\fP
-\*(FC\-\^\-assign \*(FIvar\*(FC\^=\^\*(FIval\*(FR%just like \*(FC\-v\fP
-\*(FC\-\^\-file \*(FIprog-file%\*(FRjust like \*(FC\-f\fP
-\*(FC\-\^\-traditional\*(FR
-\*(FC\-\^\-compat\*(FR
-\*(FC\-W compat\*(FR
-\*(FC\-W traditional\*(FR%T{
-turn off \*(GK-specific extensions
-(\*(FC\-\^\-traditional\*(FR preferred).
-T}
-\*(FC\-\^\-copyleft\*(FR
-\*(FC\-\^\-copyright\*(FR
-\*(FC\-W copyleft\*(FR
-\*(FC\-W copyright\*(FR%T{
+l lw(2.2i).
+\*(FC\-\^\-compat\*(FR, \*(FC\-\^\-traditional\*(FR
+%T{
+disable \*(GK-specific extensions
+(the use of \*(FC\-\^\-traditional\*(FR is preferred).
+T}
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-copyleft\*(FR, \*(FC\-\^\-copyright\*(FR
+%T{
print the short version of the GNU
copyright information on \*(FCstdout\*(FR.
T}
-\*(FC\-\^\-help\*(FR
-\*(FC\-\^\-usage\*(FR
-\*(FC\-W help\*(FR
-\*(FC\-W usage\*(FR%T{
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-dump-variables\*(FR[\*(FC=\*(FIfile\*(FR]
+%T{
+Print a sorted list of global variables,
+their types and final values to
+\*(FIfile\*(FR.
+If no \*(FIfile\*(FR
+is provided, \*(FCgawk\*(FR
+uses \*(FCawkvars.out\*(FR.
+T}
+\*(FC\-\^\-gen\-po\*(FR%T{
+process the program and print a GNU \*(FCgettext\*(FR
+format \*(FC\&.po\*(FR format file on standard output,
+containing the text of all strings that were marked
+for localization.
+T}
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-help\*(FR, \*(FC\-\^\-usage\*(FR
+%T{
print a short summary of the available
options on \*(FCstdout\*(FR, then exit zero.
T}
-\*(FC\-\^\-lint\*(FR
-\*(FC\-W lint\*(FR%T{
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-lint\*(FR[\*(FC=fatal\*(FR]
+%T{
warn about constructs that are dubious
or non-portable to other \*(AKs.
+With an optional argument of \*(FCfatal\*(FR,
+lint warnings become fatal errors.
T}
-\*(FC\-\^\-lint\-old\*(FR
-\*(FC\-W lint\-old\*(FR%T{
+.T&
+l lw(2.2i).
+\*(FC\-\^\-lint\-old\*(FR%T{
warn about constructs that are not
portable to the original version of
Unix \*(AK.
T}
-\*(FC\-\^\-posix\*(FR
-\*(FC\-W posix\*(FR%T{
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-non\-decimal\-data\*(FR
+%T{
+recognize octal and hexadecimal values in input data.
+\*(FIUse this option with great caution!\*(FR
+T}
+.T&
+l lw(2.2i).
+\*(FC\-\^\-posix\*(FR%T{
disable common and GNU extensions.
Enable \*(FIinterval expressions\*(FR in regular
expression matching (see \fHRegular
Expressions\fP below).
T}
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-profile\*(FR[\*(FC=\*(FIprof_file\*(FR]
+%T{
+send profiling data to \*(FIprof_file\*(FR
+(default: \*(FCawkprof.out\*(FR).
+With \*(FIgawk\*(FR,
+the profile is just a ``pretty printed'' version of the program.
+With \*(FIpgawk\*(FR,
+the profile contains execution counts in the left margin
+of each statement in the program.
+T}
+.T&
+ls
+l lw(2.2i).
\*(FC\-\^\-re\-interval\*(FR
-\*(FC\-W re\-interval\*(FR%T{
+%T{
enable \*(FIinterval expressions\*(FR in regular
expression matching (see \fHRegular
Expressions\fP below). Useful if
\*(FC\-\^\-posix\*(FR is not specified.
T}
+.T&
+ls
+l lw(2.2i).
\*(FC\-\^\-source '\*(FItext\*(FC'\*(FR
-\*(FC\-W source '\*(FItext\*(FC'\*(FR%use \*(FItext\*(FR as AWK program source code.
-\*(FC\-\^\-version\*(FR
-\*(FC\-W version\*(FR%T{
+%use \*(FItext\*(FR as AWK program source code.
+\*(FC\-\^\-version\*(FR%T{
print version information on \*(FCstdout\fP
and exit zero.
T}
@@ -281,16 +353,25 @@ T}
.sp .5
.fi
In compatibility mode,
-any other options are flagged as illegal, but are otherwise ignored.
+any other options are flagged as invalid, but are otherwise ignored.
In normal operation, as long as program text has been supplied, unknown
options are passed on to the AWK program in
\*(FCARGV\*(FR
for processing. This is most useful for running AWK
-programs via the \*(FC#!\*(FR executable interpreter mechanism.\*(CB
+programs via the \*(FC#!\*(FR executable interpreter mechanism.
+.sp .5
+\*(FIpgawk\fP accepts two signals.
+\*(FCSIGUSR1\fP causes it to dump a profile and function call stack to the
+profile file. It then continues to run.
+\*(FCSIGHUP\fP
+causes it to dump the profile and function call stack and then exit.\*(CB
.EB "\s+2\f(HBCOMMAND LINE ARGUMENTS (\*(GK\f(HB)\*(FR\s0"
.BT
+.\"
+.\"
+.\" --- Command Line Arguments (mawk)
.ES
.fi
\*(CDThe following options are specific to \*(MK.
@@ -309,7 +390,7 @@ options are processed. Useful with \*(FC#!\fP.
T}
\*(FC\-W interactive\*(FR T{
unbuffer \*(FCstdout\fP and line buffer \*(FCstdin\fP.
-Lines are always records, ignoring \*(FCRS\fP
+Lines are always records, ignoring \*(FCRS\fP.
T}
\*(FC\-W posix_space\*(FR T{
\*(FC\en\*(FR separates fields when \*(FCRS = "\^"\fP.
@@ -396,10 +477,10 @@ If a program only has an \*(FCEND\fP rule, the input will be read.
.\" --- Lines And Statements
.ES
.fi
-\*(CDAWK is a line oriented language. The pattern comes first, and then the
+\*(CDAWK is a line-oriented language. The pattern comes first, and then the
action. Action statements are enclosed in \*(FC{\fP and \*(FC}\*(FR.
Either the pattern or the action may be missing, but
-not both. If the pattern is missing, the action will be
+not both. If the pattern is missing, the action is
executed for every input record.
A missing action is equivalent to
.sp .5
@@ -421,7 +502,7 @@ are automatically continued.
Lines ending in \*(FCdo\fP or \*(FCelse\fP
also have their statements automatically continued on the following line.
In other cases, a line can be continued by ending it with a ``\e'',
-in which case the newline will be ignored. However, a ``\e'' after a
+in which case the newline is ignored. However, a ``\e'' after a
\*(FC#\*(FR is not special.
.sp .5
Multiple statements may be put on one line by separating them with a ``;''.
@@ -465,8 +546,8 @@ _
\*(FC\e>\*(FR~end of a word
\*(FC\ew\*(FR~any word-constituent character
\*(FC\eW\*(FR~any non-word-constituent character
-\*(FC\e`\*(FR~beginning of a buffer (string)
-\*(FC\e'\*(FR~end of a buffer (string)\*(CD
+\*(FC\e`\*(FR~beginning of a string
+\*(FC\e'\*(FR~end of a string\*(CD
\*(FIr\*(FC*\*(FR~zero or more occurrences of \*(FIr\*(FR
\*(FIr\*(FC+\*(FR~one or more occurrences of \*(FIr\*(FR
\*(FIr\*(FC?\*(FR~zero or one occurrences of \*(FIr\*(FR
@@ -490,7 +571,7 @@ this feature in \*(GK.\*(CX
.fi
\*(CDIn regular expressions, within character ranges
(\*(FC[\*(FR...\*(FC]\*(FR),
-the notation \*(FC[[:\*(FIclass\*(FC:]]\*(FR defines characters classes:
+the notation \*(FC[[:\*(FIclass\*(FC:]]\*(FR defines character classes:
.sp .5
.TS
center, tab(~);
@@ -500,9 +581,12 @@ lp8 lp8 lp8 lp8.
\*(FCblank\*(FR~space or tab~\*(FCpunct\*(FR~punctuation
\*(FCcntrl\*(FR~control~\*(FCspace\*(FR~whitespace
\*(FCdigit\*(FR~decimal~\*(FCupper\*(FR~upper-case
-\*(FCgraph\*(FR~non-spaces~\*(FCxdigit\*(FR~hexadecimal\*(CB
+\*(FCgraph\*(FR~non-spaces~\*(FCxdigit\*(FR~hexadecimal
.TE
.fi
+.sp .5
+Recognition of these character classes is disabled
+when \*(FC\-\-traditional\*(FR is supplied.\*(CB
.EB "\s+2\f(HBPOSIX CHARACTER CLASSES (\*(GK\f(HB)\*(FR\s0"
.\" --- Records
@@ -515,11 +599,11 @@ If \*(FCRS\fP is any single character, that character separates records.
\*(CLOtherwise, \*(FCRS\fP is a regular expression.
\*(CR(Not \*(NK.)\*(CL
Text in the input that matches this
-regular expression will separate the record.
+regular expression separates the record.
\*(CB\*(GK sets \*(FCRT\*(FR to the value of the
input text that matched the regular expression.
The value of \*(FCIGNORECASE\fP
-will also affect how records are separated when
+also affects how records are separated when
\*(FCRS\fP is a regular expression.\*(CD
If \*(FCRS\fP is set to the null string,
then records are separated by one or more blank lines.
@@ -529,7 +613,7 @@ a field separator, in addition to whatever value
\*(FCFS\fP may have.
\*(CB\*(MK does not apply exceptional rules to \*(FCFS\fP
when \*(FCRS = "\^"\fP.\*(CX
-.EB \s+2\f(HBRECORDS\*(FR\s0
+.EB "\s+2\f(HBRECORDS\*(FR\s0"
.\" --- Fields
.ES
@@ -548,13 +632,13 @@ by runs of spaces and/or tabs
\*(CLand/or newlines\*(CD.
Leading and trailing whitespace are ignored.
\*(CBThe value of \*(FCIGNORECASE\fP
-will also affect how fields are split when
+also affects how fields are split when
\*(FCFS\fP is a regular expression.\*(CD
.sp .5
\*(CBIf the \*(FCFIELDWIDTHS\fP
-variable is set to a space separated list of numbers, each field is
+variable is set to a space-separated list of numbers, each field is
expected to have a fixed width, and \*(GK
-will split up the record using the specified widths.
+splits up the record using the specified widths.
The value of \*(FCFS\fP is ignored.
Assigning a new value to \*(FCFS\fP
overrides the use of \*(FCFIELDWIDTHS\*(FR,
@@ -570,15 +654,15 @@ is set to the total number of fields in the input record.
.sp .5
References to non-existent fields (i.e., fields after \*(FC$NF\*(FR)
produce the null-string. However, assigning to a non-existent field
-(e.g., \*(FC$(NF+2) = 5\*(FR) will increase the value of
-\*(FCNF\*(FR, create any intervening fields with the null string as their value,
-and cause the value of \*(FC$0\fP
+(e.g., \*(FC$(NF+2) = 5\*(FR) increases the value of
+\*(FCNF\*(FR, creates any intervening fields with the null string as their value,
+and causes the value of \*(FC$0\fP
to be recomputed with the fields being separated by the
value of \*(FCOFS\*(FR.
References to negative numbered fields cause a fatal error.
Decreasing the value of \*(FCNF\fP causes the trailing fields to be lost
\*(CR(not \*(NK).\*(CX
-.EB \s+2\f(HBFIELDS\*(FR\s0
+.EB "\s+2\f(HBFIELDS\*(FR\s0"
.BT
@@ -614,26 +698,79 @@ It does not combine with any other pattern expression.\*(CX
.\" --- Action Statements
.ES
-.nf
-\*(CD\*(FCif (\*(FIcondition\*(FC) \*(FIstatement\*(FR [ \*(FCelse\*(FI statement \*(FR]
-\*(FCwhile (\*(FIcondition\*(FC) \*(FIstatement \*(FR
-\*(FCdo \*(FIstatement \*(FCwhile (\*(FIcondition\*(FC)\*(FR
-\*(FCfor (\*(FIexpr1\*(FC; \*(FIexpr2\*(FC; \*(FIexpr3\*(FC) \*(FIstatement\*(FR
-\*(FCfor (\*(FIvar \*(FCin\*(FI array\*(FC) \*(FIstatement\*(FR
-.ig
-\*(CB\*(FCabort\*(FR [ \*(FIexpression\*(FR ]\*(CD
-..
-\*(FCbreak\*(FR
+.fi
+.in +.2i
+.ti -.2i
+\*(CD\*(FCbreak\*(FR
+.br
+break out of the nearest enclosing \*(FCdo\*(FR, \*(FCfor\*(FR,
+or \*(FCwhile\*(FR loop.
+.ti -.2i
\*(FCcontinue\*(FR
+.br
+skip the rest of the loop body.
+Evaluate the \*(FIcondition\*(FR
+part of the nearest enclosing \*(FCdo\*(FR or \*(FCwhile\*(FR loop,
+or go to the \*(FIincr\*(FR part of a \*(FCfor\*(FR loop.
+.ti -.2i
\*(FCdelete \*(FIarray\^\*(FC[\^\*(FIindex\^\*(FC]\*(FR
-\*(CL\*(FCdelete \*(FIarray\^\*(FR\*(CD
+.br
+delete element \*(FIindex\*(FR from array \*(FIarray\*(FR.
+.ti -.2i
+\*(CL\*(FCdelete \*(FIarray\^\*(FR
+.br
+delete all elements from array \*(FIarray\*(FR.\*(CD
+.ti -.2i
+\*(FCdo \*(FIstatement \*(FCwhile (\*(FIcondition\*(FC)\*(FR
+.br
+execute \*(FIstatement\*(FR while \*(FIcondition\*(FR is true.
+The \*(FIstatement\*(FR is always executed at least once.
+.ti -.2i
\*(FCexit\*(FR [ \*(FIexpression\*(FR ]
-\*(FCnext\*(FR
-\*(CL\*(FCnextfile\*(FR \*(CR(not \*(MK)\*(CD
-\*(FC{ \*(FIstatements \*(FC}\*(CX
+.br
+terminate input record processing.
+Execute the \*(FCEND\*(FR rule(s) if present.
+If present, \*(FIexpression\*(FR becomes \*(AK's return value.
+.ti -.2i
+\*(FCfor (\*(FIinit\*(FC; \*(FIcond\*(FC; \*(FIincr\*(FC) \*(FIstatement\*(FR
+.br
+execute \*(FIinit\*(FR.
+Evaluate \*(FIcond\*(FR.
+If it is true, execute \*(FIstatement\*(FR.
+Execute \*(FIincr\*(FR before going back to the top to
+re-evaluate \*(FIcond\*(FR.
+Any of the three may be omitted.
+A missing \*(FIcond\*(FR is considered to be true.
+.ti -.2i
+\*(FCfor (\*(FIvar \*(FCin\*(FI array\*(FC) \*(FIstatement\*(FR
+.br
+execute \*(FIstatement\*(FR once for each subscript in \*(FIarray\*(FR,
+with \*(FIvar\*(FR set to a different subscript each time through
+the loop.
+.ti -.2i
+\*(CD\*(FCif (\*(FIcondition\*(FC) \*(FIstatement1\*(FR [ \*(FCelse\*(FI statement2\*(FR ]
+.br
+if \*(FIcondition\*(FR is true, execute \*(FIstatement1\*(FR,
+otherwise execute \*(FIstatement2\*(FR. Each \*(FCelse\*(FR
+matches the closest \*(FCif\*(FR.
+.ti -.2i
+\*(FCnext\*(FR see \fHInput Control.\fP
+.ti -.2i
+\*(CL\*(FCnextfile\*(FR \*(CR(not \*(MK) \*(CLsee \fHInput Control.\fP\*(CD
+.ti -.2i
+\*(FCwhile (\*(FIcondition\*(FC) \*(FIstatement \*(FR
+.br
+while \*(FIcondition\*(FR is true, execute \*(FIstatement\*(FR.
+.ti -.2i
+\*(FC{ \*(FIstatements \*(FC}\*(FR
+.br
+a list of statements enclosed in braces can be used anywhere
+that a single statement would otherwise be used.\*(CX
+.in -.2i
.EB "\s+2\f(HBACTION STATEMENTS\*(FR\s0"
+.BT
.\" --- Escape Sequences
.ES
@@ -643,13 +780,6 @@ constants (\*(FC/.../\fP), escape sequences may be used to
generate otherwise unprintable characters. This table lists
the available escape sequences.
.sp .5
-.ig
-\*(CB\*(FCPROCINFO\fP T{
-elements of this array provide access to info
-about the running AWK program. See
-\*(AM for details.\*(CD
-T}
-..
.TS
center, tab(~);
lp8 lp8 lp8 lp8.
@@ -661,17 +791,14 @@ lp8 lp8 lp8 lp8.
\*(FC\e"\fP~double quote~\*(FC\e/\fP~forward slash\*(CX
.TE
.EB "\s+2\f(HBESCAPE SEQUENCES\*(FR\s0"
-
-
-.BT
-
+.sp .7
.\" --- Variables
.ES
.fi
.TS
expand;
l lw(2i).
-\*(FCARGC\fP T{
+\*(CD\*(FCARGC\fP T{
number of command line arguments.
T}
\*(CB\*(FCARGIND\fP T{
@@ -683,19 +810,31 @@ array of command line arguments. Indexed from
contents of \*(FCARGV\fP can control the files used
for data.
T}
+\*(CL\*(FCBINMODE\fP T{
+controls ``binary'' mode for all file I/O. Values of 1, 2, or 3,
+indicate input, output, or all files, respectively, should use binary
+I/O. \*(CR(Not \*(NK.) \*(CLApplies only to non-POSIX systems.
+\*(CBFor \*(GK, string values of \*(FC"r"\fP, or \*(FC"w"\fP specify
+that input files, or output files, respectively, should use binary I/O.
+String values of \*(FC"rw"\fP or \*(FC"wr"\fP specify that all files
+should use binary I/O. Any other string value is treated as \*(FC"rw"\fP,
+but generates a warning message.\*(CD
+T}
\*(FCCONVFMT\fP T{
conversion format for numbers, default value
is \*(FC"%.6g"\*(FR.
T}
\*(FCENVIRON\fP T{
-array containing the the current environment.
+array containing the current environment.
The array is indexed by the environment
variables, each element being the value of
that variable.
T}
\*(CB\*(FCERRNO\fP T{
-contains a string describing the error when a
-redirection or read for \*(FCgetline\*(FR fails, or if
+string describing the error if a
+\*(FCgetline\*(FR
+redirection or read
+fails, or if
\*(FCclose()\*(FR fails.
T}
\*(FCFIELDWIDTHS\fP T{
@@ -710,7 +849,7 @@ on the command line, \*(FCFILENAME\fP is ``\-''.
(unless set by \*(FCgetline\fP).
T}
\*(FCFNR\fP T{
-number of the input record in current input file.
+record number in current input file.
T}
\*(FCFS\fP T{
input field separator, a space by default
@@ -718,9 +857,18 @@ input field separator, a space by default
T}
\*(CB\*(FCIGNORECASE\fP T{
if non-zero, all regular expression and string
-operations ignore case. \*(CRIn versions of \*(GK
-prior to 3.0, \*(FCIGNORECASE\fP only affected
-regular expression operations and \*(FCindex()\*(FR.\*(CD
+operations ignore case.
+Array subscripting and \*(FCasort()\*(FR are \*(FInot\*(FR affected.
+T}
+\*(CB\*(FCLINT\fP T{
+provides dynamic control of the \*(FC\-\^\-lint\fP
+option from within an AWK program.
+When true, \*(GK
+prints lint warnings.
+When assigned the string value \*(FC"fatal"\*(FR,
+lint warnings become fatal errors, exactly like
+\*(FC\-\-lint=fatal\*(FR.
+Any other true value just prints warnings.\*(CD
T}
\*(FCNF\fP T{
number of fields in the current input record.
@@ -730,49 +878,123 @@ total number of input records seen so far.
T}
\*(FCOFMT\fP T{
output format for numbers, \*(FC"%.6g"\*(FR, by default.
-\*(CROld versions of \*(AK also used this for number
-to string conversion instead of \*(FCCONVFMT\fP.\*(CD
+\*(CROld versions of \*(AK used this for number
+to string conversion.\*(CX
T}
-\*(FCOFS\fP T{
+.TE
+.EB "\s+2\f(HBVARIABLES\*(FR\s0"
+.BT
+
+.\" --- Variables (continued)
+.ES
+.fi
+.TS
+expand;
+l lw(2i).
+\*(CD\*(FCOFS\fP T{
output field separator, a space by default.
T}
\*(FCORS\fP T{
output record separator, a newline by default.
T}
+\*(CB\*(FCPROCINFO\fP T{
+elements of this array provide access to info
+about the running AWK program. See
+\*(AM for details.\*(CD
+T}
+\*(FCRLENGTH\fP T{
+length of the string matched by \*(FCmatch()\*(FR;
+\-1 if no match.
+T}
\*(FCRS\fP T{
input record separator, a newline by default
(see \fHRecords\fP above).
T}
-\*(CB\*(FCRT\fP T{
-record terminator. \*(GK sets \*(FCRT\fP to the input
-text that matched the character or regular
-expression specified by \*(FCRS\*(FR.\*(CD
-T}
\*(FCRSTART\fP T{
index of the first character matched by
\*(FCmatch()\*(FR; 0 if no match.
T}
-\*(FCRLENGTH\fP T{
-length of the string matched by \*(FCmatch()\*(FR;
-\-1 if no match.
+\*(CB\*(FCRT\fP T{
+record terminator. \*(GK sets \*(FCRT\fP to the input
+text that matched the character or regular
+expression specified by \*(FCRS\*(FR.\*(CD
T}
\*(FCSUBSEP\fP T{
character(s) used to separate multiple subscripts
-in array elements, by default \*(FC"\e034"\*(FR. (see
-\fHArrays\fP below).\*(CX
+in array elements, by default \*(FC"\e034"\*(FR. (See
+\fHArrays\fP below).
+T}
+\*(CB\*(FCTEXTDOMAIN\fP T{
+the application's text domain for internationalization;
+used to find the localized
+translations for the program's strings.\*(CX
T}
.TE
-.EB \s+2\f(HBVARIABLES\*(FR\s0
+.EB "\s+2\f(HBVARIABLES (continued)\*(FR\s0"
+
+.\" --- Conversions and Comparisons
+.ES
+.fi
+\*(CDVariables and fields may be (floating point) numbers, strings or both.
+Context determines how the value of a variable is interpreted. If used in
+a numeric expression, it will be treated as a number, if used as a string
+it will be treated as a string.
+.sp .5
+To force a variable to be treated as a number, add 0 to it; to force it
+to be treated as a string, concatenate it with the null string.
+.sp .5
+When a string must be converted to a number, the conversion is accomplished
+using \*(FIstrtod\*(FR(3).
+A number is converted to a string by using the value of \*(FCCONVFMT\fP
+as a format string for \*(FIsprintf\*(FR(3),
+with the numeric value of the variable as the argument.
+However, even though all numbers in AWK are floating-point,
+integral values are \*(FIalways\fP converted as integers.
+.sp .5
+Comparisons are performed as follows:
+If two variables are numeric, they are compared numerically.
+If one value is numeric and the other has a string value that is a
+``numeric string,'' then comparisons are also done numerically.
+Otherwise, the numeric value is converted to a string, and a string
+comparison is performed.
+Two strings are compared, of course, as strings.
+.sp .5
+Note that string constants, such as \*(FC"57"\fP, are \*(FInot\fP
+numeric strings, they are string constants. The idea of ``numeric string''
+only applies to fields, \*(FCgetline\fP input,
+\*(FCFILENAME\*(FR, \*(FCARGV\fP elements, \*(FCENVIRON\fP
+elements and the elements of an array created by
+\*(FCsplit()\fP that are numeric strings.
+The basic idea is that \*(FIuser input\*(FR,
+and only user input, that looks numeric,
+should be treated that way.
+\*(CRNote that the POSIX standard applies the concept of
+``numeric string'' everywhere, even to string constants.
+However, this is
+clearly incorrect, and none of the three free \*(AK\*(FRs do this.\*(CD
+(Fortunately, this is fixed in the next version of the standard.)
+.sp .5
+Uninitialized variables have the numeric value 0 and the string value
+\*(FC"\^"\fP
+(the null, or empty, string).\*(CX
+.EB "\s+2\f(HBCONVERSIONS AND COMPARISONS\*(FR\s0"
+
+.BT
+
+.ES
+\*(CX
+.sp 61
+.EB "\s+2\f(HBNOTES\*(FR\s0"
.BT
.\" --- Arrays
.ES
.fi
-\*(CDAn arrays subscript is an expression between square brackets
+\*(CDAn array subscript is an expression between square brackets
(\*(FC[ \*(FRand \*(FC]\*(FR).
If the expression is a list
-\*(FC(\*(FIexpr\*(FC, \*(FIexpr \*(FC...)\*(FR,
+(\*(FIexpr\*(FC, \*(FIexpr \*(FR...),
then the subscript is a string consisting of the
concatenation of the (string) value of each expression,
separated by the value of the \*(FCSUBSEP\fP variable.
@@ -809,7 +1031,7 @@ element from an array.
\*(CLSpecifying just the array name without a subscript in
the \*(FCdelete\fP
statement deletes the entire contents of an array.\*(CX
-.EB \s+2\f(HBARRAYS\*(FR\s0
+.EB "\s+2\f(HBARRAYS\*(FR\s0"
.\" --- Expressions
.ES
@@ -833,7 +1055,7 @@ and
\*(FCsub()\fP,
functions, mean \*(FC$0 ~ /\*(FIpat\*(FC/\*(FR.
.sp .5
-The AWK operators, in order of decreasing precedence, are
+The AWK operators, in order of decreasing precedence, are:
.sp .5
.fi
.TS
@@ -864,95 +1086,18 @@ l lw(1.8i).
\*(FC=\0+=\0\-=\0*=\0/=\0%=\0^=\0\*(CL**=\*(CD\fP
assignment operators\*(CX
.TE
-.EB \s+2\f(HBEXPRESSIONS\*(FR\s0
-
-
-.BT
-
-.\" --- Conversions and Comparisons
-.ES
-.fi
-\*(CDVariables and fields may be (floating point) numbers, strings or both.
-Context determines how the value of a variable is interpreted. If used in
-a numeric expression, it will be treated as a number, if used as a string
-it will be treated as a string.
-.sp .5
-To force a variable to be treated as a number, add 0 to it; to force it
-to be treated as a string, concatenate it with the null string.
-.sp .5
-When a string must be converted to a number, the conversion is accomplished
-using \*(FIatof\*(FR(3).
-A number is converted to a string by using the value of \*(FCCONVFMT\fP
-as a format string for \*(FIsprintf\*(FR(3),
-with the numeric value of the variable as the argument.
-However, even though all numbers in AWK are floating-point,
-integral values are \*(FIalways\fP converted as integers.
-.sp .5
-Comparisons are performed as follows:
-If two variables are numeric, they are compared numerically.
-If one value is numeric and the other has a string value that is a
-``numeric string,'' then comparisons are also done numerically.
-Otherwise, the numeric value is converted to a string, and a string
-comparison is performed.
-Two strings are compared, of course, as strings.
-\*(CRAccording to the POSIX standard, even if two strings are
-numeric strings, a numeric comparison is performed. However, this is
-clearly incorrect, and none of the three free \*(AK\*(FRs do this.\*(CD
-.sp .5
-Note that string constants, such as \*(FC"57"\fP, are \*(FInot\fP
-numeric strings, they are string constants. The idea of ``numeric string''
-only applies to fields, \*(FCgetline\fP input,
-\*(FCFILENAME\*(FR, \*(FCARGV\fP elements, \*(FCENVIRON\fP
-elements and the elements of an array created by
-\*(FCsplit()\fP that are numeric strings.
-The basic idea is that \*(FIuser input\*(FR,
-and only user input, that looks numeric,
-should be treated that way.
-.sp .5
-Uninitialized variables have the numeric value 0 and the string value
-\*(FC"\^"\fP
-(the null, or empty, string).\*(CX
-.EB "\s+2\f(HBCONVERSIONS AND COMPARISONS\*(FR\s0"
-
-.ig
-.\" --- Localization
-.ES
-.nf
-.ce 100
-\*(CDThis
-section
-is
-under
-construction.
-.sp .5
-This
-section
-is
-under
-construction.\*(CB
-.ce 0
-.EB "\s+2\f(HBLOCALIZATION\*(FR\s0"
-..
-
-.ig
-.ps +2
-.ce 1
-\*(CD\fHISBN: 0-916151-97-2\*(FR
-.ps -2
-..
+.EB "\s+2\f(HBEXPRESSIONS\*(FR\s0"
.BT
-
.\" --- Input Control
.ES
.fi
.TS
expand;
l lw(1.8i).
-\*(CD\*(FCclose(\*(FIfile\*(FC)\*(FR close input file or pipe.
\*(FCgetline\fP T{
-set \*(FC$0\fP from next input record;
+set \*(FC$0\fP from next record;
set \*(FCNF\*(FR, \*(FCNR\*(FR, \*(FCFNR\*(FR.
T}
\*(FCgetline < \*(FIfile\*(FR set \*(FC$0\fP from next record of \*(FIfile\*(FR; set \*(FCNF\*(FR.
@@ -963,10 +1108,15 @@ T}
\*(FCgetline \*(FIv \*(FC< \*(FIfile\*(FR set \*(FIv\fP from next record of \*(FIfile\*(FR.
\*(FIcmd \*(FC| getline\*(FR pipe into \*(FCgetline\*(FR; set \*(FC$0\*(FR, \*(FCNF\*(FR.
\*(FIcmd \*(FC| getline \*(FIv\*(FR pipe into \*(FCgetline\*(FR; set \*(FIv\*(FR.
+\*(CB\*(FIcmd \*(FC|& getline\*(FR co-process pipe into \*(FCgetline\*(FR; set \*(FC$0\*(FR, \*(FCNF\*(FR.
.TE
.fi
.in +.2i
.ti -.2i
+\*(FIcmd \*(FC|& getline \*(FIv\*(FR
+.br
+co-process pipe into \*(FCgetline\*(FR; set \*(FIv\*(FR.
+.ti -.2i
\*(FCnext\fP
.br
stop processing the current input
@@ -986,15 +1136,15 @@ and processing starts over with the first
pattern in the AWK program. Upon end
of input data, execute any \*(FCEND\fP rule(s).
\*(CREarlier versions of \*(GK used
-\*(FCnext file\*(FR, as two words. This
-generates a warning message and will
-eventually be removed. \*(CR\*(MK does not
-currently support \*(FCnextfile\*(FR.\*(CD
+\*(FCnext file\*(FR, as two words.
+This usage is no longer supported.
+\*(CR\*(MK does not currently support \*(FCnextfile\*(FR.\*(CD
.in -.2i
.sp .5
.fi
-\*(FCgetline\*(FR returns 0 on end of file, and \-1 on an
-error.\*(CX
+\*(FCgetline\*(FR returns 0 on end of file and \-1 on an error.
+\*(CBUpon an error, \*(FCERRNO\*(FR contains a string describing
+the problem.\*(CX
.EB "\s+2\f(HBINPUT CONTROL\*(FR\s0"
.\" --- Output Control
@@ -1002,28 +1152,24 @@ error.\*(CX
.fi
.in +.2i
.ti -.2i
-\*(CD\*(FCclose(\*(FIfile\*(FC)\*(FR
-.br
-close output file or pipe.
-.ti -.2i
\*(CL\*(FCfflush(\*(FR[\*(FIfile\^\*(FR]\*(FC)\*(FR
.br
flush any buffers associated
with the open output file or pipe \*(FIfile\*(FR.\*(CD
-\*(CBIf \*(FIfile\fP is missing, then standard output is flushed.
-If \*(FIfile\fP is the null string, then all open output files and pipes
-are flushed \*(CR(not \*(NK)\*(CD.
+\*(CBIf no \*(FIfile\fP, then flush standard output.
+If \*(FIfile\fP is null, then flush all open output files and pipes
+\*(CR(not \*(NK)\*(CD.
.ti -.2i
\*(FCprint\fP
.br
-print the current record. The output record is terminated
-with the value of \*(FCORS\fP.
+print the current record. Terminate output record
+with \*(FCORS\fP.
.ti -.2i
\*(FCprint \*(FIexpr-list\*(FR
.br
print expressions. Each expression is separated
-by the value of \*(FCOFS\fP. The output record is
-terminated with the value of \*(FCORS\fP.
+by the value of \*(FCOFS\fP. Terminate the output record
+with \*(FCORS\fP.
.ti -.2i
\*(FCprintf \*(FIfmt\*(FC, \*(FIexpr-list\*(FR
.br
@@ -1042,21 +1188,47 @@ I/O redirections may be used with both \*(FCprint\fP and \*(FCprintf\fP.
.ti -.2i
\*(CD\*(FCprint "hello" > \*(FIfile\*(FR
.br
-Print data to \*(FIfile\fP. The first time the file is written to, it
-will be truncated. Subsequent commands append data.
+print data to \*(FIfile\fP. The first time the file is written to, it
+is truncated. Subsequent commands append data.
.ti -.2i
\*(FCprint "hello" >> \*(FIfile\*(FR
.br
-Append data to \*(FIfile\fP. The previous contents of the file are not lost.
+append data to \*(FIfile\fP. The previous contents of \*(FIfile\*(FR are not lost.
.ti -.2i
\*(FCprint "hello" | \*(FIcmd\*(FR
.br
-Print data down a pipeline to \*(FIcmd\*(FR.\*(CX
+print data down a pipeline to \*(FIcmd\*(FR.
+.ti -.2i
+\*(CB\*(FCprint "hello" |& \*(FIcmd\*(FR
+.br
+print data down a pipeline to co-process \*(FIcmd\*(FR.\*(CX
.in -.2i
.EB "\s+2\f(HBOUTPUT CONTROL\*(FR\s0"
-.BT
+.ES
+.fi
+.in +.2i
+.ti -.2i
+\*(CD\*(FCclose(\*(FIfile\*(FC)\*(FR
+.br
+close input or output file, pipe \*(CBor co-process.\*(CD
+.ti -.2i
+\*(CB\*(FCclose(\*(FIcommand\*(FC, \*(FIhow\*(FC)\*(FR
+.br
+close one end of co-process pipe.
+Use \*(FC"to"\*(FR for the write end, or
+\*(FC"from"\*(FR for the read end.\*(CD
+.in -.2i
+.sp .5
+On success, \*(FCclose()\*(FR returns zero for a file, or the exit status for a process.
+It returns \-1 if \*(FIfile\*(FR
+was never opened, or
+if there was a system problem.
+\*(CB\*(FCERRNO\*(FR describes
+the error.\*(CX
+.EB "\s+2\f(HBCLOSING REDIRECTIONS\*(FR\s0"
+.BT
.\" --- Printf Formats
.ES
@@ -1091,6 +1263,14 @@ and the control letter:
.TS
expand;
l lw(2.2i).
+\*(CB\*(FIcount\*(FC$\*(FR T{
+use the
+\*(FIcount\*(FR'th
+argument at this point in the formatting
+(a \*(FIpositional specifier\*(FR).
+Use in translated versions of
+format strings, not in the original text of an AWK program.\*(CD
+T}
\*(FC\-\fP T{
left-justify the expression within its field.
T}
@@ -1122,7 +1302,7 @@ trailing zeros are not removed.
T}
\*(FC0\fP T{
a leading zero acts as a flag, indicating output
-should be padded with zeroes instead of spaces.
+should be padded with zeros instead of spaces.
This applies even to non-numeric output formats.
Only has an effect when the field width is wider
than the value to be printed.
@@ -1130,11 +1310,11 @@ T}
\*(FIwidth\fP T{
pad the field to this width. The field is normally
padded with spaces. If the \*(FC0\fP flag has been used,
-pad with zeroes.
+pad with zeros.
T}
-\*(FC.\fP\*(FIprec\fP T{
+\*(FC.\*(FIprec\*(FR T{
precision.
-The meaning varies by control letter:
+The meaning of the \*(FIprec\*(FR varies by control letter:
T}
\*(FC%d\*(FR, \*(FC%o\*(FR, \*(FC%i\*(FR,
\*(FC%u\*(FR, \*(FC%x\*(FR, \*(FC%X\fP T{
@@ -1155,12 +1335,13 @@ T}
The dynamic \*(FIwidth\fP and \*(FIprec\fP capabilities of the ANSI C
\*(FCprintf()\fP routines are supported.
A \*(FC*\fP in place of either the \*(FIwidth\fP or \*(FIprec\fP
-specifications will cause their values to be taken from
-the argument list to \*(FCprintf\fP or \*(FCsprintf()\*(FR.\*(CX
+specifications causes their values to be taken from
+the argument list to \*(FCprintf\fP or \*(FCsprintf()\*(FR.
+\*(CBUse \*(FC*\*(FIn\*(FC$\*(FR to use positional specifiers
+with a dynamic width or precision.\*(CX
.EB "\s+2\f(HBPRINTF FORMATS\*(FR\s0"
-
.BT
.\" --- Special Filenames
@@ -1187,13 +1368,28 @@ l lw(2i).
.fi
\*(CBThe following names are specific to \*(GK.
.sp .5
-.TS
-expand;
-l lw(2i).
-\*(FC/dev/fd/\^\*(FIn\*(FR T{
-file associated with the open file descriptor \*(FIn\*(FR
-T}
-.TE
+.in +.2i
+.ti -.2i
+\*(FC/dev/fd/\^\*(FIn\*(FR
+.br
+File associated with the open file descriptor \*(FIn\*(FR.
+.ti -.2i
+\*(FC/inet/tcp/\*(FIlport\*(FC/\*(FIrhost\*(FC/\*(FIrport\*(FR
+.br
+File for TCP/IP connection on local port \*(FIlport\*(FR to
+remote host \*(FIrhost\*(FR on remote port \*(FIrport\*(FR.
+Use a port of \*(FC0\*(FR to have the system pick a port.
+Usable only with the \*(FC|&\*(FR two-way I/O operator.
+.ti -.2i
+\*(FC/inet/udp/\*(FIlport\*(FC/\*(FIrhost\*(FC/\*(FIrport\*(FR
+.br
+Similar, but use UDP/IP instead of TCP/IP.
+.ti -.2i
+\*(CR\*(FC/inet/raw/\*(FIlport\*(FC/\*(FIrhost\*(FC/\*(FIrport\*(FR
+.br
+.\" Similar, but use raw IP sockets.
+Reserved for future use.\*(CB
+.in -.2i
.sp .5
.fi
Other special filenames provide access to information about the running
@@ -1223,19 +1419,10 @@ T}
.TE
.sp .5
.fi
-.ig
\*(CRThese filenames are now obsolete.
Use the \*(FCPROCINFO\fP array to obtain the information they provide.\*(CL
-..
-.\" BEGIN FOR 3.0.x
-\*(CRThese filenames will become obsolete in \*(GK 3.1.
-Be aware that you will have to change your programs.\*(CL
-.\" END FOR 3.0.x
.EB "\s+2\f(HBSPECIAL FILENAMES\*(FR\s0"
-
-
-
.\" --- Builtin Numeric Functions
.ES
.fi
@@ -1262,20 +1449,27 @@ T}
.BT
-
.\" --- Builtin String Functions
.ES
.fi
.in +.2i
.ti -.2i
+\*(CB\*(FCasort(\*(FIs\*(FC \*(FR[\*(FC, \*(FId\*(FR]\*(FC)\*(FR
+.br
+sorts the source array \*(FIs\*(FR, replacing the indices with numeric
+values 1 through \*(FIn\*(FR (the number of elements in the array),
+and returns the number of elements.
+If destination \*(FId\*(FR is supplied, \*(FIs\*(FR is copied to \*(FId\*(FR,
+\*(FId\*(FR is sorted, and \*(FIs\*(FR is unchanged.\*(CD
+.ti -.2i
\*(CB\*(FCgensub(\*(FIr\*(FC, \*(FIs\*(FC, \*(FIh \*(FR[\*(FC, \*(FIt\*(FR]\*(FC)\*(FR
.br
search the target string
\*(FIt\fP for matches of the regular expression \*(FIr\*(FR. If
\*(FIh\fP is a string beginning with \*(FCg\fP or \*(FCG\*(FR,
replace all matches of \*(FIr\fP with \*(FIs\*(FR. Otherwise, \*(FIh\fP
-is a number indicating which match of \*(FIr\fP to replace. If no
-\*(FIt\fP is supplied, \*(FC$0\fP is used instead. Within the
+is a number indicating which match of \*(FIr\fP to replace.
+If \*(FIt\fP is not supplied, \*(FC$0\fP is used instead. Within the
replacement text \*(FIs\*(FR, the sequence \*(FC\e\*(FIn\*(FR,
where \*(FIn\fP is a digit from 1 to 9, may be used to indicate just
the text that matched the \*(FIn\*(FRth parenthesized subexpression.
@@ -1306,13 +1500,17 @@ returns the index of the string
returns the length of the string
\*(FIs\*(FR, or the length of \*(FC$0\fP if \*(FIs\fP is not supplied.
.ti -.2i
-\*(FCmatch(\*(FIs\*(FC, \*(FIr\*(FC)\*(FR
+\*(FCmatch(\*(FIs\*(FC, \*(FIr \*(CB\*(FR[\*(FC, \*(FIa\*(FR]\*(CD\*(FC)\*(FR
.br
returns the position in
\*(FIs\fP where the regular expression \*(FIr\fP occurs, or 0 if
\*(FIr\fP is not present, and sets the values of variables
\*(FCRSTART\fP
and \*(FCRLENGTH\*(FR.
+\*(CBIf \*(FIa\*(FR is supplied, the text matching all of \*(FIr\*(FR
+is placed in \*(FIa\*(FC[0]\*(FR. If there were parenthesized
+subexpressions, the matching texts are placed
+in \*(FIa\*(FC[1]\*(FR, \*(FIa\*(FC[2]\*(FR, and so on.\*(CD
.ti -.2i
\*(FCsplit(\*(FIs\*(FC, \*(FIa \*(FR[\*(FC, \*(FIr\*(FR]\*(FC)\*(FR
.br
@@ -1328,6 +1526,16 @@ Splitting behaves identically to field splitting.
prints \*(FIexpr-list\fP
according to \*(FIfmt\*(FR, and returns the resulting string.
.ti -.2i
+\*(CB\*(FCstrtonum(\*(FIs\*(FC)\*(FR
+.br
+examines \*(FIs\*(FR, and returns its numeric value.
+If \*(FIs\*(FR begins with a leading \*(FC0\*(FR,
+\*(FCstrtonum()\*(FR assumes that \*(FIs\*(FR
+is an octal number.
+If \*(FIs\*(FR begins with a leading \*(FC0x\*(FR
+or \*(FC0X\*(FR, \*(FCstrtonum()\*(FR assumes that
+\*(FIs\*(FR is a hexadecimal number.\*(CD
+.ti -.2i
\*(FCsub(\*(FIr\*(FC, \*(FIs \*(FR[\*(FC, \*(FIt\*(FR]\*(FC)\*(FR
.br
just like
@@ -1344,21 +1552,25 @@ If \*(FIn\fP is omitted, the rest of \*(FIs\fP is used.
returns a copy of the string \*(FIstr\*(FR,
with all the upper-case characters in \*(FIstr\fP translated to their
corresponding lower-case counterparts. Non-alphabetic characters are
-left unchanged.
+left unchanged.\*(CX
+.in -.2i
+.EB "\s+2\f(HBSTRING FUNCTIONS\*(FR\s0"
+
+.BT
+
+.\" --- Builtin String Functions
+.ES
+.fi
+.in +.2i
.ti -.2i
-\*(FCtoupper(\*(FIstr\*(FC)\*(FR
+\*(CD\*(FCtoupper(\*(FIstr\*(FC)\*(FR
.br
returns a copy of the string \*(FIstr\*(FR,
with all the lower-case characters in \*(FIstr\fP translated to their
corresponding upper-case counterparts. Non-alphabetic characters are
left unchanged.\*(CX
.in -.2i
-.EB "\s+2\f(HBSTRING FUNCTIONS\*(FR\s0"
-
-
-
-.BT
-
+.EB "\s+2\f(HBSTRING FUNCTIONS (continued)\*(FR\s0"
.\" --- Builtin Time Functions
.ES
@@ -1369,15 +1581,13 @@ formatting them.
.sp .5
.fi
.in +.2i
-.ig
.ti -.2i
\*(FCmktime(\*(FIdatespec\*(FC)\*(FR
.br
turns \*(FIdatespec\fP into a time
stamp of the same form as returned by \*(FCsystime()\*(FR.
The \*(FIdatespec\fP is a string of the form
-\*(FC"\*(FIYYYY MM DD HH MM SS\*(FC"\*(FR.
-..
+\*(FC"\*(FIYYYY MM DD HH MM SS[ DST]\*(FC"\*(FR.
.ti -.2i
\*(FCstrftime(\*(FR[\*(FIformat \*(FR[\*(FC, \*(FItimestamp\*(FR]]\*(FC)\*(FR
.br
@@ -1387,7 +1597,7 @@ according to the specification in \*(FIformat\*(FR. The
\*(FCsystime()\*(FR.
If \*(FItimestamp\fP is missing, the current time of day is used. If
\*(FIformat\fP is missing, a default format equivalent to the output
-of \*(FIdate\*(FR(1) will be used.
+of \*(FIdate\*(FR(1) is used.
.ti -.2i
\*(FCsystime()\fP
.br
@@ -1396,7 +1606,83 @@ seconds since the Epoch.\*(CB
.in -.2i
.EB "\s+2\f(HBTIME FUNCTIONS (\*(GK\f(HB)\*(FR\s0"
+.\" --- Builtin Bit Manipulation Functions
+.ES
+.fi
+\*(CD\*(GK
+provides the following functions for doing bitwise operations.
+.sp .5
+.fi
+.in +.2i
+.ti -.2i
+\*(FCand(\*(FIv1\*(FC, \*(FIv2\*(FC)\*(FR
+.br
+returns the bitwise AND of the values provided by
+\*(FIv1\*(FR and \*(FIv2\*(FR.
+.ti -.2i
+\*(FCcompl(\*(FIval\*(FC)\*(FR
+.br
+returns the bitwise complement of
+\*(FIval\*(FR.
+.ti -.2i
+\*(FClshift(\*(FIval\*(FC, \*(FIcount\*(FC)\*(FR
+.br
+returns the value of \*(FIval\*(FR,
+shifted left by \*(FIcount\*(FR bits.
+.ti -.2i
+\*(FCor(\*(FIv1\*(FC, \*(FIv2\*(FC)\*(FR
+.br
+returns the bitwise OR of the values provided by
+\*(FIv1\*(FR and \*(FIv2\*(FR.
+.ti -.2i
+\*(FCrshift(\*(FIval\*(FC, \*(FIcount\*(FC)\*(FR
+.br
+returns the value of \*(FIval\*(FR,
+shifted right by \*(FIcount\*(FR bits.
+.ti -.2i
+\*(FCxor(\*(FIv1\*(FC, \*(FIv2\*(FC)\*(FR
+.br
+teturns the bitwise XOR of the values provided by
+\*(FIv1\*(FR and \*(FIv2\*(FR.\*(CB
+.in -.2i
+.EB "\s+2\f(HBBIT MANIPULATION FUNCTIONS (\*(GK\f(HB)\*(FR\s0"
+
+.\" --- Builtin Internationalizatin Functions
+.ES
+.fi
+\*(CD\*(GK
+provides the following functions for runtime message translation.
+.in +.2i
+.sp .5
+.ti -.2i
+\*(FCbindtextdomain(\*(FIdirectory \*(FR[\*(FC, \*(FIdomain\*(FR]\*(FC)\*(FR
+.br
+specifies the directory where \*(GK looks for the \*(FC\&.mo\*(FR
+files, in case they
+will not or cannot be placed in the ``standard'' locations
+(e.g., during testing.)
+It returns the directory where \*(FIdomain\*(FR is ``bound.''
+.sp .5
+The default \*(FIdomain\*(FR is the value of \*(FCTEXTDOMAIN\*(FR.
+When \*(FIdirectory\*(FR is the null string (\*(FC"\^"\*(FR),
+\*(FCbindtextdomain()\*(FR returns the current binding for the
+given \*(FIdomain\*(FR.
+.ti -.2i
+\*(FCdcgettext(\*(FIstring \*(FR[\*(FC, \*(FIdomain \*(FR[\*(FC, \*(FIcategory\*(FR]]\*(FC)\*(FR
+.br
+returns the translation of \*(FIstring\*(FR in text domain
+\*(FIdomain\*(FR for locale category \*(FIcategory\*(FR.
+The default value for \*(FIdomain\*(FR is the current value of \*(FCTEXTDOMAIN\*(FR.
+The default value for \*(FIcategory\*(FR is \*(FC"LC_MESSAGES"\*(FR.
+.sp .5
+If you supply a value for \*(FIcategory\*(FR, it must be a string equal to
+one of the known locale categories.
+You must also supply a text domain. Use \*(FCTEXTDOMAIN\*(FR
+to use the current domain.\*(CB
+.in -.2i
+.EB "\s+2\f(HBINTERNATIONALIZATION (\*(GK\f(HB)\*(FR\s0"
+.BT
.\" --- User-defined Functions
.ES
@@ -1420,7 +1706,7 @@ in the parameter list. The convention is to separate local variables from
real parameters by extra spaces in the parameter list. For example:
.sp .5
.nf
- \*(FC# a & b are local
+ \*(FC# a and b are local
function f(p, q, a, b)
{
\&.....
@@ -1450,17 +1736,65 @@ may be used in place of
\*(CRNote: This usage is deprecated.\*(CX
.EB "\s+2\f(HBUSER-DEFINED FUNCTIONS\*(FR\s0"
-
-
-.\" --- Bug Reports
+.\" --- Localization
.ES
.fi
-\*(CDIf you find a bug in this reference card, please report it via electronic
-mail to \*(FCarnold@gnu.org\*(FR.\*(CX
-.EB "\s+2\f(HBBUG REPORTS\*(FR\s0"
+\*(CDThere are several steps involved in producing and running a localizable
+\*(AK program.
+.sp .5
+1. Add a \*(FCBEGIN\*(FR action to assign a value to the
+\*(FCTEXTDOMAIN\*(FR variable to set the text domain for
+your program.
+.sp .5
+.ti +5n
+\*(FCBEGIN { TEXTDOMAIN = "myprog" }\*(FR
+.sp .5
+This allows \*(GK to find the \*(FC\&.mo\*(FR
+file associated with your program.
+Without this step, \*(GK uses the \*(FCmessages\*(FR text domain,
+which probably won't work.
+.sp .5
+2. Mark all strings that should be translated with leading underscores.
+.sp .5
+3. Use the \*(FCdcgettext()\*(FR
+and/or \*(FCbindtextdomain()\*(FR
+functions in your program, as necessary or appropriate.
+.sp .5
+4. Run
+.sp .5
+.ti +5n
+\*(FCgawk \-\^\-gen\-po \-f myprog.awk > myprog.po\*(FR
+.sp .5
+to generate a \*(FC\&.po\*(FR
+file for your program.
+.sp .5
+5. Provide appropriate translations, and build and install a corresponding
+\*(FC\&.mo\*(FR file.
+.sp .5
+The internationalization features are described in full detail in \*(AM.\*(CB
+.EB "\s+2\f(HBLOCALIZATION (\*(GK\f(HB)\*(FR\s0"
+
.BT
+.\" --- Extensions
+.ES
+.fi
+.in +.2i
+.ti -.2i
+\*(CD\*(FCextension(\*(FIlib\*(FC, \*(FIfunc\*(FC)\*(FR
+.br
+dynamically load the shared library
+\*(FIlib\*(FR
+and call
+\*(FIfunc\*(FR
+in it to initialize the library.
+This adds new built-in functions to \*(GK.
+It returns the value returned by
+\*(FIfunc\*(FR.\*(CB
+.in -.2i
+.EB "\s+2\f(HBDYNAMIC EXTENSIONS (\*(GK\f(HB)\*(FR\s0"
+
.\" --- Environment Variables
.ES
.fi
@@ -1487,7 +1821,7 @@ command line.\*(CB
First, it is possible to call the \*(FClength()\fP
built-in function not only with no argument, but even without parentheses.
This feature is marked as ``deprecated'' in the POSIX standard, and \*(GK
-will issue a warning about its use if \*(FC\-\^\-lint\fP
+issues a warning about its use if \*(FC\-\^\-lint\fP
is specified on the command line.
.sp .5
The other feature is the use of \*(FCcontinue\fP
@@ -1495,8 +1829,8 @@ or \*(FCbreak\fP statements outside the body of a
\*(FCwhile\*(FR, \*(FCfor\*(FR, or \*(FCdo\fP loop.
Historical AWK implementations have treated such usage as
equivalent to the \*(FCnext\fP statement.
-\*(GK will support this usage if \*(FC\-\^\-traditional\fP
-has been specified.\*(CB
+\*(GK supports this usage if \*(FC\-\^\-traditional\fP
+is specified.\*(CB
.EB "\s+2\f(HBHISTORICAL FEATURES (\*(GK\f(HB)\*(FR\s0"
@@ -1504,15 +1838,14 @@ has been specified.\*(CB
.ES
.nf
\*(CDHost: \*(FCgnudist.gnu.org\*(FR
-File: \*(FC/gnu/gawk/gawk-3.0.6.tar.gz\fP
+File: \*(FC/gnu/gawk/gawk-3.1.0.tar.gz\fP
.in +.2i
.fi
GNU \*(AK (\*(GK). There may be a later version.
.in -.2i
.nf
.sp .5
-Host: \*(FCnetlib.bell-labs.com\*(FR
-File: \*(FC/netlib/research/awk.bundle.gz\fP
+\*(FChttp://cm.bell-labs.com/who/bwk/awk.tar.gz\fP
.in +.2i
.fi
\*(NK. This version requires an ANSI C compiler;
@@ -1526,12 +1859,12 @@ File: \*(FC/pub/brennan/mawk1.3.3.tar.gz\fP
.fi
Michael Brennan's \*(MK. There may be a newer version.\*(CX
.in -.2i
-.EB "\s+2\f(HBFTP INFORMATION\*(FR\s0"
+.EB "\s+2\f(HBFTP/HTTP INFORMATION\*(FR\s0"
.\" --- Copying Permissions
.ES
.fi
-\*(CDCopyright \(co 1996-2000 Free Software Foundation, Inc.
+\*(CDCopyright \(co 1996-2001 Free Software Foundation, Inc.
.sp .5
Permission is granted to make and distribute verbatim copies of this
reference card provided the copyright notice and this permission notice
diff --git a/contrib/awk/doc/cardfonts b/contrib/awk/doc/cardfonts
index 5529ba9..dc44ce1 100644
--- a/contrib/awk/doc/cardfonts
+++ b/contrib/awk/doc/cardfonts
@@ -34,4 +34,4 @@ FC - font courier
.ds RN Times Roman
.ds IN Times Italic
.ds CN Courier Bold
-.ds AM \fIThe GNU Awk User's Guide\fP
+.ds AM \fIGAWK: Effective AWK Programming\fP
diff --git a/contrib/awk/doc/gawk.1 b/contrib/awk/doc/gawk.1
index 6f07cfa..3e3c62b 100644
--- a/contrib/awk/doc/gawk.1
+++ b/contrib/awk/doc/gawk.1
@@ -3,6 +3,7 @@
.ds AN \s-1ANSI\s+1
.ds GN \s-1GNU\s+1
.ds AK \s-1AWK\s+1
+.ds EP \fIGAWK: Effective AWK Programming\fP
.if !\n(.g \{\
. if !\w|\*(lq| \{\
. ds lq ``
@@ -13,7 +14,7 @@
. if \w'\(rq' .ds rq "\(rq
. \}
.\}
-.TH GAWK 1 "May 17 2000" "Free Software Foundation" "Utility Commands"
+.TH GAWK 1 "May 29 2001" "Free Software Foundation" "Utility Commands"
.SH NAME
gawk \- pattern scanning and processing language
.SH SYNOPSIS
@@ -32,6 +33,22 @@ gawk \- pattern scanning and processing language
]
.I program-text
file .\|.\|.
+.sp
+.B pgawk
+[ \*(PX or \*(GN style options ]
+.B \-f
+.I program-file
+[
+.B \-\^\-
+] file .\|.\|.
+.br
+.B pgawk
+[ \*(PX or \*(GN style options ]
+[
+.B \-\^\-
+]
+.I program-text
+file .\|.\|.
.SH DESCRIPTION
.I Gawk
is the \*(GN Project's implementation of the \*(AK programming language.
@@ -44,9 +61,22 @@ with the additional features found in the System V Release 4 version
of \*(UX
.IR awk .
.I Gawk
-also provides more recent Bell Labs
+also provides more recent Bell Laboratories
.I awk
-extensions, and some \*(GN-specific extensions.
+extensions, and a number of \*(GN-specific extensions.
+.PP
+.I Pgawk
+is the profiling version of
+.IR gawk .
+It is identical in every way to
+.IR gawk ,
+except that programs run more slowly,
+and it automatically produces an execution profile in the file
+.B awkprof.out
+when done.
+See the
+.B \-\^\-profile
+option, below.
.PP
The command line consists of options to
.I gawk
@@ -63,11 +93,11 @@ pre-defined \*(AK variables.
.SH OPTION FORMAT
.PP
.I Gawk
-options may be either the traditional \*(PX one letter options,
-or the \*(GN style long options. \*(PX options start with a single \*(lq\-\*(rq,
+options may be either traditional \*(PX one letter options,
+or \*(GN style long options. \*(PX options start with a single \*(lq\-\*(rq,
while long options start with \*(lq\-\^\-\*(rq.
Long options are provided for both \*(GN-specific features and
-for \*(PX mandated features.
+for \*(PX-mandated features.
.PP
Following the \*(PX standard,
.IR gawk -specific
@@ -89,7 +119,7 @@ remains unique.
.SH OPTIONS
.PP
.I Gawk
-accepts the following options.
+accepts the following options, listed alphabetically.
.TP
.PD 0
.BI \-F " fs"
@@ -109,7 +139,7 @@ variable).
.PD
\fB\-\^\-assign \fIvar\fB\^=\^\fIval\fR
Assign the value
-.IR val ,
+.I val
to the variable
.IR var ,
before execution of the program begins.
@@ -144,7 +174,7 @@ flag sets the maximum number of fields, and the
.B r
flag sets the maximum record size. These two flags and the
.B \-m
-option are from the Bell Labs research version of \*(UX
+option are from the Bell Laboratories research version of \*(UX
.IR awk .
They are ignored by
.IR gawk ,
@@ -153,16 +183,16 @@ since
has no pre-defined limits.
.TP
.PD 0
-.B "\-W traditional"
+.B "\-W compat"
.TP
.PD 0
-.B "\-W compat"
+.B "\-W traditional"
.TP
.PD 0
-.B \-\^\-traditional
+.B \-\^\-compat
.TP
.PD
-.B \-\^\-compat
+.B \-\^\-traditional
Run in
.I compatibility
mode. In compatibility mode,
@@ -189,7 +219,33 @@ below, for more information.
.PD
.B \-\^\-copyright
Print the short version of the \*(GN copyright information message on
-the standard output, and exits successfully.
+the standard output and exit successfully.
+.TP
+.PD 0
+\fB\-W dump-variables\fR[\fB=\fIfile\fR]
+.TP
+.PD
+\fB\-\^\-dump-variables\fR[\fB=\fIfile\fR]
+Print a sorted list of global variables, their types and final values to
+.IR file .
+If no
+.I file
+is provided,
+.I gawk
+uses a file named
+.I awkvars.out
+in the current directory.
+.sp .5
+Having a list of all the global variables is a good way to look for
+typographical errors in your programs.
+You would also use this option if you have a large program with a lot of
+functions, and you want to be sure that your functions don't
+inadvertently use global variables that you meant to be local.
+(This is a particularly easy mistake to make with simple variable
+names like
+.BR i ,
+.BR j ,
+and so on.)
.TP
.PD 0
.B "\-W help"
@@ -209,12 +265,17 @@ the standard output.
these options cause an immediate, successful exit.)
.TP
.PD 0
-.B "\-W lint"
+.BR "\-W lint" [ =fatal ]
.TP
.PD
-.B \-\^\-lint
+.BR \-\^\-lint [ =fatal ]
Provide warnings about constructs that are
dubious or non-portable to other \*(AK implementations.
+With an optional argument of
+.BR fatal ,
+lint warnings become fatal errors.
+This may be drastic, but its use will certainly encourage the
+development of cleaner \*(AK programs.
.TP
.PD 0
.B "\-W lint\-old"
@@ -224,6 +285,29 @@ dubious or non-portable to other \*(AK implementations.
Provide warnings about constructs that are
not portable to the original version of Unix
.IR awk .
+.TP
+.PD 0
+.B "\-W gen\-po"
+.TP
+.PD
+.B \-\^\-gen\-po
+Scan and parse the \*(AK program, and generate a \*(GN
+.B \&.po
+format file on standard output with entries for all localizable
+strings in the program. The program itself is not executed.
+See the \*(GN
+.I gettext
+distribution for more information on
+.B \&.po
+files.
+.TP
+.PD 0
+.B "\-W non\-decimal\-data"
+.TP
+.PD
+.B "\-\^\-non\-decimal\-data"
+Recognize octal and hexadecimal values in input data.
+.I "Use this option with great caution!"
.ig
.\" This option is left undocumented, on purpose.
.TP
@@ -246,7 +330,7 @@ This turns on
.I compatibility
mode, with the following additional restrictions:
.RS
-.TP \w'\(bu'u+1n
+.TP "\w'\(bu'u+1n"
\(bu
.B \ex
escape sequences are not recognized.
@@ -257,6 +341,12 @@ Only space and tab act as field separators when
is set to a single space, newline does not.
.TP
\(bu
+You cannot continue lines after
+.B ?
+and
+.BR : .
+.TP
+\(bu
The synonym
.B func
for the keyword
@@ -280,6 +370,23 @@ function is not available.
.RE
.TP
.PD 0
+\fB\-W profile\fR[\fB=\fIprof_file\fR]
+.TP
+.PD
+\fB\-\^\-profile\fR[\fB=\fIprof_file\fR]
+Send profiling data to
+.IR prof_file .
+The default is
+.BR awkprof.out .
+When run with
+.IR gawk ,
+the profile is just a \*(lqpretty printed\*(rq version of the program.
+When run with
+.IR pgawk ,
+the profile contains execution counts of each statement in the program
+in the left margin and function call counts for each user-defined function.
+.TP
+.PD 0
.B "\-W re\-interval"
.TP
.PD
@@ -337,14 +444,15 @@ This is also useful when reporting bugs.
.IR "GNU Coding Standards" ,
these options cause an immediate, successful exit.)
.TP
+.PD 0
.B \-\^\-
-Signal the end of options. This is useful to allow further arguments to the
+Signal the end of options. This is useful to allow further arguments to the
\*(AK program itself to start with a \*(lq\-\*(rq.
This is mainly for consistency with the argument parsing convention used
by most other \*(PX programs.
.PP
In compatibility mode,
-any other options are flagged as illegal, but are otherwise ignored.
+any other options are flagged as invalid, but are otherwise ignored.
In normal operation, as long as program text has been supplied, unknown
options are passed on to the \*(AK program in the
.B ARGV
@@ -374,7 +482,7 @@ and
.B \-\^\-source
options may be used multiple times on the command line.
.I Gawk
-will read the program text as if all the
+reads the program text as if all the
.IR program-file s
and command line source texts
had been concatenated together. This is useful for building libraries
@@ -472,7 +580,7 @@ is any single character, that character separates records.
Otherwise,
.B RS
is a regular expression. Text in the input that matches this
-regular expression will separate the record.
+regular expression separates the record.
However, in compatibility mode,
only the first character of its string
value is used for separating records.
@@ -512,9 +620,10 @@ by runs of spaces and/or tabs and/or newlines.
(But see the discussion of
.BR \-\^\-posix ,
below).
-Note that the value of
+.B NOTE:
+The value of
.B IGNORECASE
-(see below) will also affect how fields are split when
+(see below) also affects how fields are split when
.B FS
is a regular expression, and how records are separated when
.B RS
@@ -525,7 +634,7 @@ If the
variable is set to a space separated list of numbers, each field is
expected to have fixed width, and
.I gawk
-will split up the record using the specified widths. The value of
+splits up the record using the specified widths. The value of
.B FS
is ignored.
Assigning a new value to
@@ -539,7 +648,7 @@ Each field in the input record may be referenced by its position,
.BR $2 ,
and so on.
.B $0
-is the whole record. The value of a field may be assigned to as well.
+is the whole record.
Fields need not be referenced by constants:
.RS
.PP
@@ -551,6 +660,7 @@ print $n
.RE
.PP
prints the fifth field in the input record.
+.PP
The variable
.B NF
is set to the total number of fields in the input record.
@@ -560,10 +670,10 @@ References to non-existent fields (i.e. fields after
produce the null-string. However, assigning to a non-existent field
(e.g.,
.BR "$(NF+2) = 5" )
-will increase the value of
+increases the value of
.BR NF ,
-create any intervening fields with the null string as their value, and
-cause the value of
+creates any intervening fields with the null string as their value, and
+causes the value of
.B $0
to be recomputed, with the fields being separated by the value of
.BR OFS .
@@ -574,12 +684,21 @@ causes the values of fields past the new value to be lost, and the value of
.B $0
to be recomputed, with the fields being separated by the value of
.BR OFS .
+.PP
+Assigning a value to an existing field
+causes the whole record to be rebuilt when
+.B $0
+is referenced.
+Similarly, assigning a value to
+.B $0
+causes the record to be resplit, creating new
+values for the fields.
.SS Built-in Variables
.PP
-.IR Gawk 's
+.IR Gawk\^ "'s"
built-in variables are:
.PP
-.TP \w'\fBFIELDWIDTHS\fR'u+1n
+.TP "\w'\fBFIELDWIDTHS\fR'u+1n"
.B ARGC
The number of command line arguments (does not include options to
.IR gawk ,
@@ -599,6 +718,16 @@ Dynamically changing the contents of
.B ARGV
can control the files used for data.
.TP
+.B BINMODE
+On non-POSIX systems, specifies use of \*(lqbinary\*(rq mode for all file I/O.
+Numeric values of 1, 2, or 3, specify that input files, output files, or
+all files, respectively, should use binary I/O.
+String values of \fB"r"\fR, or \fB"w"\fR specify that input files, or output files,
+respectively, should use binary I/O.
+String values of \fB"rw"\fR or \fB"wr"\fR specify that all files
+should use binary I/O.
+Any other string value is treated as \fB"rw"\fR, but generates a warning message.
+.TP
.B CONVFMT
The conversion format for numbers, \fB"%.6g"\fR, by default.
.TP
@@ -612,9 +741,6 @@ Changing this array does not affect the environment seen by programs which
spawns via redirection or the
.B system()
function.
-(This may change in a future version of
-.IR gawk .)
-.\" but don't hold your breath...
.TP
.B ERRNO
If a system error occurs either doing a redirection for
@@ -627,6 +753,7 @@ then
.B ERRNO
will contain
a string describing the error.
+The value is subject to translation in non-English locales.
.TP
.B FIELDWIDTHS
A white-space separated list of fieldwidths. When set,
@@ -635,10 +762,6 @@ parses the input into fields of fixed width, instead of using the
value of the
.B FS
variable as the field separator.
-The fixed field width facility is still experimental; the
-semantics may change as
-.I gawk
-evolves over time.
.TP
.B FILENAME
The name of the current input file.
@@ -649,7 +772,9 @@ However,
.B FILENAME
is undefined inside the
.B BEGIN
-block.
+block
+(unless set by
+.BR getline ).
.TP
.B FNR
The input record number in the current input file.
@@ -682,8 +807,16 @@ and the
.BR split() ,
and
.B sub()
-pre-defined functions will all ignore case when doing regular expression
-operations. Thus, if
+built-in functions all ignore case when doing regular expression
+operations.
+.B NOTE:
+Array subscripting is
+.I not
+affected, nor is the
+.B asort()
+function.
+.sp .5
+Thus, if
.B IGNORECASE
is not equal to zero,
.B /aB/
@@ -695,13 +828,18 @@ is zero, so all regular expression and string
operations are normally case-sensitive.
Under Unix, the full ISO 8859-1 Latin-1 character set is used
when ignoring case.
-.B NOTE:
-In versions of
+.TP
+.B LINT
+Provides dynamic control of the
+.B \-\^\-lint
+option from within an \*(AK program.
+When true,
.I gawk
-prior to 3.0,
-.B IGNORECASE
-only affected regular expression operations. It now affects string
-comparisons as well.
+prints lint warnings. When false, it does not.
+When assigned the string value \fB"fatal"\fP,
+lint warnings become fatal errors, exactly like
+.BR \-\^\-lint=fatal .
+Any other true value just prints warnings.
.TP
.B NF
The number of fields in the current input record.
@@ -718,6 +856,57 @@ The output field separator, a space by default.
.B ORS
The output record separator, by default a newline.
.TP
+.B PROCINFO
+The elements of this array provide access to information about the
+running \*(AK program.
+On some systems,
+there may be elements in the array, \fB"group1"\fP through
+\fB"group\fIn\fB"\fR for some
+.IR n ,
+which is the number of supplementary groups that the process has.
+Use the
+.B in
+operator to test for these elements.
+The following elements are guaranteed to be available:
+.RS
+.TP \w'\fBPROCINFO["pgrpid"]\fR'u+1n
+\fBPROCINFO["egid"]\fP
+the value of the
+.IR getegid (2)
+system call.
+.TP
+\fBPROCINFO["euid"]\fP
+the value of the
+.IR geteuid (2)
+system call.
+.TP
+\fBPROCINFO["FS"]\fP
+\fB"FS"\fP if field splitting with
+.B FS
+is in effect, or \fB"FIELDWIDTHS"\fP if field splitting with
+.B FIELDWIDTHS
+is in effect.
+.TP
+\fBPROCINFO["gid"]\fP
+the value of the
+.IR getgid (2)
+system call.
+.TP
+\fBPROCINFO["pgrpid"]\fP
+the process group ID of the current process.
+.TP
+\fBPROCINFO["pid"]\fP
+the process ID of the current process.
+.TP
+\fBPROCINFO["ppid"]\fP
+the parent process ID of the current process.
+.TP
+\fBPROCINFO["uid"]\fP
+the value of the
+.IR getuid (2)
+system call.
+.RE
+.TP
.B RS
The input record separator, by default a newline.
.TP
@@ -743,6 +932,10 @@ The length of the string matched by
.B SUBSEP
The character used to separate multiple subscripts in array
elements, by default \fB"\e034"\fR.
+.TP
+.B TEXTDOMAIN
+The text domain of the \*(AK program; used to find the localized
+translations for the program's strings.
.SS Arrays
.PP
Arrays are subscripted with an expression between square brackets
@@ -817,7 +1010,7 @@ to be treated as a string, concatenate it with the null string.
.PP
When a string must be converted to a number, the conversion is accomplished
using
-.IR atof (3).
+.IR strtod (3).
A number is converted to a string by using the value of
.B CONVFMT
as a format string for
@@ -850,11 +1043,13 @@ If one value is numeric and the other has a string value that is a
Otherwise, the numeric value is converted to a string and a string
comparison is performed.
Two strings are compared, of course, as strings.
-According to the \*(PX standard, even if two strings are
-numeric strings, a numeric comparison is performed. However, this is
+Note that the POSIX standard applies the concept of
+\*(lqnumeric string\*(rq everywhere, even to string constants.
+However, this is
clearly incorrect, and
.I gawk
does not do this.
+(Fortunately, this is fixed in the next version of the standard.)
.PP
Note that string constants, such as \fB"57"\fP, are
.I not
@@ -877,6 +1072,79 @@ should be treated that way.
.PP
Uninitialized variables have the numeric value 0 and the string value ""
(the null, or empty, string).
+.SS Octal and Hexadecimal Constants
+Starting with version 3.1 of
+.I gawk ,
+you may use C-style octal and hexadecimal constants in your AWK
+program source code.
+For example, the octal value
+.B 011
+is equal to decimal
+.BR 9 ,
+and the hexadecimal value
+.B 0x11
+is equal to decimal 17.
+.SS String Constants
+.PP
+String constants in \*(AK are sequences of characters enclosed
+between double quotes (\fB"\fR). Within strings, certain
+.I "escape sequences"
+are recognized, as in C. These are:
+.PP
+.TP "\w'\fB\e\^\fIddd\fR'u+1n"
+.B \e\e
+A literal backslash.
+.TP
+.B \ea
+The \*(lqalert\*(rq character; usually the \s-1ASCII\s+1 \s-1BEL\s+1 character.
+.TP
+.B \eb
+backspace.
+.TP
+.B \ef
+form-feed.
+.TP
+.B \en
+newline.
+.TP
+.B \er
+carriage return.
+.TP
+.B \et
+horizontal tab.
+.TP
+.B \ev
+vertical tab.
+.TP
+.BI \ex "\^hex digits"
+The character represented by the string of hexadecimal digits following
+the
+.BR \ex .
+As in \*(AN C, all following hexadecimal digits are considered part of
+the escape sequence.
+(This feature should tell us something about language design by committee.)
+E.g., \fB"\ex1B"\fR is the \s-1ASCII\s+1 \s-1ESC\s+1 (escape) character.
+.TP
+.BI \e ddd
+The character represented by the 1-, 2-, or 3-digit sequence of octal
+digits.
+E.g., \fB"\e033"\fR is the \s-1ASCII\s+1 \s-1ESC\s+1 (escape) character.
+.TP
+.BI \e c
+The literal character
+.IR c\^ .
+.PP
+The escape sequences may also be used inside constant regular expressions
+(e.g.,
+.B "/[\ \et\ef\en\er\ev]/"
+matches whitespace characters).
+.PP
+In compatibility mode, the characters represented by octal and
+hexadecimal escape sequences are treated literally when used in
+regular expression constants. Thus,
+.B /a\e52b/
+is equivalent to
+.BR /a\e*b/ .
.SH PATTERNS AND ACTIONS
\*(AK is a line-oriented language. The pattern comes first, and then the
action. Action statements are enclosed in
@@ -884,7 +1152,7 @@ action. Action statements are enclosed in
and
.BR } .
Either the pattern may be missing, or the action may be missing, but,
-of course, not both. If the pattern is missing, the action will be
+of course, not both. If the pattern is missing, the action is
executed for every single record of input.
A missing action is equivalent to
.RS
@@ -1005,7 +1273,7 @@ inclusive. It does not combine with any other sort of pattern expression.
Regular expressions are the extended kind found in
.IR egrep .
They are composed of characters as follows:
-.TP \w'\fB[^\fIabc.\|.\|.\fB]\fR'u+2n
+.TP "\w'\fB[^\fIabc.\|.\|.\fB]\fR'u+2n"
.I c
matches the non-metacharacter
.IR c .
@@ -1045,17 +1313,17 @@ concatenation: matches
and then
.IR r2 .
.TP
-.IB r +
+.IB r\^ +
matches one or more
-.IR r 's.
+.IR r\^ "'s."
.TP
.IB r *
matches zero or more
-.IR r 's.
+.IR r\^ "'s."
.TP
-.IB r ?
+.IB r\^ ?
matches zero or one
-.IR r 's.
+.IR r\^ "'s."
.TP
.BI ( r )
grouping: matches
@@ -1071,7 +1339,7 @@ grouping: matches
.IB r { n , m }
One or two numbers inside braces denote an
.IR "interval expression" .
-If there is one number in the braces, the preceding regexp
+If there is one number in the braces, the preceding regular expression
.I r
is repeated
.I n
@@ -1120,7 +1388,7 @@ matches the empty string at the beginning of a buffer (string).
matches the empty string at the end of a buffer.
.PP
The escape sequences that are valid in string constants (see below)
-are also legal in regular expressions.
+are also valid in regular expressions.
.PP
.I "Character classes"
are a new feature introduced in the \*(PX standard.
@@ -1130,15 +1398,15 @@ actual characters themselves can vary from country to country and/or
from character set to character set. For example, the notion of what
is an alphabetic character differs in the USA and in France.
.PP
-A character class is only valid in a regexp
+A character class is only valid in a regular expression
.I inside
the brackets of a character list. Character classes consist of
.BR [: ,
a keyword denoting the class, and
.BR :] .
-Here are the character
-classes defined by the \*(PX standard.
-.TP
+The character
+classes defined by the \*(PX standard are:
+.TP "\w'\fB[:alnum:]\fR'u+2n"
.B [:alnum:]
Alphanumeric characters.
.TP
@@ -1183,14 +1451,16 @@ For example, before the \*(PX standard, to match alphanumeric
characters, you would have had to write
.BR /[A\-Za\-z0\-9]/ .
If your character set had other alphabetic characters in it, this would not
-match them. With the \*(PX character classes, you can write
+match them, and if your character set collated differently from
+\s-1ASCII\s+1, this might not even match the
+\s-1ASCII\s+1 alphanumeric characters.
+With the \*(PX character classes, you can write
.BR /[[:alnum:]]/ ,
-and this will match
-.I all
+and this matches
the alphabetic and numeric characters in your character set.
.PP
Two additional special sequences can appear in character lists.
-These apply to non-ASCII character sets, which can have single symbols
+These apply to non-\s-1ASCII\s+1 character sets, which can have single symbols
(called
.IR "collating elements" )
that are represented with more than one
@@ -1200,7 +1470,7 @@ or sorting, purposes. (E.g., in French, a plain \*(lqe\*(rq
and a grave-accented e\` are equivalent.)
.TP
Collating Symbols
-A collating symbols is a multi-character collating element enclosed in
+A collating symbol is a multi-character collating element enclosed in
.B [.
and
.BR .] .
@@ -1208,9 +1478,9 @@ For example, if
.B ch
is a collating element, then
.B [[.ch.]]
-is a regexp that matches this collating element, while
+is a regular expression that matches this collating element, while
.B [ch]
-is a regexp that matches either
+is a regular expression that matches either
.B c
or
.BR h .
@@ -1224,15 +1494,17 @@ and
For example, the name
.B e
might be used to represent all of
-\*(lqe,\*(rq \*(lqe\`,\*(rq and \*(lqe\`.\*(rq
+\*(lqe,\*(rq \*(lqe\h'-\w:e:u'\`,\*(rq and \*(lqe\h'-\w:e:u'\`.\*(rq
In this case,
-.B [[=e]]
-is a regexp
+.B [[=e=]]
+is a regular expression
that matches any of
- .BR e ,
- .BR e\' ,
+.BR e ,
+....BR "e\'" ,
+.BR "e\h'-\w:e:u'\'" ,
or
- .BR e\` .
+....BR "e\`" .
+.BR "e\h'-\w:e:u'\`" .
.PP
These features are very valuable in non-English speaking locales.
The library functions that
@@ -1253,22 +1525,22 @@ and
.B \e'
operators are specific to
.IR gawk ;
-they are extensions based on facilities in the \*(GN regexp libraries.
+they are extensions based on facilities in the \*(GN regular expression libraries.
.PP
The various command line options
control how
.I gawk
-interprets characters in regexps.
+interprets characters in regular expressions.
.TP
No options
In the default case,
.I gawk
provide all the facilities of
-\*(PX regexps and the \*(GN regexp operators described above.
+\*(PX regular expressions and the \*(GN regular expression operators described above.
However, interval expressions are not supported.
.TP
.B \-\^\-posix
-Only \*(PX regexps are supported, the \*(GN operators are not special.
+Only \*(PX regular expressions are supported, the \*(GN operators are not special.
(E.g.,
.B \ew
matches a literal
@@ -1278,16 +1550,16 @@ Interval expressions are allowed.
.B \-\^\-traditional
Traditional Unix
.I awk
-regexps are matched. The \*(GN operators
+regular expressions are matched. The \*(GN operators
are not special, interval expressions are not available, and neither
are the \*(PX character classes
.RB ( [[:alnum:]]
and so on).
Characters described by octal and hexadecimal escape sequences are
-treated literally, even if they represent regexp metacharacters.
+treated literally, even if they represent regular expression metacharacters.
.TP
.B \-\^\-re\-interval
-Allow interval expressions in regexps, even if
+Allow interval expressions in regular expressions, even if
.B \-\^\-traditional
has been provided.
.SS Actions
@@ -1413,8 +1685,14 @@ as follows:
The input/output statements are as follows:
.PP
.TP "\w'\fBprintf \fIfmt, expr-list\fR'u+1n"
-.BI close( file )
-Close file (or pipe, see below).
+\fBclose(\fIfile \fR[\fB, \fIhow\fR]\fB)\fR
+Close file, pipe or co-process.
+The optional
+.I how
+should only be used when closing one end of a
+two-way pipe to a co-process.
+It must be a string value, either
+\fB"to"\fR or \fB"from"\fR.
.TP
.B getline
Set
@@ -1445,6 +1723,28 @@ Set
from next record of
.IR file .
.TP
+\fIcommand\fB | getline \fR[\fIvar\fR]
+Run
+.I command
+piping the output either into
+.B $0
+or
+.IR var ,
+as above.
+.TP
+\fIcommand\fB |& getline \fR[\fIvar\fR]
+Run
+.I command
+as a co-process
+piping the output either into
+.B $0
+or
+.IR var ,
+as above.
+Co-processes are a
+.I gawk
+extension.
+.TP
.B next
Stop processing the current input record. The next input record
is read and processing starts over with the first pattern in the
@@ -1461,14 +1761,9 @@ and
are updated,
.B FNR
is reset to 1, and processing starts over with the first pattern in the
-\*(AK program. If the end of the input data is reached, the
+\*(AK program. If the end of the input data is reached, the
.B END
block(s), if any, are executed.
-.B NOTE:
-Earlier versions of gawk used
-.BR "next file" ,
-as two words. While this usage is still recognized, it generates a
-warning message and will eventually be removed.
.TP
.B print
Prints the current record.
@@ -1519,36 +1814,41 @@ is the null string,
then all open output files and pipes
have their buffers flushed.
.PP
-Other input/output redirections are also allowed. For
+Additional output redirections are allowed for
.B print
and
-.BR printf ,
-.BI >> " file"
+.BR printf .
+.TP
+.BI "print .\|.\|. >>" " file"
appends output to the
-.IR file ,
-while
-.BI | " command"
+.IR file .
+.TP
+.BI "print .\|.\|. |" " command"
writes on a pipe.
-In a similar fashion,
-.IB command " | getline"
-pipes into
-.BR getline .
+.TP
+.BI "print .\|.\|. |&" " command"
+sends data to a co-process.
+.PP
The
.BR getline
-command will return 0 on end of file, and \-1 on an error.
+command returns 0 on end of file and \-1 on an error.
+Upon an error,
+.B ERRNO
+contains a string describing the problem.
.PP
-NOTE: If using a pipe to
+.B NOTE:
+If using a pipe or co-process to
.BR getline ,
or from
.B print
or
-.BR printf
+.B printf
within a loop, you
.I must
use
.B close()
to create new instances of the command.
-AWK does not automatically close pipes when
+\*(AK does not automatically close pipes or co-processes when
they return EOF.
.SS The \fIprintf\fP\^ Statement
.PP
@@ -1559,7 +1859,7 @@ statement and
function
(see below)
accept the following conversion specification formats:
-.TP
+.TP "\w'\fB%g\fR, \fB%G\fR'u+2n"
.B %c
An \s-1ASCII\s+1 character.
If the argument used for
@@ -1568,18 +1868,10 @@ is numeric, it is treated as a character and printed.
Otherwise, the argument is assumed to be a string, and the only first
character of that string is printed.
.TP
-.PD 0
-.B %d
-.TP
-.PD
-.B %i
+.BR "%d" "," " %i"
A decimal number (the integer part).
.TP
-.PD 0
-.B %e
-.TP
-.PD
-.B %E
+.B %e , " %E"
A floating point number of the form
.BR [\-]d.dddddde[+\^\-]dd .
The
@@ -1593,11 +1885,7 @@ instead of
A floating point number of the form
.BR [\-]ddd.dddddd .
.TP
-.PD 0
-.B %g
-.TP
-.PD
-.B %G
+.B %g , " %G"
Use
.B %e
or
@@ -1620,11 +1908,7 @@ An unsigned decimal number (again, an integer).
.B %s
A character string.
.TP
-.PD 0
-.B %x
-.TP
-.PD
-.B %X
+.B %x , " %X"
An unsigned hexadecimal number (an integer).
The
.B %X
@@ -1638,10 +1922,23 @@ A single
.B %
character; no argument is converted.
.PP
-There are optional, additional parameters that may lie between the
+Optional, additional parameters may lie between the
.B %
and the control letter:
.TP
+.IB count $
+Use the
+.IR count "'th"
+argument at this point in the formatting.
+This is called a
+.I "positional specifier"
+and
+is intended primarily for use in translated versions of
+format strings, not in the original text of an AWK program.
+It is a
+.I gawk
+extension.
+.TP
.B \-
The expression should be left-justified within its field.
.TP
@@ -1676,7 +1973,7 @@ For
.BR %E ,
and
.BR %f ,
-the result will always contain a
+the result always contains a
decimal point.
For
.BR %g ,
@@ -1722,7 +2019,9 @@ of significant digits. For the
and
.B %X
formats, it specifies the minimum number of
-digits to print. For a string, it specifies the maximum number of
+digits to print. For
+.BR %s ,
+it specifies the maximum number of
characters from the string that should be printed.
.PP
The dynamic
@@ -1738,11 +2037,18 @@ in place of either the
.B width
or
.B prec
-specifications will cause their values to be taken from
+specifications causes their values to be taken from
the argument list to
.B printf
or
.BR sprintf() .
+To use a positional specifier with a dynamic width or precision,
+supply the
+.IB count $
+after the
+.B *
+in the format string.
+For example, \fB"%3$*2$.*1$s"\fP.
.SS Special File Names
.PP
When doing I/O redirection from either
@@ -1756,13 +2062,72 @@ from a file,
.I gawk
recognizes certain special filenames internally. These filenames
allow access to open file descriptors inherited from
-.IR gawk 's
+.IR gawk\^ "'s"
parent process (usually the shell).
+These file names may also be used on the command line to name data files.
+The filenames are:
+.TP "\w'\fB/dev/stdout\fR'u+1n"
+.B /dev/stdin
+The standard input.
+.TP
+.B /dev/stdout
+The standard output.
+.TP
+.B /dev/stderr
+The standard error output.
+.TP
+.BI /dev/fd/\^ n
+The file associated with the open file descriptor
+.IR n .
+.PP
+These are particularly useful for error messages. For example:
+.PP
+.RS
+.ft B
+print "You blew it!" > "/dev/stderr"
+.ft R
+.RE
+.PP
+whereas you would otherwise have to use
+.PP
+.RS
+.ft B
+print "You blew it!" | "cat 1>&2"
+.ft R
+.RE
+.PP
+The following special filenames may be used with the
+.B |&
+co-process operator for creating TCP/IP network connections.
+.TP "\w'\fB/inet/tcp/\fIlport\fB/\fIrhost\fB/\fIrport\fR'u+2n"
+.BI /inet/tcp/ lport / rhost / rport
+File for TCP/IP connection on local port
+.I lport
+to
+remote host
+.I rhost
+on remote port
+.IR rport .
+Use a port of
+.B 0
+to have the system pick a port.
+.TP
+.BI /inet/udp/ lport / rhost / rport
+Similar, but use UDP/IP instead of TCP/IP.
+.TP
+.BI /inet/raw/ lport / rhost / rport
+.\" Similar, but use raw IP sockets.
+Reserved for future use.
+.PP
Other special filenames provide access to information about the running
-.B gawk
+.I gawk
process.
+.B "These filenames are now obsolete."
+Use the
+.B PROCINFO
+array to obtain the information they provide.
The filenames are:
-.TP \w'\fB/dev/stdout\fR'u+1n
+.TP "\w'\fB/dev/stdout\fR'u+1n"
.B /dev/pid
Reading this file returns the process ID of the current process,
in decimal, terminated with a newline.
@@ -1797,88 +2162,84 @@ system call.
If there are any additional fields, they are the group IDs returned by
.IR getgroups (2).
Multiple groups may not be supported on all systems.
-.TP
-.B /dev/stdin
-The standard input.
-.TP
-.B /dev/stdout
-The standard output.
-.TP
-.B /dev/stderr
-The standard error output.
-.TP
-.BI /dev/fd/\^ n
-The file associated with the open file descriptor
-.IR n .
-.PP
-These are particularly useful for error messages. For example:
-.PP
-.RS
-.ft B
-print "You blew it!" > "/dev/stderr"
-.ft R
-.RE
-.PP
-whereas you would otherwise have to use
-.PP
-.RS
-.ft B
-print "You blew it!" | "cat 1>&2"
-.ft R
-.RE
-.PP
-These file names may also be used on the command line to name data files.
.SS Numeric Functions
.PP
-\*(AK has the following pre-defined arithmetic functions:
+\*(AK has the following built-in arithmetic functions:
.PP
-.TP \w'\fBsrand(\fR[\fIexpr\^\fR]\fB)\fR'u+1n
+.TP "\w'\fBsrand(\fR[\fIexpr\^\fR]\fB)\fR'u+1n"
.BI atan2( y , " x" )
-returns the arctangent of
+Returns the arctangent of
.I y/x
in radians.
.TP
.BI cos( expr )
-returns the cosine of
+Returns the cosine of
.IR expr ,
which is in radians.
.TP
.BI exp( expr )
-the exponential function.
+The exponential function.
.TP
.BI int( expr )
-truncates to integer.
+Truncates to integer.
.TP
.BI log( expr )
-the natural logarithm function.
+The natural logarithm function.
.TP
.B rand()
-returns a random number between 0 and 1.
+Returns a random number between 0 and 1.
.TP
.BI sin( expr )
-returns the sine of
+Returns the sine of
.IR expr ,
which is in radians.
.TP
.BI sqrt( expr )
-the square root function.
+The square root function.
.TP
\&\fBsrand(\fR[\fIexpr\^\fR]\fB)\fR
-uses
+Uses
.I expr
as a new seed for the random number generator. If no
.I expr
-is provided, the time of day will be used.
+is provided, the time of day is used.
The return value is the previous seed for the random
number generator.
.SS String Functions
.PP
.I Gawk
-has the following pre-defined string functions:
+has the following built-in string functions:
.PP
.TP "\w'\fBsprintf(\^\fIfmt\fB\^, \fIexpr-list\^\fB)\fR'u+1n"
+\fBasort(\fIs \fR[\fB, \fId\fR]\fB)\fR
+Returns the number of elements in the source
+array
+.IR s .
+The contents of
+.I s
+are sorted using
+.IR gawk\^ "'s"
+normal rules for
+comparing values, and the indexes of the
+sorted values of
+.I s
+are replaced with sequential
+integers starting with 1. If the optional
+destination array
+.I d
+is specified, then
+.I s
+is first duplicated into
+.IR d ,
+and then
+.I d
+is sorted, leaving the indexes of the
+source array
+.I s
+unchanged.
+.TP
\fBgensub(\fIr\fB, \fIs\fB, \fIh \fR[\fB, \fIt\fR]\fB)\fR
-search the target string
+Search the target string
.I t
for matches of the regular expression
.IR r .
@@ -1897,9 +2258,9 @@ Otherwise,
is a number indicating which match of
.I r
to replace.
-If no
+If
.I t
-is supplied,
+is not supplied,
.B $0
is used instead.
Within the replacement text
@@ -1925,7 +2286,7 @@ and the original target string is
changed.
.TP "\w'\fBsprintf(\^\fIfmt\fB\^, \fIexpr-list\^\fB)\fR'u+1n"
\fBgsub(\fIr\fB, \fIs \fR[\fB, \fIt\fR]\fB)\fR
-for each substring matching the regular expression
+For each substring matching the regular expression
.I r
in the string
.IR t ,
@@ -1943,18 +2304,18 @@ Use
.B \e&
to get a literal
.BR & .
-See
-.I "Effective AWK Programming"
+(This must be typed as \fB"\e\e&"\fP;
+see \*(EP
for a fuller discussion of the rules for
.BR &'s
and backslashes in the replacement text of
.BR sub() ,
.BR gsub() ,
and
-.BR gensub() .
+.BR gensub() .)
.TP
.BI index( s , " t" )
-returns the index of the string
+Returns the index of the string
.I t
in the string
.IR s ,
@@ -1963,7 +2324,7 @@ or 0 if
is not present.
.TP
\fBlength(\fR[\fIs\fR]\fB)
-returns the length of the string
+Returns the length of the string
.IR s ,
or the length of
.B $0
@@ -1971,8 +2332,8 @@ if
.I s
is not supplied.
.TP
-.BI match( s , " r" )
-returns the position in
+\fBmatch(\fIs\fB, \fIr \fR[\fB, \fIa\fR]\fB)\fR
+Returns the position in
.I s
where the regular expression
.I r
@@ -1982,9 +2343,33 @@ is not present, and sets the values of
.B RSTART
and
.BR RLENGTH .
+Note that the argument order is the same as for the
+.B ~
+operator:
+.IB str " ~"
+.IR re .
+.ft R
+If array
+.I a
+is provided,
+.I a
+is cleared and then elements 1 through
+.I n
+are filled with the portions of
+.I s
+that match the corresponding parenthesized
+subexpression in
+.IR r .
+The 0'th element of
+.I a
+contains the portion
+of
+.I s
+matched by the entire regular expression
+.IR r .
.TP
\fBsplit(\fIs\fB, \fIa \fR[\fB, \fIr\fR]\fB)\fR
-splits the string
+Splits the string
.I s
into the array
.I a
@@ -2001,19 +2386,44 @@ is cleared first.
Splitting behaves identically to field splitting, described above.
.TP
.BI sprintf( fmt , " expr-list" )
-prints
+Prints
.I expr-list
according to
.IR fmt ,
and returns the resulting string.
.TP
+.BI strtonum( str )
+Examines
+.IR str ,
+and returns its numeric value.
+If
+.I str
+begins
+with a leading
+.BR 0 ,
+.B strtonum()
+assumes that
+.I str
+is an octal number.
+If
+.I str
+begins
+with a leading
+.B 0x
+or
+.BR 0X ,
+.B strtonum()
+assumes that
+.I str
+is a hexadecimal number.
+.TP
\fBsub(\fIr\fB, \fIs \fR[\fB, \fIt\fR]\fB)\fR
-just like
+Just like
.BR gsub() ,
but only the first matching substring is replaced.
.TP
\fBsubstr(\fIs\fB, \fIi \fR[\fB, \fIn\fR]\fB)\fR
-returns the at most
+Returns the at most
.IR n -character
substring of
.I s
@@ -2026,7 +2436,7 @@ is omitted, the rest of
is used.
.TP
.BI tolower( str )
-returns a copy of the string
+Returns a copy of the string
.IR str ,
with all the upper-case characters in
.I str
@@ -2034,27 +2444,58 @@ translated to their corresponding lower-case counterparts.
Non-alphabetic characters are left unchanged.
.TP
.BI toupper( str )
-returns a copy of the string
+Returns a copy of the string
.IR str ,
with all the lower-case characters in
.I str
translated to their corresponding upper-case counterparts.
Non-alphabetic characters are left unchanged.
.SS Time Functions
-.PP
Since one of the primary uses of \*(AK programs is processing log files
that contain time stamp information,
.I gawk
-provides the following two functions for obtaining time stamps and
+provides the following functions for obtaining time stamps and
formatting them.
.PP
.TP "\w'\fBsystime()\fR'u+1n"
-.B systime()
-returns the current time of day as the number of seconds since the Epoch
-(Midnight UTC, January 1, 1970 on \*(PX systems).
+\fBmktime(\fIdatespec\fB)\fR
+Rurns
+.I datespec
+into a time stamp of the same form as returned by
+.BR systime() .
+The
+.I datespec
+is a string of the form
+.IR "YYYY MM DD HH MM SS[ DST]" .
+The contents of the string are six or seven numbers representing respectively
+the full year including century,
+the month from 1 to 12,
+the day of the month from 1 to 31,
+the hour of the day from 0 to 23,
+the minute from 0 to 59,
+and the second from 0 to 60,
+and an optional daylight saving flag.
+The values of these numbers need not be within the ranges specified;
+for example, an hour of \-1 means 1 hour before midnight.
+The origin-zero Gregorian calendar is assumed,
+with year 0 preceding year 1 and year \-1 preceding year 0.
+The time is assumed to be in the local timezone.
+If the daylight saving flag is positive,
+the time is assumed to be daylight saving time;
+if zero, the time is assumed to be standard time;
+and if negative (the default),
+.B mktime()
+attempts to determine whether daylight saving time is in effect
+for the specified time.
+If
+.I datespec
+does not contain enough elements or if the resulting time
+is out of range,
+.B mktime()
+returns \-1.
.TP
\fBstrftime(\fR[\fIformat \fR[\fB, \fItimestamp\fR]]\fB)\fR
-formats
+Formats
.I timestamp
according to the specification in
.IR format.
@@ -2069,7 +2510,7 @@ If
.I format
is missing, a default format equivalent to the output of
.IR date (1)
-will be used.
+is used.
See the specification for the
.B strftime()
function in \*(AN C for the format conversions that are
@@ -2082,68 +2523,113 @@ if that version was used to build
.IR gawk ,
then all of the conversions described in that man page are available to
.IR gawk.
-.SS String Constants
-.PP
-String constants in \*(AK are sequences of characters enclosed
-between double quotes (\fB"\fR). Within strings, certain
-.I "escape sequences"
-are recognized, as in C. These are:
-.PP
-.TP \w'\fB\e\^\fIddd\fR'u+1n
-.B \e\e
-A literal backslash.
.TP
-.B \ea
-The \*(lqalert\*(rq character; usually the \s-1ASCII\s+1 \s-1BEL\s+1 character.
-.TP
-.B \eb
-backspace.
-.TP
-.B \ef
-form-feed.
-.TP
-.B \en
-newline.
-.TP
-.B \er
-carriage return.
+.B systime()
+Returns the current time of day as the number of seconds since the Epoch
+(1970-01-01 00:00:00 UTC on \*(PX systems).
+.SS Bit Manipulations Functions
+Starting with version 3.1 of
+.IR gawk ,
+the following bit manipulation functions are available.
+They work by converting double-precision floating point
+values to
+.B "unsigned long"
+integers, doing the operation, and then converting the
+result back to floating point.
+The functions are:
+.TP "\w'\fBrshift(\fIval\fB, \fIcount\fB)\fR'u+2n"
+\fBand(\fIv1\fB, \fIv2\fB)\fR
+Return the bitwise AND of the values provided by
+.I v1
+and
+.IR v2 .
.TP
-.B \et
-horizontal tab.
+\fBcompl(\fIval\fB)\fR
+Return the bitwise complement of
+.IR val .
.TP
-.B \ev
-vertical tab.
+\fBlshift(\fIval\fB, \fIcount\fB)\fR
+Return the value of
+.IR val ,
+shifted left by
+.I count
+bits.
.TP
-.BI \ex "\^hex digits"
-The character represented by the string of hexadecimal digits following
-the
-.BR \ex .
-As in \*(AN C, all following hexadecimal digits are considered part of
-the escape sequence.
-(This feature should tell us something about language design by committee.)
-E.g., \fB"\ex1B"\fR is the \s-1ASCII\s+1 \s-1ESC\s+1 (escape) character.
+\fBor(\fIv1\fB, \fIv2\fB)\fR
+Return the bitwise OR of the values provided by
+.I v1
+and
+.IR v2 .
.TP
-.BI \e ddd
-The character represented by the 1-, 2-, or 3-digit sequence of octal
-digits.
-E.g., \fB"\e033"\fR is the \s-1ASCII\s+1 \s-1ESC\s+1 (escape) character.
+\fBrshift(\fIval\fB, \fIcount\fB)\fR
+Return the value of
+.IR val ,
+shifted right by
+.I count
+bits.
.TP
-.BI \e c
-The literal character
-.IR c\^ .
-.PP
-The escape sequences may also be used inside constant regular expressions
-(e.g.,
-.B "/[\ \et\ef\en\er\ev]/"
-matches whitespace characters).
+\fBxor(\fIv1\fB, \fIv2\fB)\fR
+Return the bitwise XOR of the values provided by
+.I v1
+and
+.IR v2 .
.PP
-In compatibility mode, the characters represented by octal and
-hexadecimal escape sequences are treated literally when used in
-regexp constants. Thus,
-.B /a\e52b/
-is equivalent to
-.BR /a\e*b/ .
-.SH FUNCTIONS
+.SS Internationalization Functions
+Starting with version 3.1 of
+.IR gawk ,
+the following functions may be used from within your AWK program for
+translating strings at run-time.
+For full details, see \*(EP.
+.TP
+\fBbindtextdomain(\fIdirectory \fR[\fB, \fIdomain\fR]\fB)\fR
+Specifies the directory where
+.I gawk
+looks for the
+.B \&.mo
+files, in case they
+will not or cannot be placed in the ``standard'' locations
+(e.g., during testing).
+It returns the directory where
+.I domain
+is ``bound.''
+.sp .5
+The default
+.I domain
+is the value of
+.BR TEXTDOMAIN .
+If
+.I directory
+is the null string (\fB""\fR), then
+.B bindtextdomain()
+returns the current binding for the
+given
+.IR domain .
+.TP
+\fBdcgettext(\fIstring \fR[\fB, \fIdomain \fR[\fB, \fIcategory\fR]]\fB)\fR
+Returns the translation of
+.I string
+in
+text domain
+.I domain
+for locale category
+.IR category .
+The default value for
+.I domain
+is the current value of
+.BR TEXTDOMAIN .
+The default value for
+.I category
+is \fB"LC_MESSAGES"\fR.
+.sp .5
+If you supply a value for
+.IR category ,
+it must be a string equal to
+one of the known locale categories described
+in \*(EP.
+You must also supply a text domain. Use
+.B TEXTDOMAIN
+if you want to use the current domain.
+.SH USER-DEFINED FUNCTIONS
Functions in \*(AK are defined as follows:
.PP
.RS
@@ -2163,7 +2649,7 @@ real parameters by extra spaces in the parameter list. For example:
.RS
.ft B
.nf
-function f(p, q, a, b) # a & b are local
+function f(p, q, a, b) # a and b are local
{
\&.\|.\|.
}
@@ -2193,7 +2679,7 @@ If
.B \-\^\-lint
has been provided,
.I gawk
-will warn about calls to undefined functions at parse time,
+warns about calls to undefined functions at parse time,
instead of at run time.
Calling an undefined function at run time is a fatal error.
.PP
@@ -2201,6 +2687,45 @@ The word
.B func
may be used in place of
.BR function .
+.SH DYNAMICALLY LOADING NEW FUNCTIONS
+Beginning with version 3.1 of
+.IR gawk ,
+you can dynamically add new built-in functions to the running
+.I gawk
+interpreter.
+The full details are beyond the scope of this manual page;
+see \*(EP for the details.
+.PP
+.TP 8
+\fBextension(\fIobject\fB, \fIfunction\fB)\fR
+Dynamically link the shared object file named by
+.IR object ,
+and invoke
+.I function
+in that object, to perform initialization.
+These should both be provided as strings.
+Returns the value returned by
+.IR function .
+.PP
+.ft B
+This function is provided and documented in \*(EP,
+but everything about this feature is likely to change
+in the next release.
+We STRONGLY recommend that you do not use this feature
+for anything that you aren't willing to redo.
+.ft R
+.SH SIGNALS
+.I pgawk
+accepts two signals.
+.B SIGUSR1
+causes it to dump a profile and function call stack to the
+profile file, which is either
+.BR awkprof.out ,
+or whatever file was named with the
+.B \-\^\-profile
+option. It then continues to run.
+.B SIGHUP
+causes it to dump the profile and function call stack and then exit.
.SH EXAMPLES
.nf
Print and sort the login names of all users:
@@ -2229,23 +2754,84 @@ Concatenate and line number (a variation on a theme):
{ print NR, $0 }
.ft R
.fi
-.SH SEE ALSO
-.IR egrep (1),
-.IR getpid (2),
-.IR getppid (2),
-.IR getpgrp (2),
-.IR getuid (2),
-.IR geteuid (2),
-.IR getgid (2),
-.IR getegid (2),
-.IR getgroups (2)
-.PP
-.IR "The AWK Programming Language" ,
-Alfred V. Aho, Brian W. Kernighan, Peter J. Weinberger,
-Addison-Wesley, 1988. ISBN 0-201-07981-X.
-.PP
-.IR "Effective AWK Programming" ,
-Edition 1.0, published by the Free Software Foundation, 1995.
+.SH INTERNATIONALIZATION
+.PP
+String constants are sequences of characters enclosed in double
+quotes. In non-English speaking environments, it is possible to mark
+strings in the \*(AK program as requiring translation to the native
+natural language. Such strings are marked in the \*(AK program with
+a leading underscore (\*(lq_\*(rq). For example,
+.sp
+.RS
+.ft B
+gawk 'BEGIN { print "hello, world" }'
+.RE
+.sp
+.ft R
+always prints
+.BR "hello, world" .
+But,
+.sp
+.RS
+.ft B
+gawk 'BEGIN { print _"hello, world" }'
+.RE
+.sp
+.ft R
+might print
+.B "bonjour, monde"
+in France.
+.PP
+There are several steps involved in producing and running a localizable
+\*(AK program.
+.TP "\w'4.'u+2n"
+1.
+Add a
+.B BEGIN
+action to assign a value to the
+.B TEXTDOMAIN
+variable to set the text domain to a name associated with your program.
+.sp
+.ti +5n
+.ft B
+BEGIN { TEXTDOMAIN = "myprog" }
+.ft R
+.sp
+This allows
+.I gawk
+to find the
+.B \&.mo
+file associated with your program.
+Without this step,
+.I gawk
+uses the
+.B messages
+text domain,
+which likely does not contain translations for your program.
+.TP
+2.
+Mark all strings that should be translated with leading underscores.
+.TP
+3.
+If necessary, use the
+.B dcgettext()
+and/or
+.B bindtextdomain()
+functions in your program, as appropriate.
+.TP
+4.
+Run
+.B "gawk \-\^\-gen\-po \-f myprog.awk > myprog.po"
+to generate a
+.B \&.po
+file for your program.
+.TP
+5.
+Provide appropriate translations, and build and install a corresponding
+.B \&.mo
+file.
+.PP
+The internationalization features are described in full detail in \*(EP.
.SH POSIX COMPATIBILITY
A primary goal for
.I gawk
@@ -2256,13 +2842,10 @@ To this end,
.I gawk
incorporates the following user visible
features which are not described in the \*(AK book,
-but are part of the Bell Labs version of
+but are part of the Bell Laboratories version of
.IR awk ,
and are in the \*(PX standard.
.PP
-The
-.B \-v
-option for assigning variables before program execution starts is new.
The book indicates that command line variable assignment happens when
.I awk
would otherwise open the argument as a file, which is after the
@@ -2275,9 +2858,11 @@ the
block was run. Applications came to depend on this \*(lqfeature.\*(rq
When
.I awk
-was changed to match its documentation, this option was added to
+was changed to match its documentation, the
+.B \-v
+option for assigning variables before program execution was added to
accommodate applications that depended upon the old behavior.
-(This feature was agreed upon by both the AT&T and \*(GN developers.)
+(This feature was agreed upon by both the Bell Laboratories and the \*(GN developers.)
.PP
The
.B \-W
@@ -2287,7 +2872,7 @@ When processing arguments,
.I gawk
uses the special option \*(lq\-\^\-\*(rq to signal the end of
arguments.
-In compatibility mode, it will warn about, but otherwise ignore,
+In compatibility mode, it warns about but otherwise ignores
undefined options.
In normal operation, such arguments are passed on to the \*(AK program for
it to process.
@@ -2315,13 +2900,61 @@ and
.BR \ev
escape sequences (done originally in
.I gawk
-and fed back into AT&T's); the
+and fed back into the Bell Laboratories version); the
.B tolower()
and
.B toupper()
-built-in functions (from AT&T); and the \*(AN C conversion specifications in
+built-in functions (from the Bell Laboratories version); and the \*(AN C conversion specifications in
.B printf
-(done first in AT&T's version).
+(done first in the Bell Laboratories version).
+.SH HISTORICAL FEATURES
+There are two features of historical \*(AK implementations that
+.I gawk
+supports.
+First, it is possible to call the
+.B length()
+built-in function not only with no argument, but even without parentheses!
+Thus,
+.RS
+.PP
+.ft B
+a = length # Holy Algol 60, Batman!
+.ft R
+.RE
+.PP
+is the same as either of
+.RS
+.PP
+.ft B
+a = length()
+.br
+a = length($0)
+.ft R
+.RE
+.PP
+This feature is marked as \*(lqdeprecated\*(rq in the \*(PX standard, and
+.I gawk
+issues a warning about its use if
+.B \-\^\-lint
+is specified on the command line.
+.PP
+The other feature is the use of either the
+.B continue
+or the
+.B break
+statements outside the body of a
+.BR while ,
+.BR for ,
+or
+.B do
+loop. Traditional \*(AK implementations have treated such usage as
+equivalent to the
+.B next
+statement.
+.I Gawk
+supports this usage if
+.B \-\^\-traditional
+has been specified.
.SH GNU EXTENSIONS
.I Gawk
has a number of extensions to \*(PX
@@ -2339,15 +2972,23 @@ The following features of
are not available in
\*(PX
.IR awk .
-.RS
-.TP \w'\(bu'u+1n
+.\" Environment vars and startup stuff
+.TP "\w'\(bu'u+1n"
+\(bu
+No path search is performed for files named via the
+.B \-f
+option. Therefore the
+.B AWKPATH
+environment variable is not special.
+.\" POSIX and language recognition issues
+.TP
\(bu
The
.B \ex
escape sequence.
(Disabled with
.BR \-\^\-posix .)
-.TP \w'\(bu'u+1n
+.TP
\(bu
The
.B fflush()
@@ -2356,22 +2997,26 @@ function.
.BR \-\^\-posix .)
.TP
\(bu
-The
-.BR systime(),
-.BR strftime(),
+The ability to continue lines after
+.B ?
and
-.B gensub()
-functions.
+.BR : .
+(Disabled with
+.BR \-\^\-posix .)
.TP
\(bu
-The special file names available for I/O redirection are not recognized.
+Octal and hexadecimal constants in AWK programs.
+.\" Special variables
.TP
\(bu
The
.BR ARGIND ,
+.BR BINMODE ,
.BR ERRNO ,
+.BR LINT ,
+.B RT
and
-.B RT
+.B TEXTDOMAIN
variables are not special.
.TP
\(bu
@@ -2385,11 +3030,26 @@ The
variable and fixed-width field splitting.
.TP
\(bu
+The
+.B PROCINFO
+array is not available.
+.\" I/O stuff
+.TP
+\(bu
The use of
.B RS
as a regular expression.
.TP
\(bu
+The special file names available for I/O redirection are not recognized.
+.TP
+\(bu
+The
+.B |&
+operator for creating co-processes.
+.\" Changes to standard awk functions
+.TP
+\(bu
The ability to split out individual characters using the null string
as the value of
.BR FS ,
@@ -2397,33 +3057,75 @@ and as the third argument to
.BR split() .
.TP
\(bu
-No path search is performed for files named via the
-.B \-f
-option. Therefore the
-.B AWKPATH
-environment variable is not special.
+The optional second argument to the
+.B close()
+function.
.TP
\(bu
-The use of
-.B "nextfile"
-to abandon processing of the current input file.
+The optional third argument to the
+.B match()
+function.
+.TP
+\(bu
+The ability to use positional specifiers with
+.B printf
+and
+.BR sprintf() .
+.\" New keywords or changes to keywords
.TP
\(bu
The use of
.BI delete " array"
to delete the entire contents of an array.
-.RE
+.TP
+\(bu
+The use of
+.B "nextfile"
+to abandon processing of the current input file.
+.\" New functions
+.TP
+\(bu
+The
+.BR and() ,
+.BR asort() ,
+.BR bindtextdomain() ,
+.BR compl() ,
+.BR dcgettext() ,
+.BR gensub() ,
+.BR lshift() ,
+.BR mktime() ,
+.BR or() ,
+.BR rshift() ,
+.BR strftime() ,
+.BR strtonum() ,
+.B systime()
+and
+.B xor()
+functions.
+.\" I18N stuff
+.TP
+\(bu
+Localizable strings.
+.\" Extending gawk
+.TP
+\(bu
+Adding new built-in functions dynamically with the
+.B extension()
+function.
.PP
-The AWK book does not define the return value of the
+The \*(AK book does not define the return value of the
.B close()
function.
-.IR Gawk\^ 's
+.IR Gawk\^ "'s"
.B close()
returns the value from
.IR fclose (3),
or
.IR pclose (3),
-when closing a file or pipe, respectively.
+when closing an output file or pipe, respectively.
+It returns the process's exit status when closing an input pipe.
+The return value is \-1 if the named file, pipe
+or co-process was not opened with a redirection.
.PP
When
.I gawk
@@ -2436,7 +3138,7 @@ argument to the
.B \-F
option is \*(lqt\*(rq, then
.B FS
-will be set to the tab character.
+is set to the tab character.
Note that typing
.B "gawk \-F\et \&.\|.\|."
simply causes the shell to quote the \*(lqt,\*(rq, and does not pass
@@ -2448,14 +3150,14 @@ This behavior also does not occur if
.B \-\^\-posix
has been specified.
To really get a tab character as the field separator, it is best to use
-quotes:
+single quotes:
.BR "gawk \-F'\et' \&.\|.\|." .
.ig
.PP
If
.I gawk
-was compiled for debugging, it will
-accept the following additional options:
+was compiled for debugging, it
+accepts the following additional options:
.TP
.PD 0
.B \-Wparsedebug
@@ -2472,55 +3174,17 @@ This option should only be of interest to the
maintainers, and may not even be compiled into
.IR gawk .
..
-.SH HISTORICAL FEATURES
-There are two features of historical \*(AK implementations that
-.I gawk
-supports.
-First, it is possible to call the
-.B length()
-built-in function not only with no argument, but even without parentheses!
-Thus,
-.RS
-.PP
-.ft B
-a = length # Holy Algol 60, Batman!
-.ft R
-.RE
-.PP
-is the same as either of
-.RS
-.PP
-.ft B
-a = length()
-.br
-a = length($0)
-.ft R
-.RE
-.PP
-This feature is marked as \*(lqdeprecated\*(rq in the \*(PX standard, and
+.SH ENVIRONMENT VARIABLES
+The
+.B AWKPATH
+environment variable can be used to provide a list of directories that
.I gawk
-will issue a warning about its use if
-.B \-\^\-lint
-is specified on the command line.
+searches when looking for files named via the
+.B \-f
+and
+.B \-\^\-file
+options.
.PP
-The other feature is the use of either the
-.B continue
-or the
-.B break
-statements outside the body of a
-.BR while ,
-.BR for ,
-or
-.B do
-loop. Traditional \*(AK implementations have treated such usage as
-equivalent to the
-.B next
-statement.
-.I Gawk
-will support this usage if
-.B \-\^\-traditional
-has been specified.
-.SH ENVIRONMENT VARIABLES
If
.B POSIXLY_CORRECT
exists in the environment, then
@@ -2532,54 +3196,47 @@ If
.B \-\^\-lint
has been specified,
.I gawk
-will issue a warning message to this effect.
+issues a warning message to this effect.
+.SH SEE ALSO
+.IR egrep (1),
+.IR getpid (2),
+.IR getppid (2),
+.IR getpgrp (2),
+.IR getuid (2),
+.IR geteuid (2),
+.IR getgid (2),
+.IR getegid (2),
+.IR getgroups (2)
.PP
-The
-.B AWKPATH
-environment variable can be used to provide a list of directories that
-.I gawk
-will search when looking for files named via the
-.B \-f
-and
-.B \-\^\-file
-options.
+.IR "The AWK Programming Language" ,
+Alfred V. Aho, Brian W. Kernighan, Peter J. Weinberger,
+Addison-Wesley, 1988. ISBN 0-201-07981-X.
+.PP
+\*(EP,
+Edition 3.0, published by the Free Software Foundation, 2001.
.SH BUGS
The
.B \-F
option is not necessary given the command line variable assignment feature;
it remains only for backwards compatibility.
.PP
-If your system actually has support for
-.B /dev/fd
-and the associated
-.BR /dev/stdin ,
-.BR /dev/stdout ,
-and
-.B /dev/stderr
-files, you may get different output from
-.I gawk
-than you would get on a system without those files. When
-.I gawk
-interprets these files internally, it synchronizes output to the standard
-output with output to
-.BR /dev/stdout ,
-while on a system with those files, the output is actually to different
-open files.
-Caveat Emptor.
-.PP
Syntactically invalid single character programs tend to overflow
the parse stack, generating a rather unhelpful message. Such programs
are surprisingly difficult to diagnose in the completely general case,
and the effort to do so really is not worth it.
-.SH VERSION INFORMATION
-This man page documents
-.IR gawk ,
-version 3.0.6.
+.ig
+.PP
+.I Gawk
+suffers from ``feeping creaturism.''
+It's too bad
+.I perl
+is so inelegant.
+..
.SH AUTHORS
The original version of \*(UX
.I awk
was designed and implemented by Alfred Aho,
-Peter Weinberger, and Brian Kernighan of AT&T Bell Labs. Brian Kernighan
+Peter Weinberger, and Brian Kernighan of Bell Laboratories. Brian Kernighan
continues to maintain and enhance it.
.PP
Paul Rubin and Jay Fenlason,
@@ -2600,14 +3257,22 @@ The initial DOS port was done by Conrad Kwok and Scott Garfinkle.
Scott Deifik is the current DOS maintainer. Pat Rankin did the
port to VMS, and Michal Jaegermann did the port to the Atari ST.
The port to OS/2 was done by Kai Uwe Rommel, with contributions and
-help from Darrel Hankerson. Fred Fish supplied support for the Amiga.
+help from Darrel Hankerson. Fred Fish supplied support for the Amiga,
+Stephen Davies provided the Tandem port,
+and Martin Brown provided the BeOS port.
+.SH VERSION INFORMATION
+This man page documents
+.IR gawk ,
+version 3.1.0.
.SH BUG REPORTS
If you find a bug in
.IR gawk ,
please send electronic mail to
.BR bug-gawk@gnu.org .
Please include your operating system and its revision, the version of
-.IR gawk ,
+.I gawk
+(from
+.BR "gawk \-\^\-version" ),
what C compiler you used to compile it, and a test program
and data that are as small as possible for reproducing the problem.
.PP
@@ -2630,11 +3295,11 @@ developers occasionally read this newsgroup, posting bug reports there
is an unreliable way to report bugs. Instead, please use the electronic mail
addresses given above.
.SH ACKNOWLEDGEMENTS
-Brian Kernighan of Bell Labs
+Brian Kernighan of Bell Laboratories
provided valuable assistance during testing and debugging.
We thank him.
.SH COPYING PERMISSIONS
-Copyright \(co 1996\-2000 Free Software Foundation, Inc.
+Copyright \(co 1989, 1991\-2001 Free Software Foundation, Inc.
.PP
Permission is granted to make and distribute verbatim copies of
this manual page provided the copyright notice and this permission
diff --git a/contrib/awk/doc/gawk.texi b/contrib/awk/doc/gawk.texi
index 2657b14..808ef6e 100644
--- a/contrib/awk/doc/gawk.texi
+++ b/contrib/awk/doc/gawk.texi
@@ -4,38 +4,74 @@
@settitle The GNU Awk User's Guide
@c %**end of header (This is for running Texinfo on a region.)
-@c inside ifinfo for older versions of texinfo.tex
-@ifinfo
-@c I hope this is the right category
-@dircategory Programming Languages
+@dircategory GNU Packages
@direntry
-* Gawk: (gawk). A Text Scanning and Processing Language.
+* Gawk: (gawk). A text scanning and processing language.
+@end direntry
+@dircategory Individual utilities
+@direntry
+* awk: (gawk)Invoking gawk. Text scanning and processing.
@end direntry
-@end ifinfo
@c @set xref-automatic-section-title
-@c @set DRAFT
@c The following information should be updated here only!
@c This sets the edition of the document, the version of gawk it
-@c applies to, and when the document was updated.
-@set TITLE Effective AWK Programming
+@c applies to and all the info about who's publishing this edition
+
+@c These apply across the board.
+@set UPDATE-MONTH March, 2001
+@set VERSION 3.1
+@set PATCHLEVEL 0
+
+@set FSF
+
+@set TITLE GAWK: Effective AWK Programming
@set SUBTITLE A User's Guide for GNU Awk
-@set PATCHLEVEL 6
-@set EDITION 1.0.@value{PATCHLEVEL}
-@set VERSION 3.0
-@set UPDATE-MONTH July, 2000
+@set EDITION 3
+
@iftex
@set DOCUMENT book
+@set CHAPTER chapter
+@set APPENDIX appendix
+@set SECTION section
+@set SUBSECTION subsection
+@set DARKCORNER @inmargin{@image{lflashlight,1cm}, @image{rflashlight,1cm}}
@end iftex
@ifinfo
@set DOCUMENT Info file
+@set CHAPTER major node
+@set APPENDIX major node
+@set SECTION minor node
+@set SUBSECTION node
+@set DARKCORNER (d.c.)
@end ifinfo
+@ifhtml
+@set DOCUMENT Web page
+@set CHAPTER chapter
+@set APPENDIX appendix
+@set SECTION section
+@set SUBSECTION subsection
+@set DARKCORNER (d.c.)
+@end ifhtml
+
+@c some special symbols
+@iftex
+@set LEQ @math{@leq}
+@end iftex
+@ifnottex
+@set LEQ <=
+@end ifnottex
+
+@set FN file name
+@set FFN File Name
+@set DF data file
+@set DDF Data File
+@set PVERSION version
@ignore
Some comments on the layout for TeX.
-1. Use at least texinfo.tex 2.159. It contains fixes that
- are needed to get the footings for draft mode to not appear.
+1. Use at least texinfo.tex 2000-09-06.09
2. I have done A LOT of work to make this look good. There are `@page' commands
and use of `@group ... @end group' in a number of places. If you muck
with anything, it's your responsibility not to break the layout.
@@ -56,48 +92,45 @@ Some comments on the layout for TeX.
@c unwise to comment it out when running a master in case there are
@c overfulls which are deemed okay.
-@ifclear DRAFT
@iftex
@finalout
@end iftex
-@end ifclear
+@c Comment out the "smallbook" for technical review. Saves
+@c considerable paper. Remember to turn it back on *before*
+@c starting the page-breaking work.
@smallbook
-@iftex
-@c @cropmarks
-@end iftex
@ifinfo
-This file documents @code{awk}, a program that you can use to select
+This file documents @command{awk}, a program that you can use to select
particular records in a file and perform operations upon them.
-This is Edition @value{EDITION} of @cite{@value{TITLE}},
+This is Edition @value{EDITION} of @cite{@value{TITLE}: @value{SUBTITLE}},
for the @value{VERSION}.@value{PATCHLEVEL} version of the GNU implementation of AWK.
-Copyright (C) 1989, 1991, 1992, 1993, 1996-2000 Free Software Foundation, Inc.
+Copyright (C) 1989, 1991, 1992, 1993, 1996-2001 Free Software Foundation, Inc.
-Permission is granted to make and distribute verbatim copies of
-this manual provided the copyright notice and this permission notice
-are preserved on all copies.
+Permission is granted to copy, distribute and/or modify this document
+under the terms of the GNU Free Documentation License, Version 1.1 or
+any later version published by the Free Software Foundation; with the
+Invariant Sections being ``GNU General Public License'', the Front-Cover
+texts being (a) (see below), and with the Back-Cover Texts being (b)
+(see below). A copy of the license is included in the section entitled
+``GNU Free Documentation License''.
-@ignore
-Permission is granted to process this file through TeX and print the
-results, provided the printed document carries copying permission
-notice identical to this one except for the removal of this paragraph
-(this paragraph not being relevant to the printed manual).
+@enumerate a
+@item
+``A GNU Manual''
-@end ignore
-Permission is granted to copy and distribute modified versions of this
-manual under the conditions for verbatim copying, provided that the entire
-resulting derived work is distributed under the terms of a permission
-notice identical to this one.
-
-Permission is granted to copy and distribute translations of this manual
-into another language, under the above conditions for modified versions,
-except that this permission notice may be stated in a translation approved
-by the Foundation.
+@item
+``You have freedom to copy and modify this GNU Manual, like GNU
+software. Copies published by the Free Software Foundation raise
+funds for GNU development.''
+@end enumerate
@end ifinfo
+@c Uncomment this for the release. Leaving it off saves paper
+@c during editing and review.
@setchapternewpage odd
@titlepage
@@ -106,73 +139,72 @@ by the Foundation.
@subtitle Edition @value{EDITION}
@subtitle @value{UPDATE-MONTH}
@author Arnold D. Robbins
-@ignore
-@sp 1
-@author Based on @cite{The GAWK Manual},
-@author by Robbins, Close, Rubin, and Stallman
-@end ignore
@c Include the Distribution inside the titlepage environment so
@c that headings are turned off. Headings on and off do not work.
@page
@vskip 0pt plus 1filll
-@ifset LEGALJUNK
+@ignore
The programs and applications presented in this book have been
-included for their instructional value. They have been tested with care,
+included for their instructional value. They have been tested with care
but are not guaranteed for any particular purpose. The publisher does not
offer any warranties or representations, nor does it accept any
liabilities with respect to the programs or applications.
So there.
@sp 2
-UNIX is a registered trademark of X/Open, Ltd. @*
-Microsoft, MS, and MS-DOS are registered trademarks, and Windows is a
+UNIX is a registered trademark of The Open Group in the United States and other countries. @*
+Microsoft, MS and MS-DOS are registered trademarks, and Windows is a
trademark of Microsoft Corporation in the United States and other
countries. @*
-Atari, 520ST, 1040ST, TT, STE, Mega, and Falcon are registered trademarks
+Atari, 520ST, 1040ST, TT, STE, Mega and Falcon are registered trademarks
or trademarks of Atari Corporation. @*
-DEC, Digital, OpenVMS, ULTRIX, and VMS, are trademarks of Digital Equipment
+DEC, Digital, OpenVMS, ULTRIX and VMS are trademarks of Digital Equipment
Corporation. @*
-@end ifset
+@end ignore
``To boldly go where no man has gone before'' is a
Registered Trademark of Paramount Pictures Corporation. @*
@c sorry, i couldn't resist
@sp 3
-Copyright @copyright{} 1989, 1991, 1992, 1993, 1996-2000 Free Software Foundation, Inc.
+Copyright @copyright{} 1989, 1991, 1992, 1993, 1996-2001 Free Software Foundation, Inc.
@sp 2
-
-This is Edition @value{EDITION} of @cite{@value{TITLE}}, @*
-for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU implementation of AWK.
+
+This is Edition @value{EDITION} of @cite{@value{TITLE}: @value{SUBTITLE}},
+for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU
+implementation of AWK.
@sp 2
Published by:
+@sp 1
Free Software Foundation @*
59 Temple Place --- Suite 330 @*
Boston, MA 02111-1307 USA @*
Phone: +1-617-542-5942 @*
Fax: +1-617-542-2652 @*
-Email: @code{gnu@@gnu.org} @*
-URL: @code{http://www.gnu.org/} @*
+Email: @email{gnu@@gnu.org} @*
+URL: @uref{http://www.gnu.org/} @*
-@sp 1
-@c this ISBN can change!
-@c This one is correct for gawk 3.0 and edition 1.0 from the FSF
-ISBN 1-882114-26-4 @*
-
-Permission is granted to make and distribute verbatim copies of
-this manual provided the copyright notice and this permission notice
-are preserved on all copies.
-
-Permission is granted to copy and distribute modified versions of this
-manual under the conditions for verbatim copying, provided that the entire
-resulting derived work is distributed under the terms of a permission
-notice identical to this one.
-
-Permission is granted to copy and distribute translations of this manual
-into another language, under the above conditions for modified versions,
-except that this permission notice may be stated in a translation approved
-by the Foundation.
+@c This one is correct for gawk 3.1.0 from the FSF
+ISBN 1-882114-28-0 @*
+
+Permission is granted to copy, distribute and/or modify this document
+under the terms of the GNU Free Documentation License, Version 1.1 or
+any later version published by the Free Software Foundation; with the
+Invariant Sections being ``GNU General Public License'', the Front-Cover
+texts being (a) (see below), and with the Back-Cover Texts being (b)
+(see below). A copy of the license is included in the section entitled
+``GNU Free Documentation License''.
+
+@enumerate a
+@item
+``A GNU Manual''
+
+@item
+``You have freedom to copy and modify this GNU Manual, like GNU
+software. Copies published by the Free Software Foundation raise
+funds for GNU development.''
+@end enumerate
@sp 2
Cover art by Etienne Suvasa.
@end titlepage
@@ -192,6 +224,7 @@ Cover art by Etienne Suvasa.
@center @i{To Nachum, for the added dimension.}
@sp 1
@center @i{To Malka, for the new beginning.}
+@w{ }
@page
@w{ }
@page
@@ -202,330 +235,401 @@ Cover art by Etienne Suvasa.
@headings off
@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
-@ifset DRAFT
-@evenfooting @today{} @| @emph{DRAFT!} @| Please Do Not Redistribute
-@oddfooting Please Do Not Redistribute @| @emph{DRAFT!} @| @today{}
-@end ifset
@end iftex
@ifinfo
-@node Top, Preface, (dir), (dir)
+@node Top, Foreword, (dir), (dir)
@top General Introduction
-@c Preface or Licensing nodes should come right after the Top
+@c Preface node should come right after the Top
@c node, in `unnumbered' sections, then the chapter, `What is gawk'.
+@c Licensing nodes are appendices, they're not central to AWK.
-This file documents @code{awk}, a program that you can use to select
+This file documents @command{awk}, a program that you can use to select
particular records in a file and perform operations upon them.
-This is Edition @value{EDITION} of @cite{@value{TITLE}}, @*
-for the @value{VERSION}.@value{PATCHLEVEL} version of the GNU implementation @*
+This is Edition @value{EDITION} of @cite{@value{TITLE}: @value{SUBTITLE}},
+for the @value{VERSION}.@value{PATCHLEVEL} version of the GNU implementation
of AWK.
@end ifinfo
@menu
-* Preface:: What this @value{DOCUMENT} is about; brief
- history and acknowledgements.
-* What Is Awk:: What is the @code{awk} language; using this
- @value{DOCUMENT}.
-* Getting Started:: A basic introduction to using @code{awk}. How
- to run an @code{awk} program. Command line
- syntax.
-* One-liners:: Short, sample @code{awk} programs.
-* Regexp:: All about matching things using regular
- expressions.
-* Reading Files:: How to read files and manipulate fields.
-* Printing:: How to print using @code{awk}. Describes the
- @code{print} and @code{printf} statements.
- Also describes redirection of output.
-* Expressions:: Expressions are the basic building blocks of
- statements.
-* Patterns and Actions:: Overviews of patterns and actions.
-* Statements:: The various control statements are described
- in detail.
-* Built-in Variables:: Built-in Variables
-* Arrays:: The description and use of arrays. Also
- includes array-oriented control statements.
-* Built-in:: The built-in functions are summarized here.
-* User-defined:: User-defined functions are described in
- detail.
-* Invoking Gawk:: How to run @code{gawk}.
-* Library Functions:: A Library of @code{awk} Functions.
-* Sample Programs:: Many @code{awk} programs with complete
- explanations.
-* Language History:: The evolution of the @code{awk} language.
-* Gawk Summary:: @code{gawk} Options and Language Summary.
-* Installation:: Installing @code{gawk} under various operating
- systems.
-* Notes:: Something about the implementation of
- @code{gawk}.
-* Glossary:: An explanation of some unfamiliar terms.
-* Copying:: Your right to copy and distribute @code{gawk}.
-* Index:: Concept and Variable Index.
-
-* History:: The history of @code{gawk} and @code{awk}.
-* Manual History:: Brief history of the GNU project and this
- @value{DOCUMENT}.
-* Acknowledgements:: Acknowledgements.
-* This Manual:: Using this @value{DOCUMENT}. Includes sample
- input files that you can use.
-* Conventions:: Typographical Conventions.
-* Sample Data Files:: Sample data files for use in the @code{awk}
- programs illustrated in this @value{DOCUMENT}.
-* Names:: What name to use to find @code{awk}.
-* Running gawk:: How to run @code{gawk} programs; includes
- command line syntax.
-* One-shot:: Running a short throw-away @code{awk} program.
-* Read Terminal:: Using no input files (input from terminal
- instead).
-* Long:: Putting permanent @code{awk} programs in
- files.
-* Executable Scripts:: Making self-contained @code{awk} programs.
-* Comments:: Adding documentation to @code{gawk} programs.
-* Very Simple:: A very simple example.
-* Two Rules:: A less simple one-line example with two rules.
-* More Complex:: A more complex example.
-* Statements/Lines:: Subdividing or combining statements into
- lines.
-* Other Features:: Other Features of @code{awk}.
-* When:: When to use @code{gawk} and when to use other
- things.
-* Regexp Usage:: How to Use Regular Expressions.
-* Escape Sequences:: How to write non-printing characters.
-* Regexp Operators:: Regular Expression Operators.
-* GNU Regexp Operators:: Operators specific to GNU software.
-* Case-sensitivity:: How to do case-insensitive matching.
-* Leftmost Longest:: How much text matches.
-* Computed Regexps:: Using Dynamic Regexps.
-* Records:: Controlling how data is split into records.
-* Fields:: An introduction to fields.
-* Non-Constant Fields:: Non-constant Field Numbers.
-* Changing Fields:: Changing the Contents of a Field.
-* Field Separators:: The field separator and how to change it.
-* Basic Field Splitting:: How fields are split with single characters or
- simple strings.
-* Regexp Field Splitting:: Using regexps as the field separator.
-* Single Character Fields:: Making each character a separate field.
-* Command Line Field Separator:: Setting @code{FS} from the command line.
-* Field Splitting Summary:: Some final points and a summary table.
-* Constant Size:: Reading constant width data.
-* Multiple Line:: Reading multi-line records.
-* Getline:: Reading files under explicit program control
- using the @code{getline} function.
-* Getline Intro:: Introduction to the @code{getline} function.
-* Plain Getline:: Using @code{getline} with no arguments.
-* Getline/Variable:: Using @code{getline} into a variable.
-* Getline/File:: Using @code{getline} from a file.
-* Getline/Variable/File:: Using @code{getline} into a variable from a
- file.
-* Getline/Pipe:: Using @code{getline} from a pipe.
-* Getline/Variable/Pipe:: Using @code{getline} into a variable from a
- pipe.
-* Getline Summary:: Summary Of @code{getline} Variants.
-* Print:: The @code{print} statement.
-* Print Examples:: Simple examples of @code{print} statements.
-* Output Separators:: The output separators and how to change them.
-* OFMT:: Controlling Numeric Output With @code{print}.
-* Printf:: The @code{printf} statement.
-* Basic Printf:: Syntax of the @code{printf} statement.
-* Control Letters:: Format-control letters.
-* Format Modifiers:: Format-specification modifiers.
-* Printf Examples:: Several examples.
-* Redirection:: How to redirect output to multiple files and
- pipes.
-* Special Files:: File name interpretation in @code{gawk}.
- @code{gawk} allows access to inherited file
- descriptors.
-* Close Files And Pipes:: Closing Input and Output Files and Pipes.
-* Constants:: String, numeric, and regexp constants.
-* Scalar Constants:: Numeric and string constants.
-* Regexp Constants:: Regular Expression constants.
-* Using Constant Regexps:: When and how to use a regexp constant.
-* Variables:: Variables give names to values for later use.
-* Using Variables:: Using variables in your programs.
-* Assignment Options:: Setting variables on the command line and a
- summary of command line syntax. This is an
- advanced method of input.
-* Conversion:: The conversion of strings to numbers and vice
- versa.
-* Arithmetic Ops:: Arithmetic operations (@samp{+}, @samp{-},
- etc.)
-* Concatenation:: Concatenating strings.
-* Assignment Ops:: Changing the value of a variable or a field.
-* Increment Ops:: Incrementing the numeric value of a variable.
-* Truth Values:: What is ``true'' and what is ``false''.
-* Typing and Comparison:: How variables acquire types, and how this
- affects comparison of numbers and strings with
- @samp{<}, etc.
-* Boolean Ops:: Combining comparison expressions using boolean
- operators @samp{||} (``or''), @samp{&&}
- (``and'') and @samp{!} (``not'').
-* Conditional Exp:: Conditional expressions select between two
- subexpressions under control of a third
- subexpression.
-* Function Calls:: A function call is an expression.
-* Precedence:: How various operators nest.
-* Pattern Overview:: What goes into a pattern.
-* Kinds of Patterns:: A list of all kinds of patterns.
-* Regexp Patterns:: Using regexps as patterns.
-* Expression Patterns:: Any expression can be used as a pattern.
-* Ranges:: Pairs of patterns specify record ranges.
-* BEGIN/END:: Specifying initialization and cleanup rules.
-* Using BEGIN/END:: How and why to use BEGIN/END rules.
-* I/O And BEGIN/END:: I/O issues in BEGIN/END rules.
-* Empty:: The empty pattern, which matches every record.
-* Action Overview:: What goes into an action.
-* If Statement:: Conditionally execute some @code{awk}
- statements.
-* While Statement:: Loop until some condition is satisfied.
-* Do Statement:: Do specified action while looping until some
- condition is satisfied.
-* For Statement:: Another looping statement, that provides
- initialization and increment clauses.
-* Break Statement:: Immediately exit the innermost enclosing loop.
-* Continue Statement:: Skip to the end of the innermost enclosing
- loop.
-* Next Statement:: Stop processing the current input record.
-* Nextfile Statement:: Stop processing the current file.
-* Exit Statement:: Stop execution of @code{awk}.
-* User-modified:: Built-in variables that you change to control
- @code{awk}.
-* Auto-set:: Built-in variables where @code{awk} gives you
- information.
-* ARGC and ARGV:: Ways to use @code{ARGC} and @code{ARGV}.
-* Array Intro:: Introduction to Arrays
-* Reference to Elements:: How to examine one element of an array.
-* Assigning Elements:: How to change an element of an array.
-* Array Example:: Basic Example of an Array
-* Scanning an Array:: A variation of the @code{for} statement. It
- loops through the indices of an array's
- existing elements.
-* Delete:: The @code{delete} statement removes an element
- from an array.
-* Numeric Array Subscripts:: How to use numbers as subscripts in
- @code{awk}.
-* Uninitialized Subscripts:: Using Uninitialized variables as subscripts.
-* Multi-dimensional:: Emulating multi-dimensional arrays in
- @code{awk}.
-* Multi-scanning:: Scanning multi-dimensional arrays.
-* Calling Built-in:: How to call built-in functions.
-* Numeric Functions:: Functions that work with numbers, including
- @code{int}, @code{sin} and @code{rand}.
-* String Functions:: Functions for string manipulation, such as
- @code{split}, @code{match}, and
- @code{sprintf}.
-* I/O Functions:: Functions for files and shell commands.
-* Time Functions:: Functions for dealing with time stamps.
-* Definition Syntax:: How to write definitions and what they mean.
-* Function Example:: An example function definition and what it
- does.
-* Function Caveats:: Things to watch out for.
-* Return Statement:: Specifying the value a function returns.
-* Options:: Command line options and their meanings.
-* Other Arguments:: Input file names and variable assignments.
-* AWKPATH Variable:: Searching directories for @code{awk} programs.
-* Obsolete:: Obsolete Options and/or features.
-* Undocumented:: Undocumented Options and Features.
-* Known Bugs:: Known Bugs in @code{gawk}.
-* Portability Notes:: What to do if you don't have @code{gawk}.
-* Nextfile Function:: Two implementations of a @code{nextfile}
- function.
-* Assert Function:: A function for assertions in @code{awk}
- programs.
-* Round Function:: A function for rounding if @code{sprintf} does
- not do it correctly.
-* Ordinal Functions:: Functions for using characters as numbers and
- vice versa.
-* Join Function:: A function to join an array into a string.
-* Mktime Function:: A function to turn a date into a timestamp.
-* Gettimeofday Function:: A function to get formatted times.
-* Filetrans Function:: A function for handling data file transitions.
-* Getopt Function:: A function for processing command line
- arguments.
-* Passwd Functions:: Functions for getting user information.
-* Group Functions:: Functions for getting group information.
-* Library Names:: How to best name private global variables in
- library functions.
-* Clones:: Clones of common utilities.
-* Cut Program:: The @code{cut} utility.
-* Egrep Program:: The @code{egrep} utility.
-* Id Program:: The @code{id} utility.
-* Split Program:: The @code{split} utility.
-* Tee Program:: The @code{tee} utility.
-* Uniq Program:: The @code{uniq} utility.
-* Wc Program:: The @code{wc} utility.
-* Miscellaneous Programs:: Some interesting @code{awk} programs.
-* Dupword Program:: Finding duplicated words in a document.
-* Alarm Program:: An alarm clock.
-* Translate Program:: A program similar to the @code{tr} utility.
-* Labels Program:: Printing mailing labels.
-* Word Sorting:: A program to produce a word usage count.
-* History Sorting:: Eliminating duplicate entries from a history
- file.
-* Extract Program:: Pulling out programs from Texinfo source
- files.
-* Simple Sed:: A Simple Stream Editor.
-* Igawk Program:: A wrapper for @code{awk} that includes files.
-* V7/SVR3.1:: The major changes between V7 and System V
- Release 3.1.
-* SVR4:: Minor changes between System V Releases 3.1
- and 4.
-* POSIX:: New features from the POSIX standard.
-* BTL:: New features from the Bell Laboratories
- version of @code{awk}.
-* POSIX/GNU:: The extensions in @code{gawk} not in POSIX
- @code{awk}.
-* Command Line Summary:: Recapitulation of the command line.
-* Language Summary:: A terse review of the language.
-* Variables/Fields:: Variables, fields, and arrays.
-* Fields Summary:: Input field splitting.
-* Built-in Summary:: @code{awk}'s built-in variables.
-* Arrays Summary:: Using arrays.
-* Data Type Summary:: Values in @code{awk} are numbers or strings.
-* Rules Summary:: Patterns and Actions, and their component
- parts.
-* Pattern Summary:: Quick overview of patterns.
-* Regexp Summary:: Quick overview of regular expressions.
-* Actions Summary:: Quick overview of actions.
-* Operator Summary:: @code{awk} operators.
-* Control Flow Summary:: The control statements.
-* I/O Summary:: The I/O statements.
-* Printf Summary:: A summary of @code{printf}.
-* Special File Summary:: Special file names interpreted internally.
-* Built-in Functions Summary:: Built-in numeric and string functions.
-* Time Functions Summary:: Built-in time functions.
-* String Constants Summary:: Escape sequences in strings.
-* Functions Summary:: Defining and calling functions.
-* Historical Features:: Some undocumented but supported ``features''.
-* Gawk Distribution:: What is in the @code{gawk} distribution.
-* Getting:: How to get the distribution.
-* Extracting:: How to extract the distribution.
-* Distribution contents:: What is in the distribution.
-* Unix Installation:: Installing @code{gawk} under various versions
- of Unix.
-* Quick Installation:: Compiling @code{gawk} under Unix.
-* Configuration Philosophy:: How it's all supposed to work.
-* VMS Installation:: Installing @code{gawk} on VMS.
-* VMS Compilation:: How to compile @code{gawk} under VMS.
-* VMS Installation Details:: How to install @code{gawk} under VMS.
-* VMS Running:: How to run @code{gawk} under VMS.
-* VMS POSIX:: Alternate instructions for VMS POSIX.
-* PC Installation:: Installing and Compiling @code{gawk} on MS-DOS
- and OS/2
-* Atari Installation:: Installing @code{gawk} on the Atari ST.
-* Atari Compiling:: Compiling @code{gawk} on Atari
-* Atari Using:: Running @code{gawk} on Atari
-* Amiga Installation:: Installing @code{gawk} on an Amiga.
-* Bugs:: Reporting Problems and Bugs.
-* Other Versions:: Other freely available @code{awk}
- implementations.
-* Compatibility Mode:: How to disable certain @code{gawk} extensions.
-* Additions:: Making Additions To @code{gawk}.
-* Adding Code:: Adding code to the main body of @code{gawk}.
-* New Ports:: Porting @code{gawk} to a new operating system.
-* Future Extensions:: New features that may be implemented one day.
-* Improvements:: Suggestions for improvements by volunteers.
-
+* Foreword:: Some nice words about this
+ @value{DOCUMENT}.
+* Preface:: What this @value{DOCUMENT} is about; brief
+ history and acknowledgments.
+* Getting Started:: A basic introduction to using
+ @command{awk}. How to run an @command{awk}
+ program. Command-line syntax.
+* Regexp:: All about matching things using regular
+ expressions.
+* Reading Files:: How to read files and manipulate fields.
+* Printing:: How to print using @command{awk}. Describes
+ the @code{print} and @code{printf}
+ statements. Also describes redirection of
+ output.
+* Expressions:: Expressions are the basic building blocks
+ of statements.
+* Patterns and Actions:: Overviews of patterns and actions.
+* Arrays:: The description and use of arrays. Also
+ includes array-oriented control statements.
+* Functions:: Built-in and user-defined functions.
+* Internationalization:: Getting @command{gawk} to speak your
+ language.
+* Advanced Features:: Stuff for advanced users, specific to
+ @command{gawk}.
+* Invoking Gawk:: How to run @command{gawk}.
+* Library Functions:: A Library of @command{awk} Functions.
+* Sample Programs:: Many @command{awk} programs with complete
+ explanations.
+* Language History:: The evolution of the @command{awk}
+ language.
+* Installation:: Installing @command{gawk} under various
+ operating systems.
+* Notes:: Notes about @command{gawk} extensions and
+ possible future work.
+* Basic Concepts:: A very quick intoduction to programming
+ concepts.
+* Glossary:: An explanation of some unfamiliar terms.
+* Copying:: Your right to copy and distribute
+ @command{gawk}.
+* GNU Free Documentation License:: The license for this @value{DOCUMENT}.
+* Index:: Concept and Variable Index.
+
+@detailmenu
+* History:: The history of @command{gawk} and
+ @command{awk}.
+* Names:: What name to use to find @command{awk}.
+* This Manual:: Using this @value{DOCUMENT}. Includes
+ sample input files that you can use.
+* Conventions:: Typographical Conventions.
+* Manual History:: Brief history of the GNU project and this
+ @value{DOCUMENT}.
+* How To Contribute:: Helping to save the world.
+* Acknowledgments:: Acknowledgments.
+* Running gawk:: How to run @command{gawk} programs;
+ includes command-line syntax.
+* One-shot:: Running a short throw-away @command{awk}
+ program.
+* Read Terminal:: Using no input files (input from terminal
+ instead).
+* Long:: Putting permanent @command{awk} programs in
+ files.
+* Executable Scripts:: Making self-contained @command{awk}
+ programs.
+* Comments:: Adding documentation to @command{gawk}
+ programs.
+* Quoting:: More discussion of shell quoting issues.
+* Sample Data Files:: Sample data files for use in the
+ @command{awk} programs illustrated in this
+ @value{DOCUMENT}.
+* Very Simple:: A very simple example.
+* Two Rules:: A less simple one-line example using two
+ rules.
+* More Complex:: A more complex example.
+* Statements/Lines:: Subdividing or combining statements into
+ lines.
+* Other Features:: Other Features of @command{awk}.
+* When:: When to use @command{gawk} and when to use
+ other things.
+* Regexp Usage:: How to Use Regular Expressions.
+* Escape Sequences:: How to write non-printing characters.
+* Regexp Operators:: Regular Expression Operators.
+* Character Lists:: What can go between @samp{[...]}.
+* GNU Regexp Operators:: Operators specific to GNU software.
+* Case-sensitivity:: How to do case-insensitive matching.
+* Leftmost Longest:: How much text matches.
+* Computed Regexps:: Using Dynamic Regexps.
+* Records:: Controlling how data is split into records.
+* Fields:: An introduction to fields.
+* Non-Constant Fields:: Non-constant Field Numbers.
+* Changing Fields:: Changing the Contents of a Field.
+* Field Separators:: The field separator and how to change it.
+* Regexp Field Splitting:: Using regexps as the field separator.
+* Single Character Fields:: Making each character a separate field.
+* Command Line Field Separator:: Setting @code{FS} from the command-line.
+* Field Splitting Summary:: Some final points and a summary table.
+* Constant Size:: Reading constant width data.
+* Multiple Line:: Reading multi-line records.
+* Getline:: Reading files under explicit program
+ control using the @code{getline} function.
+* Plain Getline:: Using @code{getline} with no arguments.
+* Getline/Variable:: Using @code{getline} into a variable.
+* Getline/File:: Using @code{getline} from a file.
+* Getline/Variable/File:: Using @code{getline} into a variable from a
+ file.
+* Getline/Pipe:: Using @code{getline} from a pipe.
+* Getline/Variable/Pipe:: Using @code{getline} into a variable from a
+ pipe.
+* Getline/Coprocess:: Using @code{getline} from a coprocess.
+* Getline/Variable/Coprocess:: Using @code{getline} into a variable from a
+ coprocess.
+* Getline Notes:: Important things to know about
+ @code{getline}.
+* Getline Summary:: Summary of @code{getline} Variants.
+* Print:: The @code{print} statement.
+* Print Examples:: Simple examples of @code{print} statements.
+* Output Separators:: The output separators and how to change
+ them.
+* OFMT:: Controlling Numeric Output With
+ @code{print}.
+* Printf:: The @code{printf} statement.
+* Basic Printf:: Syntax of the @code{printf} statement.
+* Control Letters:: Format-control letters.
+* Format Modifiers:: Format-specification modifiers.
+* Printf Examples:: Several examples.
+* Redirection:: How to redirect output to multiple files
+ and pipes.
+* Special Files:: File name interpretation in @command{gawk}.
+ @command{gawk} allows access to inherited
+ file descriptors.
+* Special FD:: Special files for I/O.
+* Special Process:: Special files for process information.
+* Special Network:: Special files for network communications.
+* Special Caveats:: Things to watch out for.
+* Close Files And Pipes:: Closing Input and Output Files and Pipes.
+* Constants:: String, numeric and regexp constants.
+* Scalar Constants:: Numeric and string constants.
+* Non-decimal-numbers:: What are octal and hex numbers.
+* Regexp Constants:: Regular Expression constants.
+* Using Constant Regexps:: When and how to use a regexp constant.
+* Variables:: Variables give names to values for later
+ use.
+* Using Variables:: Using variables in your programs.
+* Assignment Options:: Setting variables on the command-line and a
+ summary of command-line syntax. This is an
+ advanced method of input.
+* Conversion:: The conversion of strings to numbers and
+ vice versa.
+* Arithmetic Ops:: Arithmetic operations (@samp{+}, @samp{-},
+ etc.)
+* Concatenation:: Concatenating strings.
+* Assignment Ops:: Changing the value of a variable or a
+ field.
+* Increment Ops:: Incrementing the numeric value of a
+ variable.
+* Truth Values:: What is ``true'' and what is ``false''.
+* Typing and Comparison:: How variables acquire types and how this
+ affects comparison of numbers and strings
+ with @samp{<}, etc.
+* Boolean Ops:: Combining comparison expressions using
+ boolean operators @samp{||} (``or''),
+ @samp{&&} (``and'') and @samp{!} (``not'').
+* Conditional Exp:: Conditional expressions select between two
+ subexpressions under control of a third
+ subexpression.
+* Function Calls:: A function call is an expression.
+* Precedence:: How various operators nest.
+* Pattern Overview:: What goes into a pattern.
+* Regexp Patterns:: Using regexps as patterns.
+* Expression Patterns:: Any expression can be used as a pattern.
+* Ranges:: Pairs of patterns specify record ranges.
+* BEGIN/END:: Specifying initialization and cleanup
+ rules.
+* Using BEGIN/END:: How and why to use BEGIN/END rules.
+* I/O And BEGIN/END:: I/O issues in BEGIN/END rules.
+* Empty:: The empty pattern, which matches every
+ record.
+* Using Shell Variables:: How to use shell variables with
+ @command{awk}.
+* Action Overview:: What goes into an action.
+* Statements:: Describes the various control statements in
+ detail.
+* If Statement:: Conditionally execute some @command{awk}
+ statements.
+* While Statement:: Loop until some condition is satisfied.
+* Do Statement:: Do specified action while looping until
+ some condition is satisfied.
+* For Statement:: Another looping statement, that provides
+ initialization and increment clauses.
+* Break Statement:: Immediately exit the innermost enclosing
+ loop.
+* Continue Statement:: Skip to the end of the innermost enclosing
+ loop.
+* Next Statement:: Stop processing the current input record.
+* Nextfile Statement:: Stop processing the current file.
+* Exit Statement:: Stop execution of @command{awk}.
+* Built-in Variables:: Summarizes the built-in variables.
+* User-modified:: Built-in variables that you change to
+ control @command{awk}.
+* Auto-set:: Built-in variables where @command{awk}
+ gives you information.
+* ARGC and ARGV:: Ways to use @code{ARGC} and @code{ARGV}.
+* Array Intro:: Introduction to Arrays
+* Reference to Elements:: How to examine one element of an array.
+* Assigning Elements:: How to change an element of an array.
+* Array Example:: Basic Example of an Array
+* Scanning an Array:: A variation of the @code{for} statement. It
+ loops through the indices of an array's
+ existing elements.
+* Delete:: The @code{delete} statement removes an
+ element from an array.
+* Numeric Array Subscripts:: How to use numbers as subscripts in
+ @command{awk}.
+* Uninitialized Subscripts:: Using Uninitialized variables as
+ subscripts.
+* Multi-dimensional:: Emulating multidimensional arrays in
+ @command{awk}.
+* Multi-scanning:: Scanning multidimensional arrays.
+* Array Sorting:: Sorting array values and indices.
+* Built-in:: Summarizes the built-in functions.
+* Calling Built-in:: How to call built-in functions.
+* Numeric Functions:: Functions that work with numbers, including
+ @code{int}, @code{sin} and @code{rand}.
+* String Functions:: Functions for string manipulation, such as
+ @code{split}, @code{match} and
+ @code{sprintf}.
+* Gory Details:: More than you want to know about @samp{\}
+ and @samp{&} with @code{sub}, @code{gsub},
+ and @code{gensub}.
+* I/O Functions:: Functions for files and shell commands.
+* Time Functions:: Functions for dealing with timestamps.
+* Bitwise Functions:: Functions for bitwise operations.
+* I18N Functions:: Functions for string translation.
+* User-defined:: Describes User-defined functions in detail.
+* Definition Syntax:: How to write definitions and what they
+ mean.
+* Function Example:: An example function definition and what it
+ does.
+* Function Caveats:: Things to watch out for.
+* Return Statement:: Specifying the value a function returns.
+* Dynamic Typing:: How variable types can change at runtime.
+* I18N and L10N:: Internationalization and Localization.
+* Explaining gettext:: How GNU @code{gettext} works.
+* Programmer i18n:: Features for the programmer.
+* Translator i18n:: Features for the translator.
+* String Extraction:: Extracting marked strings.
+* Printf Ordering:: Rearranging @code{printf} arguments.
+* I18N Portability:: @command{awk}-level portability issues.
+* I18N Example:: A simple i18n example.
+* Gawk I18N:: @command{gawk} is also internationalized.
+* Non-decimal Data:: Allowing non-decimal input data.
+* Two-way I/O:: Two-way communications with another
+ process.
+* TCP/IP Networking:: Using @command{gawk} for network
+ programming.
+* Portal Files:: Using @command{gawk} with BSD portals.
+* Profiling:: Profiling your @command{awk} programs.
+* Command Line:: How to run @command{awk}.
+* Options:: Command-line options and their meanings.
+* Other Arguments:: Input file names and variable assignments.
+* AWKPATH Variable:: Searching directories for @command{awk}
+ programs.
+* Obsolete:: Obsolete Options and/or features.
+* Undocumented:: Undocumented Options and Features.
+* Known Bugs:: Known Bugs in @command{gawk}.
+* Library Names:: How to best name private global variables
+ in library functions.
+* General Functions:: Functions that are of general use.
+* Nextfile Function:: Two implementations of a @code{nextfile}
+ function.
+* Assert Function:: A function for assertions in @command{awk}
+ programs.
+* Round Function:: A function for rounding if @code{sprintf}
+ does not do it correctly.
+* Cliff Random Function:: The Cliff Random Number Generator.
+* Ordinal Functions:: Functions for using characters as numbers
+ and vice versa.
+* Join Function:: A function to join an array into a string.
+* Gettimeofday Function:: A function to get formatted times.
+* Data File Management:: Functions for managing command-line data
+ files.
+* Filetrans Function:: A function for handling data file
+ transitions.
+* Rewind Function:: A function for rereading the current file.
+* File Checking:: Checking that data files are readable.
+* Ignoring Assigns:: Treating assignments as file names.
+* Getopt Function:: A function for processing command-line
+ arguments.
+* Passwd Functions:: Functions for getting user information.
+* Group Functions:: Functions for getting group information.
+* Running Examples:: How to run these examples.
+* Clones:: Clones of common utilities.
+* Cut Program:: The @command{cut} utility.
+* Egrep Program:: The @command{egrep} utility.
+* Id Program:: The @command{id} utility.
+* Split Program:: The @command{split} utility.
+* Tee Program:: The @command{tee} utility.
+* Uniq Program:: The @command{uniq} utility.
+* Wc Program:: The @command{wc} utility.
+* Miscellaneous Programs:: Some interesting @command{awk} programs.
+* Dupword Program:: Finding duplicated words in a document.
+* Alarm Program:: An alarm clock.
+* Translate Program:: A program similar to the @command{tr}
+ utility.
+* Labels Program:: Printing mailing labels.
+* Word Sorting:: A program to produce a word usage count.
+* History Sorting:: Eliminating duplicate entries from a
+ history file.
+* Extract Program:: Pulling out programs from Texinfo source
+ files.
+* Simple Sed:: A Simple Stream Editor.
+* Igawk Program:: A wrapper for @command{awk} that includes
+ files.
+* V7/SVR3.1:: The major changes between V7 and System V
+ Release 3.1.
+* SVR4:: Minor changes between System V Releases 3.1
+ and 4.
+* POSIX:: New features from the POSIX standard.
+* BTL:: New features from the Bell Laboratories
+ version of @command{awk}.
+* POSIX/GNU:: The extensions in @command{gawk} not in
+ POSIX @command{awk}.
+* Contributors:: The major contributors to @command{gawk}.
+* Gawk Distribution:: What is in the @command{gawk} distribution.
+* Getting:: How to get the distribution.
+* Extracting:: How to extract the distribution.
+* Distribution contents:: What is in the distribution.
+* Unix Installation:: Installing @command{gawk} under various
+ versions of Unix.
+* Quick Installation:: Compiling @command{gawk} under Unix.
+* Additional Configuration Options:: Other compile-time options.
+* Configuration Philosophy:: How it's all supposed to work.
+* Non-Unix Installation:: Installation on Other Operating Systems.
+* Amiga Installation:: Installing @command{gawk} on an Amiga.
+* BeOS Installation:: Installing @command{gawk} on BeOS.
+* PC Installation:: Installing and Compiling @command{gawk} on
+ MS-DOS and OS/2.
+* PC Binary Installation:: Installing a prepared distribution.
+* PC Compiling:: Compiling @command{gawk} for MS-DOS, Win32,
+ and OS/2.
+* PC Using:: Running @command{gawk} on MS-DOS, Win32 and
+ OS/2.
+* VMS Installation:: Installing @command{gawk} on VMS.
+* VMS Compilation:: How to compile @command{gawk} under VMS.
+* VMS Installation Details:: How to install @command{gawk} under VMS.
+* VMS Running:: How to run @command{gawk} under VMS.
+* VMS POSIX:: Alternate instructions for VMS POSIX.
+* Unsupported:: Systems whose ports are no longer
+ supported.
+* Atari Installation:: Installing @command{gawk} on the Atari ST.
+* Atari Compiling:: Compiling @command{gawk} on Atari.
+* Atari Using:: Running @command{gawk} on Atari.
+* Tandem Installation:: Installing @command{gawk} on a Tandem.
+* Bugs:: Reporting Problems and Bugs.
+* Other Versions:: Other freely available @command{awk}
+ implementations.
+* Compatibility Mode:: How to disable certain @command{gawk}
+ extensions.
+* Additions:: Making Additions To @command{gawk}.
+* Adding Code:: Adding code to the main body of
+ @command{gawk}.
+* New Ports:: Porting @command{gawk} to a new operating
+ system.
+* Dynamic Extensions:: Adding new built-in functions to
+ @command{gawk}.
+* Internals:: A brief look at some @command{gawk}
+ internals.
+* Sample Library:: A example of new functions.
+* Internal File Description:: What the new functions will do.
+* Internal File Ops:: The code for internal file operations.
+* Using Internal File Ops:: How to use an external extension.
+* Future Extensions:: New features that may be implemented one
+ day.
+* Basic High Level:: The high level view.
+* Basic Data Typing:: A very quick intro to data types.
+* Floating Point Issues:: Stuff to know about floating-point numbers.
+@end detailmenu
@end menu
@c dedication for Info file
@@ -541,69 +645,560 @@ of AWK.
@center To Malka, for the new beginning.
@end ifinfo
-@node Preface, What Is Awk, Top, Top
-@unnumbered Preface
+@summarycontents
+@contents
+
+@node Foreword, Preface, Top, Top
+@unnumbered Foreword
+
+Arnold Robbins and I are good friends. We were introduced 11 years ago
+by circumstances---and our favorite programming language, AWK.
+The circumstances started a couple of years
+earlier. I was working at a new job and noticed an unplugged
+Unix computer sitting in the corner. No one knew how to use it,
+and neither did I. However,
+a couple of days later it was running, and
+I was @code{root} and the one-and-only user.
+That day, I began the transition from statistician to Unix programmer.
+
+On one of many trips to the library or bookstore in search of
+books on Unix, I found the gray AWK book, a.k.a. Aho, Kernighan and
+Weinberger, @cite{The AWK Programming Language}, Addison-Wesley,
+1988. AWK's simple programming paradigm---find a pattern in the
+input and then perform an action---often reduced complex or tedious
+data manipulations to few lines of code. I was excited to try my
+hand at programming in AWK.
+
+Alas, the @command{awk} on my computer was a limited version of the
+language described in the AWK book. I discovered that my computer
+had ``old @command{awk}'' and the AWK book described ``new @command{awk}.''
+I learned that this was typical; the old version refused to step
+aside or relinquish its name. If a system had a new @command{awk}, it was
+invariably called @command{nawk}, and few systems had it.
+The best way to get a new @command{awk} was to @command{ftp} the source code for
+@command{gawk} from @code{prep.ai.mit.edu}. @command{gawk} was a version of
+new @command{awk} written by David Trueman and Arnold, and available under
+the GNU General Public License.
+
+(Incidentally,
+it's no longer difficult to find a new @command{awk}. @command{gawk} ships with
+Linux, and you can download binaries or source code for almost
+any system; my wife uses @command{gawk} on her VMS box.)
+
+My Unix system started out unplugged from the wall; it certainly was not
+plugged into a network. So, oblivious to the existence of @command{gawk}
+and the Unix community in general, and desiring a new @command{awk}, I wrote
+my own, called @command{mawk}.
+Before I was finished I knew about @command{gawk},
+but it was too late to stop, so I eventually posted
+to a @code{comp.sources} newsgroup.
+
+A few days after my posting, I got a friendly email
+from Arnold introducing
+himself. He suggested we share design and algorithms and
+attached a draft of the POSIX standard so
+that I could update @command{mawk} to support language extensions added
+after publication of the AWK book.
+
+Frankly, if our roles had
+been reversed, I would not have been so open and we probably would
+have never met. I'm glad we did meet.
+He is an AWK expert's AWK expert and a genuinely nice person.
+Arnold contributes significant amounts of his
+expertise and time to the Free Software Foundation.
+
+This book is the @command{gawk} reference manual, but at its core it
+is a book about AWK programming that
+will appeal to a wide audience.
+It is a definitive reference to the AWK language as defined by the
+1987 Bell Labs release and codified in the 1992 POSIX Utilities
+standard.
+
+On the other hand, the novice AWK programmer can study
+a wealth of practical programs that emphasize
+the power of AWK's basic idioms:
+data driven control-flow, pattern matching with regular expressions,
+and associative arrays.
+Those looking for something new can try out @command{gawk}'s
+interface to network protocols via special @file{/inet} files.
+
+The programs in this book make clear that an AWK program is
+typically much smaller and faster to develop than
+a counterpart written in C.
+Consequently, there is often a payoff to prototype an
+algorithm or design in AWK to get it running quickly and expose
+problems early. Often, the interpreted performance is adequate
+and the AWK prototype becomes the product.
+
+The new @command{pgawk} (profiling @command{gawk}), produces
+program execution counts.
+I recently experimented with an algorithm that for
+@math{n} lines of input, exhibited
+@tex
+$\sim\! Cn^2$
+@end tex
+@ifnottex
+~ C n^2
+@end ifnottex
+performance, while
+theory predicted
+@tex
+$\sim\! Cn\log n$
+@end tex
+@ifnottex
+~ C n log n
+@end ifnottex
+behavior. A few minutes poring
+over the @file{awkprof.out} profile pinpointed the problem to
+a single line of code. @command{pgawk} is a welcome addition to
+my programmer's toolbox.
+
+Arnold has distilled over a decade of experience writing and
+using AWK programs, and developing @command{gawk}, into this book. If you use
+AWK or want to learn how, then read this book.
+@display
+Michael Brennan
+Author of @command{mawk}
+@end display
+
+@node Preface, Getting Started, Foreword, Top
+@unnumbered Preface
@c I saw a comment somewhere that the preface should describe the book itself,
@c and the introduction should describe what the book covers.
+@c
+@c 12/2000: Chuck wants the preface & intro combined.
+
+Several kinds of tasks occur repeatedly
+when working with text files.
+You might want to extract certain lines and discard the rest.
+Or you may need to make changes wherever certain patterns appear,
+but leave the rest of the file alone.
+Writing single-use programs for these tasks in languages such as C, C++ or Pascal
+is time-consuming and inconvenient.
+Such jobs are often easier with @command{awk}.
+The @command{awk} utility interprets a special-purpose programming language
+that makes it easy to handle simple data-reformatting jobs.
+
+The GNU implementation of @command{awk} is called @command{gawk}; it is fully
+compatible with the System V Release 4 version of
+@command{awk}. @command{gawk} is also compatible with the POSIX
+specification of the @command{awk} language. This means that all
+properly written @command{awk} programs should work with @command{gawk}.
+Thus, we usually don't distinguish between @command{gawk} and other
+@command{awk} implementations.
+
+@cindex uses of @command{awk}
+@cindex applications of @command{awk}
+Using @command{awk} allows you to:
+
+@itemize @bullet
+@item
+Manage small, personal databases
+
+@item
+Generate reports
-This @value{DOCUMENT} teaches you about the @code{awk} language and
+@item
+Validate data
+
+@item
+Produce indexes and perform other document preparation tasks
+
+@item
+Experiment with algorithms that you can adapt later to other computer
+languages.
+@end itemize
+
+@cindex uses of @command{gawk}
+In addition,
+@command{gawk}
+provides facilities that make it easy to:
+
+@itemize @bullet
+@item
+Extract bits and pieces of data for processing
+
+@item
+Sort data
+
+@item
+Perform simple network communications.
+@end itemize
+
+This @value{DOCUMENT} teaches you about the @command{awk} language and
how you can use it effectively. You should already be familiar with basic
-system commands, such as @code{cat} and @code{ls},@footnote{These commands
-are available on POSIX compliant systems, as well as on traditional Unix
+system commands, such as @command{cat} and @command{ls},@footnote{These commands
+are available on POSIX-compliant systems, as well as on traditional Unix
based systems. If you are using some other operating system, you still need to
-be familiar with the ideas of I/O redirection and pipes.} and basic shell
+be familiar with the ideas of I/O redirection and pipes.} as well as basic shell
facilities, such as Input/Output (I/O) redirection and pipes.
-Implementations of the @code{awk} language are available for many different
-computing environments. This @value{DOCUMENT}, while describing the @code{awk} language
-in general, also describes a particular implementation of @code{awk} called
-@code{gawk} (which stands for ``GNU Awk''). @code{gawk} runs on a broad range
-of Unix systems, ranging from 80386 PC-based computers, up through large scale
-systems, such as Crays. @code{gawk} has also been ported to MS-DOS and
-OS/2 PC's, Atari and Amiga micro-computers, and VMS.
+Implementations of the @command{awk} language are available for many
+different computing environments. This @value{DOCUMENT}, while describing
+the @command{awk} language in general, also describes the particular
+implementation of @command{awk} called @command{gawk} (which stands for
+``GNU awk''). @command{gawk} runs on a broad range of Unix systems,
+ranging from 80386 PC-based computers, up through large-scale systems,
+such as Crays. @command{gawk} has also been ported to Mac OS X,
+MS-DOS, Microsoft Windows (all versions) and OS/2 PC's, Atari and Amiga
+micro-computers, BeOS, Tandem D20, and VMS.
@menu
-* History:: The history of @code{gawk} and @code{awk}.
+* History:: The history of @command{gawk} and
+ @command{awk}.
+* Names:: What name to use to find @command{awk}.
+* This Manual:: Using this @value{DOCUMENT}. Includes sample
+ input files that you can use.
+* Conventions:: Typographical Conventions.
* Manual History:: Brief history of the GNU project and this
@value{DOCUMENT}.
-* Acknowledgements:: Acknowledgements.
+* How To Contribute:: Helping to save the world.
+* Acknowledgments:: Acknowledgments.
@end menu
-@node History, Manual History, Preface, Preface
-@unnumberedsec History of @code{awk} and @code{gawk}
+@node History, Names, Preface, Preface
+@unnumberedsec History of @command{awk} and @command{gawk}
+@cindex recipe for a programming language
+@cindex programming language, recipe for
+@center Recipe For A Programming Language
+
+@multitable {2 parts} {1 part @code{egrep}} {1 part @code{snobol}}
+@item @tab 1 part @code{egrep} @tab 1 part @code{snobol}
+@item @tab 2 parts @code{ed} @tab 3 parts C
+@end multitable
+
+@quotation
+Blend all parts well using @code{lex} and @code{yacc}.
+Document minimally and release.
+
+After eight years, add another part @code{egrep} and two
+more parts C. Document very well and release.
+@end quotation
@cindex acronym
-@cindex history of @code{awk}
+@cindex history of @command{awk}
@cindex Aho, Alfred
@cindex Weinberger, Peter
@cindex Kernighan, Brian
-@cindex old @code{awk}
-@cindex new @code{awk}
-The name @code{awk} comes from the initials of its designers: Alfred V.@:
-Aho, Peter J.@: Weinberger, and Brian W.@: Kernighan. The original version of
-@code{awk} was written in 1977 at AT&T Bell Laboratories.
-In 1985 a new version made the programming
+@cindex old @command{awk}
+@cindex new @command{awk}
+The name @command{awk} comes from the initials of its designers: Alfred V.@:
+Aho, Peter J.@: Weinberger and Brian W.@: Kernighan. The original version of
+@command{awk} was written in 1977 at AT&T Bell Laboratories.
+In 1985, a new version made the programming
language more powerful, introducing user-defined functions, multiple input
streams, and computed regular expressions.
-This new version became generally available with Unix System V Release 3.1.
-The version in System V Release 4 added some new features and also cleaned
+This new version became widely available with Unix System V
+Release 3.1 (SVR3.1).
+The version in SVR4 added some new features and cleaned
up the behavior in some of the ``dark corners'' of the language.
-The specification for @code{awk} in the POSIX Command Language
-and Utilities standard further clarified the language based on feedback
-from both the @code{gawk} designers, and the original Bell Labs @code{awk}
-designers.
+The specification for @command{awk} in the POSIX Command Language
+and Utilities standard further clarified the language.
+Both the @command{gawk} designers and the original Bell Laboratories @command{awk}
+designers provided feedback for the POSIX specification.
-The GNU implementation, @code{gawk}, was written in 1986 by Paul Rubin
-and Jay Fenlason, with advice from Richard Stallman. John Woods
+@cindex Rubin, Paul
+@cindex Fenlason, Jay
+@cindex Trueman, David
+Paul Rubin wrote the GNU implementation, @command{gawk}, in 1986.
+Jay Fenlason completed it, with advice from Richard Stallman. John Woods
contributed parts of the code as well. In 1988 and 1989, David Trueman, with
-help from Arnold Robbins, thoroughly reworked @code{gawk} for compatibility
-with the newer @code{awk}. Current development focuses on bug fixes,
+help from me, thoroughly reworked @command{gawk} for compatibility
+with the newer @command{awk}.
+Circa 1995, I became the primary maintainer.
+Current development focuses on bug fixes,
performance improvements, standards compliance, and occasionally, new features.
-@node Manual History, Acknowledgements, History, Preface
+In May of 1997, J@"urgen Kahrs felt the need for network access
+from @command{awk}, and with a little help from me, set about adding
+features to do this for @command{gawk}. At that time, he also
+wrote the bulk of
+@cite{TCP/IP Internetworking with @command{gawk}}
+(a separate document, available as part of the @command{gawk} distribution).
+His code finally became part of the main @command{gawk} distribution
+with @command{gawk} @value{PVERSION} 3.1.
+
+@xref{Contributors, ,Major Contributors to @command{gawk}},
+for a complete list of those who made important contributions to @command{gawk}.
+
+@node Names, This Manual, History, Preface
+@section A Rose by Any Other Name
+
+@cindex old @command{awk} vs. new @command{awk}
+@cindex new @command{awk} vs. old @command{awk}
+The @command{awk} language has evolved over the years. Full details are
+provided in @ref{Language History, ,The Evolution of the @command{awk} Language}.
+The language described in this @value{DOCUMENT}
+is often referred to as ``new @command{awk}'' (@command{nawk}).
+
+Because of this, many systems have multiple
+versions of @command{awk}.
+Some systems have an @command{awk} utility that implements the
+original version of the @command{awk} language and a @command{nawk} utility
+for the new
+version.
+Others have an @command{oawk} for the ``old @command{awk}''
+language and plain @command{awk} for the new one. Still others only
+have one version, which is usually the new one.@footnote{Often, these systems
+use @command{gawk} for their @command{awk} implementation!}
+
+All in all, this makes it difficult for you to know which version of
+@command{awk} you should run when writing your programs. The best advice
+I can give here is to check your local documentation. Look for @command{awk},
+@command{oawk}, and @command{nawk}, as well as for @command{gawk}.
+It is likely that you already
+have some version of new @command{awk} on your system, which is what
+you should use when running your programs. (Of course, if you're reading
+this @value{DOCUMENT}, chances are good that you have @command{gawk}!)
+
+Throughout this @value{DOCUMENT}, whenever we refer to a language feature
+that should be available in any complete implementation of POSIX @command{awk},
+we simply use the term @command{awk}. When referring to a feature that is
+specific to the GNU implementation, we use the term @command{gawk}.
+
+@node This Manual, Conventions, Names, Preface
+@section Using This Book
+@cindex book, using this
+@cindex using this book
+@cindex language, @command{awk}
+@cindex program, @command{awk}
+@ignore
+@cindex @command{awk} language
+@cindex @command{awk} program
+@end ignore
+@cindex Brandon, Dick
+@cindex sex, comparisons with
+@quotation
+@i{Documentation is like sex: when it is good, it is very, very good; and
+when it is bad, it is better than nothing.}@*
+Dick Brandon
+@end quotation
+
+The term @command{awk} refers to a particular program as well as to the language you
+use to tell this program what to do. When we need to be careful, we call
+the program ``the @command{awk} utility'' and the language ``the @command{awk}
+language.''
+This @value{DOCUMENT} explains
+both the @command{awk} language and how to run the @command{awk} utility.
+The term @dfn{@command{awk} program} refers to a program written by you in
+the @command{awk} programming language.
+
+Primarily, this @value{DOCUMENT} explains the features of @command{awk},
+as defined in the POSIX standard. It does so in the context of the
+@command{gawk} implementation. While doing so, it also
+attempts to describe important differences between @command{gawk}
+and other @command{awk} implementations.@footnote{All such differences
+appear in the index under the heading ``differences between @command{gawk} and
+@command{awk}.''} Finally, any @command{gawk} features that are not in
+the POSIX standard for @command{awk} are noted.
+
+@ifnotinfo
+This @value{DOCUMENT} has the difficult task of being both a tutorial and a reference.
+If you are a novice, feel free to skip over details that seem too complex.
+You should also ignore the many cross references; they are for the
+expert user and for the online Info version of the document.
+@end ifnotinfo
+
+There are
+subsections labelled
+as @strong{Advanced Notes}
+scattered throughout the @value{DOCUMENT}.
+They add a more complete explanation of points that are relevant, but not likely
+to be of interest on first reading.
+All appear in the index, under the heading ``advanced notes.''
+
+Most of the time, the examples use complete @command{awk} programs.
+In some of the more advanced sections, only the part of the @command{awk}
+program that illustrates the concept currently being described is shown.
+
+While this @value{DOCUMENT} is aimed principally at people who have not been
+exposed
+to @command{awk}, there is a lot of information here that even the @command{awk}
+expert should find useful. In particular, the description of POSIX
+@command{awk} and the example programs in
+@ref{Library Functions, ,A Library of @command{awk} Functions}, and in
+@ref{Sample Programs, ,Practical @command{awk} Programs},
+should be of interest.
+
+@ref{Getting Started, ,Getting Started with @command{awk}},
+provides the essentials you need to know to begin using @command{awk}.
+
+@ref{Regexp, ,Regular Expressions},
+introduces regular expressions in general, and in particular the flavors
+supported by POSIX @command{awk} and @command{gawk}.
+
+@ref{Reading Files, , Reading Input Files},
+describes how @command{awk} reads your data.
+It introduces the concepts of records and fields, as well
+as the @code{getline} command.
+I/O redirection is first described here.
+
+@ref{Printing, , Printing Output},
+describes how @command{awk} programs can produce output with
+@code{print} and @code{printf}.
+
+@ref{Expressions},
+describes expressions, which are the basic building blocks
+for getting most things done in a program.
+
+@ref{Patterns and Actions, ,Patterns Actions and Variables},
+describes how to write patterns for matching records, actions for
+doing something when a record is matched, and the built-in variables
+@command{awk} and @command{gawk} use.
+
+@ref{Arrays, ,Arrays in @command{awk}},
+covers @command{awk}'s one-and-only data structure: associative arrays.
+Deleting array elements and whole arrays is also described, as well as
+sorting arrays in @command{gawk}.
+
+@ref{Functions},
+describes the built-in functions @command{awk} and
+@command{gawk} provide for you, as well as how to define
+your own functions.
+
+@ref{Internationalization, ,Internationalization with @command{gawk}},
+describes special features in @command{gawk} for translating program
+messages into different languages at runtime.
+
+@ref{Advanced Features, ,Advanced Features of @command{gawk}},
+describes a number of @command{gawk}-specific advanced features.
+Of particular note
+are the abilities to have two-way communications with another process,
+perform TCP/IP networking, and
+profile your @command{awk} programs.
+
+@ref{Invoking Gawk, ,Running @command{awk} and @command{gawk}},
+describes how to run @command{gawk}, the meaning of its
+command-line options, and how it finds @command{awk}
+program source files.
+
+@ref{Library Functions, ,A Library of @command{awk} Functions}, and
+@ref{Sample Programs, ,Practical @command{awk} Programs},
+provide many sample @command{awk} programs.
+Reading them allows you to see @command{awk} being used
+for solving real problems.
+
+@ref{Language History, ,The Evolution of the @command{awk} Language},
+describes how the @command{awk} language has evolved since it was
+first released to present. It also describes how @command{gawk}
+has acquired features over time.
+
+@ref{Installation, ,Installing @command{gawk}},
+describes how to get @command{gawk}, how to compile it
+under Unix, and how to compile and use it on different
+non-Unix systems. It also describes how to report bugs
+in @command{gawk} and where to get three other freely
+available implementations of @command{awk}.
+
+@ref{Notes, ,Implementation Notes},
+describes how to disable @command{gawk}'s extensions, as
+well as how to contribute new code to @command{gawk},
+how to write extension libraries, and some possible
+future directions for @command{gawk} development.
+
+@ref{Basic Concepts, ,Basic Programming Concepts},
+provides some very cursory background material for those who
+are completely unfamiliar with computer programming.
+Also centralized there is a discussion of some of the issues
+involved in using floating-point numbers.
+
+The
+@ref{Glossary},
+defines most, if not all, the significant terms used
+throughout the book.
+If you find terms that you aren't familiar with, try looking them up.
+
+@ref{Copying, ,GNU General Public License}, and
+@ref{GNU Free Documentation License},
+present the licenses that cover the @command{gawk} source code,
+and this @value{DOCUMENT}, respectively.
+
+@node Conventions, Manual History, This Manual, Preface
+@section Typographical Conventions
+
+@cindex Texinfo
+This @value{DOCUMENT} is written using Texinfo, the GNU documentation
+formatting language.
+A single Texinfo source file is used to produce both the printed and online
+versions of the documentation.
+@iftex
+Because of this, the typographical conventions
+are slightly different than in other books you may have read.
+@end iftex
+@ifnottex
+This @value{SECTION} briefly documents the typographical conventions used in Texinfo.
+@end ifnottex
+
+Examples you would type at the command-line are preceded by the common
+shell primary and secondary prompts, @samp{$} and @samp{>}.
+Output from the command is preceded by the glyph ``@print{}''.
+This typically represents the command's standard output.
+Error messages, and other output on the command's standard error, are preceded
+by the glyph ``@error{}''. For example:
+
+@example
+$ echo hi on stdout
+@print{} hi on stdout
+$ echo hello on stderr 1>&2
+@error{} hello on stderr
+@end example
+
+@iftex
+In the text, command names appear in @code{this font}, while code segments
+appear in the same font and quoted, @samp{like this}. Some things are
+emphasized @emph{like this}, and if a point needs to be made
+strongly, it is done @strong{like this}. The first occurrence of
+a new term is usually its @dfn{definition} and appears in the same
+font as the previous occurrence of ``definition'' in this sentence.
+@value{FN}s are indicated like this: @file{/path/to/ourfile}.
+@end iftex
+
+Characters that you type at the keyboard look @kbd{like this}. In particular,
+there are special characters called ``control characters.'' These are
+characters that you type by holding down both the @kbd{CONTROL} key and
+another key, at the same time. For example, a @kbd{Ctrl-d} is typed
+by first pressing and holding the @kbd{CONTROL} key, next
+pressing the @kbd{d} key and finally releasing both keys.
+
+@c fakenode --- for prepinfo
+@subsubheading Dark Corners
+@cindex Kernighan, Brian
+@quotation
+@i{Dark corners are basically fractal --- no matter how much
+you illuminate, there's always a smaller but darker one.}@*
+Brian Kernighan
+@end quotation
+
+@cindex d.c., see ``dark corner''
+@cindex dark corner
+Until the POSIX standard (and @cite{The Gawk Manual}),
+many features of @command{awk} were either poorly documented or not
+documented at all. Descriptions of such features
+(often called ``dark corners'') are noted in this @value{DOCUMENT} with
+@iftex
+the picture of a flashlight in the margin, as shown here.
+@value{DARKCORNER}
+@end iftex
+@ifnottex
+``(d.c.)''.
+@end ifnottex
+They also appear in the index under the heading ``dark corner.''
+
+As noted by the opening quote, though, any
+coverage of dark corners
+is, by definition, something that is incomplete.
+
+@node Manual History, How To Contribute, Conventions, Preface
@unnumberedsec The GNU Project and This Book
+@cindex Torvalds, Linus
+@cindex sex, comparisons with
+@quotation
+@i{Software is like sex: it's better when it's free.}@*
+Linus Torvalds
+@end quotation
+@cindex FSF
@cindex Free Software Foundation
@cindex Stallman, Richard
The Free Software Foundation (FSF) is a non-profit organization dedicated
@@ -612,493 +1207,391 @@ It was founded by Richard M.@: Stallman, the author of the original
Emacs editor. GNU Emacs is the most widely used version of Emacs today.
@cindex GNU Project
-The GNU project is an on-going effort on the part of the Free Software
-Foundation to create a complete, freely distributable, POSIX compliant
-computing environment. (GNU stands for ``GNU's not Unix''.)
-The FSF uses the ``GNU General Public License'' (or GPL) to ensure that
-source code for their software is always available to the end user. A
-copy of the GPL is included for your reference
-(@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE}).
-The GPL applies to the C language source code for @code{gawk}.
+@cindex GPL
+@cindex General Public License
+@cindex GNU General Public License
+@cindex online documentation
+@cindex documentation, online
+The GNU@footnote{GNU stands for ``GNU's not Unix.''}
+Project is an ongoing effort on the part of the Free Software
+Foundation to create a complete, freely distributable, POSIX-compliant
+computing environment.
+The FSF uses the ``GNU General Public License'' (GPL) to ensure that
+their software's
+source code is always available to the end user. A
+copy of the GPL is included
+@ifnotinfo
+in this @value{DOCUMENT}
+@end ifnotinfo
+for your reference
+(@pxref{Copying, ,GNU General Public License}).
+The GPL applies to the C language source code for @command{gawk}.
+To find out more about the FSF and the GNU Project online,
+see @uref{http://www.gnu.org, the GNU Project's home page}.
+This @value{DOCUMENT} may also be read from
+@uref{http://www.gnu.org/manual/gawk/, their web site}.
A shell, an editor (Emacs), highly portable optimizing C, C++, and
-Objective-C compilers, a symbolic debugger, and dozens of large and
-small utilities (such as @code{gawk}), have all been completed and are
-freely available. As of this writing (early 1997), the GNU operating
-system kernel (the HURD), has been released, but is still in an early
+Objective-C compilers, a symbolic debugger and dozens of large and
+small utilities (such as @command{gawk}), have all been completed and are
+freely available. The GNU operating
+system kernel (the HURD), has been released but is still in an early
stage of development.
@cindex Linux
+@cindex GNU/Linux
+@cindex BSD-based operating systems
@cindex NetBSD
@cindex FreeBSD
+@cindex OpenBSD
Until the GNU operating system is more fully developed, you should
-consider using Linux, a freely distributable, Unix-like operating
-system for 80386, DEC Alpha, Sun SPARC and other systems. There are
-many books on Linux. One freely available one is @cite{Linux
+consider using GNU/Linux, a freely distributable, Unix-like operating
+system for Intel 80386, DEC Alpha, Sun SPARC, IBM S/390, and other
+systems.@footnote{The terminology ``GNU/Linux'' is explained
+in the @ref{Glossary}.}
+There are
+many books on GNU/Linux. One that is freely available is @cite{Linux
Installation and Getting Started}, by Matt Welsh.
-Many Linux distributions are available, often in computer stores or
-bundled on CD-ROM with books about Linux.
+Many GNU/Linux distributions are often available in computer stores or
+bundled on CD-ROMs with books about Linux.
(There are three other freely available, Unix-like operating systems for
-80386 and other systems, NetBSD, FreeBSD,and OpenBSD. All are based on the
+80386 and other systems: NetBSD, FreeBSD, and OpenBSD. All are based on the
4.4-Lite Berkeley Software Distribution, and they use recent versions
-of @code{gawk} for their versions of @code{awk}.)
+of @command{gawk} for their versions of @command{awk}.)
-@iftex
-This @value{DOCUMENT} you are reading now is actually free. The
-information in it is freely available to anyone, the machine readable
-source code for the @value{DOCUMENT} comes with @code{gawk}, and anyone
+@ifnotinfo
+The @value{DOCUMENT} you are reading now is actually free---at least, the
+information in it is free to anyone. The machine readable
+source code for the @value{DOCUMENT} comes with @command{gawk}; anyone
may take this @value{DOCUMENT} to a copying machine and make as many
-copies of it as they like. (Take a moment to check the copying
-permissions on the Copyright page.)
-
-If you paid money for this @value{DOCUMENT}, what you actually paid for
-was the @value{DOCUMENT}'s nice printing and binding, and the
-publisher's associated costs to produce it. We have made an effort to
-keep these costs reasonable; most people would prefer a bound book to
-over 330 pages of photo-copied text that would then have to be held in
-a loose-leaf binder (not to mention the time and labor involved in
-doing the copying). The same is true of producing this
-@value{DOCUMENT} from the machine readable source; the retail price is
-only slightly more than the cost per page of printing it
-on a laser printer.
-@end iftex
+copies of it as they like. (Take a moment to check the Free Documentation
+License; see @ref{GNU Free Documentation License}.)
+
+Although you could just print it out yourself, bound books are much
+easier to read and use. Furthermore,
+the proceeds from sales of this book go back to the FSF
+to help fund development of more free software.
+@end ifnotinfo
-This @value{DOCUMENT} itself has gone through several previous,
-preliminary editions. I started working on a preliminary draft of
-@cite{The GAWK Manual}, by Diane Close, Paul Rubin, and Richard
-Stallman in the fall of 1988.
-It was around 90 pages long, and barely described the original, ``old''
-version of @code{awk}. After substantial revision, the first version of
+@ignore
+@cindex Close, Diane
+The @value{DOCUMENT} itself has gone through several previous,
+preliminary editions.
+Paul Rubin wrote the very first draft of @cite{The GAWK Manual};
+it was around 40 pages in size.
+Diane Close and Richard Stallman improved it, yielding the
+version which I started working with in the fall of 1988.
+It was around 90 pages long and barely described the original, ``old''
+version of @command{awk}. After substantial revision, the first version of
the @cite{The GAWK Manual} to be released was Edition 0.11 Beta in
October of 1989. The manual then underwent more substantial revision
for Edition 0.13 of December 1991.
-David Trueman, Pat Rankin, and Michal Jaegermann contributed sections
+David Trueman, Pat Rankin and Michal Jaegermann contributed sections
of the manual for Edition 0.13.
That edition was published by the
-FSF as a bound book early in 1992. Since then there have been several
+FSF as a bound book early in 1992. Since then there were several
minor revisions, notably Edition 0.14 of November 1992 that was published
-by the FSF in January of 1993, and Edition 0.16 of August 1993.
+by the FSF in January of 1993 and Edition 0.16 of August 1993.
-Edition 1.0 of @cite{@value{TITLE}} represents a significant re-working
+Edition 1.0 of @cite{GAWK: The GNU Awk User's Guide} represented a significant re-working
of @cite{The GAWK Manual}, with much additional material.
-The FSF and I agree that I am now the primary author.
-I also felt that it needed a more descriptive title.
+The FSF and I agreed that I was now the primary author.
+@c I also felt that the manual needed a more descriptive title.
+
+In January 1996, SSC published Edition 1.0 under the title @cite{Effective AWK Programming}.
+In February 1997, they published Edition 1.0.3 which had minor changes
+as a ``second edition.''
+In 1999, the FSF published this same version as Edition 2
+of @cite{GAWK: The GNU Awk User's Guide}.
+
+Edition @value{EDITION} maintains the basic structure of Edition 1.0,
+but with significant additional material, reflecting the host of new features
+in @command{gawk} @value{PVERSION} @value{VERSION}.
+Of particular note is
+@ref{Array Sorting, ,Sorting Array Values and Indices with @command{gawk}},
+@ref{Bitwise Functions, ,Using @command{gawk}'s Bit Manipulation Functions},
+@ref{Internationalization, ,Internationalization with @command{gawk}},
+@ref{Advanced Features, ,Advanced Features of @command{gawk}},
+and
+@ref{Dynamic Extensions, ,Adding New Built-in Functions to @command{gawk}}.
+@end ignore
+
+@cindex Close, Diane
+The @value{DOCUMENT} itself has gone through a number of previous editions.
+Paul Rubin wrote the very first draft of @cite{The GAWK Manual};
+it was around 40 pages in size.
+Diane Close and Richard Stallman improved it, yielding a
+version that was
+around 90 pages long and barely described the original, ``old''
+version of @command{awk}.
+
+I started working with that version in the fall of 1988.
+As work on it progressed,
+the FSF published several preliminary versions (numbered 0.@var{x}).
+In 1996, Edition 1.0 was released with @command{gawk} 3.0.0.
+The FSF published the first two editions under
+the title @cite{The GNU Awk User's Guide}.
+
+This edition maintains the basic structure of Edition 1.0,
+but with significant additional material, reflecting the host of new features
+in @command{gawk} @value{PVERSION} @value{VERSION}.
+Of particular note is
+@ref{Array Sorting, ,Sorting Array Values and Indices with @command{gawk}},
+as well as
+@ref{Bitwise Functions, ,Using @command{gawk}'s Bit Manipulation Functions},
+@ref{Internationalization, ,Internationalization with @command{gawk}},
+and also
+@ref{Advanced Features, ,Advanced Features of @command{gawk}},
+and
+@ref{Dynamic Extensions, ,Adding New Built-in Functions to @command{gawk}}.
@cite{@value{TITLE}} will undoubtedly continue to evolve.
An electronic version
-comes with the @code{gawk} distribution from the FSF.
+comes with the @command{gawk} distribution from the FSF.
If you find an error in this @value{DOCUMENT}, please report it!
@xref{Bugs, ,Reporting Problems and Bugs}, for information on submitting
-problem reports electronically, or write to me in care of the FSF.
+problem reports electronically, or write to me in care of the publisher.
-@node Acknowledgements, , Manual History, Preface
-@unnumberedsec Acknowledgements
+@node How To Contribute, Acknowledgments, Manual History, Preface
+@unnumberedsec How to Contribute
-@cindex Stallman, Richard
-I would like to acknowledge Richard M.@: Stallman, for his vision of a
-better world, and for his courage in founding the FSF and starting the
-GNU project.
+As the maintainer of GNU @command{awk},
+I am starting a collection of publicly available @command{awk}
+programs.
+For more information,
+see @uref{ftp://ftp.freefriends.org/arnold/Awkstuff}.
+If you have written an interesting @command{awk} program, or have written a
+@command{gawk} extension that you would like to
+share with the rest of the world, please contact me (@email{arnold@@gnu.org}).
+Making things available on the Internet helps keep the
+@command{gawk} distribution down to manageable size.
+
+@node Acknowledgments, , How To Contribute, Preface
+@unnumberedsec Acknowledgments
-The initial draft of @cite{The GAWK Manual} had the following acknowledgements:
+The initial draft of @cite{The GAWK Manual} had the following acknowledgments:
@quotation
Many people need to be thanked for their assistance in producing this
manual. Jay Fenlason contributed many ideas and sample programs. Richard
Mlynarik and Robert Chassell gave helpful comments on drafts of this
-manual. The paper @cite{A Supplemental Document for @code{awk}} by John W.@:
+manual. The paper @cite{A Supplemental Document for @command{awk}} by John W.@:
Pierce of the Chemistry Department at UC San Diego, pinpointed several
-issues relevant both to @code{awk} implementation and to this manual, that
+issues relevant both to @command{awk} implementation and to this manual, that
would otherwise have escaped us.
@end quotation
-The following people provided many helpful comments on Edition 0.13 of
-@cite{The GAWK Manual}: Rick Adams, Michael Brennan, Rich Burridge, Diane Close,
-Christopher (``Topher'') Eliot, Michael Lijewski, Pat Rankin, Miriam Robbins,
-and Michal Jaegermann.
+@cindex Stallman, Richard
+I would like to acknowledge Richard M.@: Stallman, for his vision of a
+better world and for his courage in founding the FSF and starting the
+GNU project.
-The following people provided many helpful comments for Edition 1.0 of
-@cite{@value{TITLE}}: Karl Berry, Michael Brennan, Darrel
-Hankerson, Michal Jaegermann, Michael Lijewski, and Miriam Robbins.
-Pat Rankin, Michal Jaegermann, Darrel Hankerson and Scott Deifik
-updated their respective sections for Edition 1.0.
+The following people (in alphabetical order)
+provided helpful comments on various
+versions of this book, up to and including this edition.
+Rick Adams,
+Nelson H.F. Beebe,
+Karl Berry,
+Dr.@: Michael Brennan,
+Rich Burridge,
+Claire Coutier,
+Diane Close,
+Scott Deifik,
+Christopher (``Topher'') Eliot,
+Jeffrey Friedl,
+Dr.@: Darrel Hankerson,
+Michal Jaegermann,
+Dr.@: Richard J.@: LeBlanc,
+Michael Lijewski,
+Pat Rankin,
+Miriam Robbins,
+Mary Sheehan,
+and
+Chuck Toporek.
+@cindex Berry, Karl
+@cindex Chassell, Robert J.@:
+@cindex Texinfo
Robert J.@: Chassell provided much valuable advice on
-the use of Texinfo. He also deserves special thanks for
+the use of Texinfo.
+He also deserves special thanks for
convincing me @emph{not} to title this @value{DOCUMENT}
@cite{How To Gawk Politely}.
Karl Berry helped significantly with the @TeX{} part of Texinfo.
+@cindex Hartholz, Marshall
+@cindex Hartholz, Elaine
+@cindex Schreiber, Bert
+@cindex Schreiber, Rita
+I would like to thank Marshall and Elaine Hartholz of Seattle and
+Dr.@: Bert and Rita Schreiber of Detroit for large amounts of quiet vacation
+time in their homes, which allowed me to make significant progress on
+this @value{DOCUMENT} and on @command{gawk} itself.
+
+@cindex Hughes, Phil
+Phil Hughes of SSC
+contributed in a very important way by loaning me his laptop GNU/Linux
+system, not once, but twice, which allowed me to do a lot of work while
+away from home.
+
@cindex Trueman, David
David Trueman deserves special credit; he has done a yeoman job
-of evolving @code{gawk} so that it performs well, and without bugs.
-Although he is no longer involved with @code{gawk},
+of evolving @command{gawk} so that it performs well and without bugs.
+Although he is no longer involved with @command{gawk},
working with him on this project was a significant pleasure.
+@cindex Drepper, Ulrich
+@cindex GNITS mailing list
+The intrepid members of the GNITS mailing list, and most notably Ulrich
+Drepper, provided invaluable help and feedback for the design of the
+internationalization features.
+
+@cindex Beebe, Nelson
+@cindex Brown, Martin
@cindex Deifik, Scott
@cindex Hankerson, Darrel
-@cindex Rommel, Kai Uwe
-@cindex Rankin, Pat
@cindex Jaegermann, Michal
-Scott Deifik, Darrel Hankerson, Kai Uwe Rommel, Pat Rankin, and Michal
-Jaegermann (in no particular order) are long time members of the
-@code{gawk} ``crack portability team.'' Without their hard work and
-help, @code{gawk} would not be nearly the fine program it is today. It
+@cindex Kahrs, J@"urgen
+@cindex Rankin, Pat
+@cindex Rommel, Kai Uwe
+@cindex Zaretskii, Eli
+Nelson Beebe,
+Martin Brown,
+Scott Deifik,
+Darrel Hankerson,
+Michal Jaegermann,
+J@"urgen Kahrs,
+Pat Rankin,
+Kai Uwe Rommel,
+and Eli Zaretskii
+(in alphabetical order)
+are long-time members of the
+@command{gawk} ``crack portability team.'' Without their hard work and
+help, @command{gawk} would not be nearly the fine program it is today. It
has been and continues to be a pleasure working with this team of fine
people.
-@cindex Friedl, Jeffrey
-Jeffrey Friedl provided invaluable help in tracking down a number
-of last minute problems with regular expressions in @code{gawk} 3.0.
-
@cindex Kernighan, Brian
-David and I would like to thank Brian Kernighan of Bell Labs for
-invaluable assistance during the testing and debugging of @code{gawk}, and for
+David and I would like to thank Brian Kernighan of Bell Laboratories for
+invaluable assistance during the testing and debugging of @command{gawk}, and for
help in clarifying numerous points about the language. We could not have
-done nearly as good a job on either @code{gawk} or its documentation without
+done nearly as good a job on either @command{gawk} or its documentation without
his help.
-@cindex Hughes, Phil
-I would like to thank Marshall and Elaine Hartholz of Seattle, and Dr.@:
-Bert and Rita Schreiber of Detroit for large amounts of quiet vacation
-time in their homes, which allowed me to make significant progress on
-this @value{DOCUMENT} and on @code{gawk} itself. Phil Hughes of SSC
-contributed in a very important way by loaning me his laptop Linux
-system, not once, but twice, allowing me to do a lot of work while
-away from home.
+Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly & Associates contributed
+significant editorial help for this @value{DOCUMENT} for the
+3.1 release of @command{gawk}.
@cindex Robbins, Miriam
-Finally, I must thank my wonderful wife, Miriam, for her patience through
+@cindex Robbins, Jean
+@cindex Robbins, Harry
+@cindex G-d
+I must thank my wonderful wife, Miriam, for her patience through
the many versions of this project, for her proof-reading,
and for sharing me with the computer.
I would like to thank my parents for their love, and for the grace with
which they raised and educated me.
-I also must acknowledge my gratitude to G-d, for the many opportunities
+Finally, I also must acknowledge my gratitude to G-d, for the many opportunities
He has sent my way, as well as for the gifts He has given me with which to
take advantage of those opportunities.
@sp 2
@noindent
Arnold Robbins @*
-Atlanta, Georgia @*
-February, 1997
+Nof Ayalon @*
+ISRAEL @*
+March, 2001
@ignore
-Stuff still not covered anywhere:
-BASICS:
- Integer vs. floating point
- Hex vs. octal vs. decimal
- Interpreter vs compiler
- input/output
-@end ignore
-
-@node What Is Awk, Getting Started, Preface, Top
-@chapter Introduction
-
-If you are like many computer users, you would frequently like to make
-changes in various text files wherever certain patterns appear, or
-extract data from parts of certain lines while discarding the rest. To
-write a program to do this in a language such as C or Pascal is a
-time-consuming inconvenience that may take many lines of code. The job
-may be easier with @code{awk}.
-
-The @code{awk} utility interprets a special-purpose programming language
-that makes it possible to handle simple data-reformatting jobs
-with just a few lines of code.
-
-The GNU implementation of @code{awk} is called @code{gawk}; it is fully
-upward compatible with the System V Release 4 version of
-@code{awk}. @code{gawk} is also upward compatible with the POSIX
-specification of the @code{awk} language. This means that all
-properly written @code{awk} programs should work with @code{gawk}.
-Thus, we usually don't distinguish between @code{gawk} and other @code{awk}
-implementations.
-
-@cindex uses of @code{awk}
-Using @code{awk} you can:
+@c Try this
+@iftex
+@page
+@headings off
+@majorheading I@ @ @ @ The @command{awk} Language and @command{gawk}
+Part I describes the @command{awk} language and @command{gawk} program in detail.
+It starts with the basics, and continues through all of the features of @command{awk}
+and @command{gawk}. It contains the following chapters:
@itemize @bullet
@item
-manage small, personal databases
+@ref{Getting Started, ,Getting Started with @command{awk}}.
@item
-generate reports
+@ref{Regexp, ,Regular Expressions}.
@item
-validate data
+@ref{Reading Files, , Reading Input Files}.
@item
-produce indexes, and perform other document preparation tasks
+@ref{Printing, , Printing Output}.
@item
-even experiment with algorithms that can be adapted later to other computer
-languages
-@end itemize
-
-@menu
-* This Manual:: Using this @value{DOCUMENT}. Includes sample
- input files that you can use.
-* Conventions:: Typographical Conventions.
-* Sample Data Files:: Sample data files for use in the @code{awk}
- programs illustrated in this @value{DOCUMENT}.
-@end menu
-
-@node This Manual, Conventions, What Is Awk, What Is Awk
-@section Using This Book
-@cindex book, using this
-@cindex using this book
-@cindex language, @code{awk}
-@cindex program, @code{awk}
-@ignore
-@cindex @code{awk} language
-@cindex @code{awk} program
-@end ignore
-
-The term @code{awk} refers to a particular program, and to the language you
-use to tell this program what to do. When we need to be careful, we call
-the program ``the @code{awk} utility'' and the language ``the @code{awk}
-language.'' The term @code{gawk} refers to a version of @code{awk} developed
-as part the GNU project. The purpose of this @value{DOCUMENT} is to explain
-both the @code{awk} language and how to run the @code{awk} utility.
-
-The main purpose of the @value{DOCUMENT} is to explain the features
-of @code{awk}, as defined in the POSIX standard. It does so in the context
-of one particular implementation, @code{gawk}. While doing so, it will also
-attempt to describe important differences between @code{gawk} and other
-@code{awk} implementations. Finally, any @code{gawk} features that
-are not in the POSIX standard for @code{awk} will be noted.
-
-@iftex
-This @value{DOCUMENT} has the difficult task of being both tutorial and reference.
-If you are a novice, feel free to skip over details that seem too complex.
-You should also ignore the many cross references; they are for the
-expert user, and for the on-line Info version of the document.
-@end iftex
-
-The term @dfn{@code{awk} program} refers to a program written by you in
-the @code{awk} programming language.
-
-@xref{Getting Started, ,Getting Started with @code{awk}}, for the bare
-essentials you need to know to start using @code{awk}.
-
-Some useful ``one-liners'' are included to give you a feel for the
-@code{awk} language (@pxref{One-liners, ,Useful One Line Programs}).
-
-Many sample @code{awk} programs have been provided for you
-(@pxref{Library Functions, ,A Library of @code{awk} Functions}; also
-@pxref{Sample Programs, ,Practical @code{awk} Programs}).
-
-The entire @code{awk} language is summarized for quick reference in
-@ref{Gawk Summary, ,@code{gawk} Summary}. Look there if you just need
-to refresh your memory about a particular feature.
-
-If you find terms that you aren't familiar with, try looking them
-up in the glossary (@pxref{Glossary}).
-
-Most of the time complete @code{awk} programs are used as examples, but in
-some of the more advanced sections, only the part of the @code{awk} program
-that illustrates the concept being described is shown.
+@ref{Expressions}.
-While this @value{DOCUMENT} is aimed principally at people who have not been
-exposed
-to @code{awk}, there is a lot of information here that even the @code{awk}
-expert should find useful. In particular, the description of POSIX
-@code{awk}, and the example programs in
-@ref{Library Functions, ,A Library of @code{awk} Functions}, and
-@ref{Sample Programs, ,Practical @code{awk} Programs},
-should be of interest.
-
-@c fakenode --- for prepinfo
-@unnumberedsubsec Dark Corners
-@display
-@i{Who opened that window shade?!?}
-Count Dracula
-@end display
-@sp 1
+@item
+@ref{Patterns and Actions, ,Patterns Actions and Variables}.
-@cindex d.c., see ``dark corner''
-@cindex dark corner
-Until the POSIX standard (and @cite{The Gawk Manual}),
-many features of @code{awk} were either poorly documented, or not
-documented at all. Descriptions of such features
-(often called ``dark corners'') are noted in this @value{DOCUMENT} with
-``(d.c.)''.
-They also appear in the index under the heading ``dark corner.''
+@item
+@ref{Arrays, ,Arrays in @command{awk}}.
-@node Conventions, Sample Data Files, This Manual, What Is Awk
-@section Typographical Conventions
+@item
+@ref{Functions}.
-This @value{DOCUMENT} is written using Texinfo, the GNU documentation formatting language.
-A single Texinfo source file is used to produce both the printed and on-line
-versions of the documentation.
-@iftex
-Because of this, the typographical conventions
-are slightly different than in other books you may have read.
-@end iftex
-@ifinfo
-This section briefly documents the typographical conventions used in Texinfo.
-@end ifinfo
+@item
+@ref{Internationalization, ,Internationalization with @command{gawk}}.
-Examples you would type at the command line are preceded by the common
-shell primary and secondary prompts, @samp{$} and @samp{>}.
-Output from the command is preceded by the glyph ``@print{}''.
-This typically represents the command's standard output.
-Error messages, and other output on the command's standard error, are preceded
-by the glyph ``@error{}''. For example:
+@item
+@ref{Advanced Features, ,Advanced Features of @command{gawk}}.
-@example
-@group
-$ echo hi on stdout
-@print{} hi on stdout
-$ echo hello on stderr 1>&2
-@error{} hello on stderr
-@end group
-@end example
+@item
+@ref{Invoking Gawk, ,Running @command{awk} and @command{gawk}}.
+@end itemize
-@iftex
-In the text, command names appear in @code{this font}, while code segments
-appear in the same font and quoted, @samp{like this}. Some things will
-be emphasized @emph{like this}, and if a point needs to be made
-strongly, it will be done @strong{like this}. The first occurrence of
-a new term is usually its @dfn{definition}, and appears in the same
-font as the previous occurrence of ``definition'' in this sentence.
-File names are indicated like this: @file{/path/to/ourfile}.
+@page
+@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
+@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
@end iftex
+@end ignore
-Characters that you type at the keyboard look @kbd{like this}. In particular,
-there are special characters called ``control characters.'' These are
-characters that you type by holding down both the @kbd{CONTROL} key and
-another key, at the same time. For example, a @kbd{Control-d} is typed
-by first pressing and holding the @kbd{CONTROL} key, next
-pressing the @kbd{d} key, and finally releasing both keys.
-
-@node Sample Data Files, , Conventions, What Is Awk
-@section Data Files for the Examples
-
-@cindex input file, sample
-@cindex sample input file
-@cindex @file{BBS-list} file
-Many of the examples in this @value{DOCUMENT} take their input from two sample
-data files. The first, called @file{BBS-list}, represents a list of
-computer bulletin board systems together with information about those systems.
-The second data file, called @file{inventory-shipped}, contains
-information about shipments on a monthly basis. In both files,
-each line is considered to be one @dfn{record}.
-
-In the file @file{BBS-list}, each record contains the name of a computer
-bulletin board, its phone number, the board's baud rate(s), and a code for
-the number of hours it is operational. An @samp{A} in the last column
-means the board operates 24 hours a day. A @samp{B} in the last
-column means the board operates evening and weekend hours, only. A
-@samp{C} means the board operates only on weekends.
-
-@c 2e: Update the baud rates to reflect today's faster modems
-@example
-@c system mkdir eg
-@c system mkdir eg/lib
-@c system mkdir eg/data
-@c system mkdir eg/prog
-@c system mkdir eg/misc
-@c file eg/data/BBS-list
-aardvark 555-5553 1200/300 B
-alpo-net 555-3412 2400/1200/300 A
-barfly 555-7685 1200/300 A
-bites 555-1675 2400/1200/300 A
-camelot 555-0542 300 C
-core 555-2912 1200/300 C
-fooey 555-1234 2400/1200/300 B
-foot 555-6699 1200/300 B
-macfoo 555-6480 1200/300 A
-sdace 555-3430 2400/1200/300 A
-sabafoo 555-2127 1200/300 C
-@c endfile
-@end example
-
-@cindex @file{inventory-shipped} file
-The second data file, called @file{inventory-shipped}, represents
-information about shipments during the year.
-Each record contains the month of the year, the number
-of green crates shipped, the number of red boxes shipped, the number of
-orange bags shipped, and the number of blue packages shipped,
-respectively. There are 16 entries, covering the 12 months of one year
-and four months of the next year.
-
-@example
-@c file eg/data/inventory-shipped
-Jan 13 25 15 115
-Feb 15 32 24 226
-Mar 15 24 34 228
-Apr 31 52 63 420
-May 16 34 29 208
-Jun 31 42 75 492
-Jul 24 34 67 436
-Aug 15 34 47 316
-Sep 13 55 37 277
-Oct 29 54 68 525
-Nov 20 87 82 577
-Dec 17 35 61 401
-
-Jan 21 36 64 620
-Feb 26 58 80 652
-Mar 24 75 70 495
-Apr 21 70 74 514
-@c endfile
-@end example
-
-@ifinfo
-If you are reading this in GNU Emacs using Info, you can copy the regions
-of text showing these sample files into your own test files. This way you
-can try out the examples shown in the remainder of this document. You do
-this by using the command @kbd{M-x write-region} to copy text from the Info
-file into a file for use with @code{awk}
-(@xref{Misc File Ops, , Miscellaneous File Operations, emacs, GNU Emacs Manual},
-for more information). Using this information, create your own
-@file{BBS-list} and @file{inventory-shipped} files, and practice what you
-learn in this @value{DOCUMENT}.
-
-If you are using the stand-alone version of Info,
-see @ref{Extract Program, ,Extracting Programs from Texinfo Source Files},
-for an @code{awk} program that will extract these data files from
-@file{gawk.texi}, the Texinfo source file for this Info file.
-@end ifinfo
-
-@node Getting Started, One-liners, What Is Awk, Top
-@chapter Getting Started with @code{awk}
+@node Getting Started, Regexp, Preface, Top
+@chapter Getting Started with @command{awk}
@cindex script, definition of
@cindex rule, definition of
@cindex program, definition of
-@cindex basic function of @code{awk}
+@cindex basic function of @command{awk}
-The basic function of @code{awk} is to search files for lines (or other
+The basic function of @command{awk} is to search files for lines (or other
units of text) that contain certain patterns. When a line matches one
-of the patterns, @code{awk} performs specified actions on that line.
-@code{awk} keeps processing input lines in this way until the end of the
-input files are reached.
+of the patterns, @command{awk} performs specified actions on that line.
+@command{awk} keeps processing input lines in this way until it reaches
+the end of the input files.
@cindex data-driven languages
@cindex procedural languages
@cindex language, data-driven
@cindex language, procedural
-Programs in @code{awk} are different from programs in most other languages,
-because @code{awk} programs are @dfn{data-driven}; that is, you describe
-the data you wish to work with, and then what to do when you find it.
+Programs in @command{awk} are different from programs in most other languages,
+because @command{awk} programs are @dfn{data-driven}; that is, you describe
+the data you want to work with and then what to do when you find it.
Most other languages are @dfn{procedural}; you have to describe, in great
detail, every step the program is to take. When working with procedural
languages, it is usually much
harder to clearly describe the data your program will process.
-For this reason, @code{awk} programs are often refreshingly easy to both
+For this reason, @command{awk} programs are often refreshingly easy to
write and read.
@cindex program, definition of
@cindex rule, definition of
-When you run @code{awk}, you specify an @code{awk} @dfn{program} that
-tells @code{awk} what to do. The program consists of a series of
+When you run @command{awk}, you specify an @command{awk} @dfn{program} that
+tells @command{awk} what to do. The program consists of a series of
@dfn{rules}. (It may also contain @dfn{function definitions},
-an advanced feature which we will ignore for now.
-@xref{User-defined, ,User-defined Functions}.) Each rule specifies one
-pattern to search for, and one action to perform when that pattern is found.
+an advanced feature that we will ignore for now.
+@xref{User-defined, ,User-Defined Functions}.) Each rule specifies one
+pattern to search for and one action to perform
+upon finding the pattern.
Syntactically, a rule consists of a pattern followed by an action. The
action is enclosed in curly braces to separate it from the pattern.
-Rules are usually separated by newlines. Therefore, an @code{awk}
+Newlines usually separate rules. Therefore, an @command{awk}
program looks like this:
@example
@@ -1108,70 +1601,34 @@ program looks like this:
@end example
@menu
-* Names:: What name to use to find @code{awk}.
-* Running gawk:: How to run @code{gawk} programs; includes
- command line syntax.
+* Running gawk:: How to run @command{gawk} programs; includes
+ command-line syntax.
+* Sample Data Files:: Sample data files for use in the @command{awk}
+ programs illustrated in this @value{DOCUMENT}.
* Very Simple:: A very simple example.
-* Two Rules:: A less simple one-line example with two rules.
+* Two Rules:: A less simple one-line example using two
+ rules.
* More Complex:: A more complex example.
* Statements/Lines:: Subdividing or combining statements into
lines.
-* Other Features:: Other Features of @code{awk}.
-* When:: When to use @code{gawk} and when to use other
- things.
+* Other Features:: Other Features of @command{awk}.
+* When:: When to use @command{gawk} and when to use
+ other things.
@end menu
-@node Names, Running gawk , Getting Started, Getting Started
-@section A Rose By Any Other Name
-
-@cindex old @code{awk} vs. new @code{awk}
-@cindex new @code{awk} vs. old @code{awk}
-The @code{awk} language has evolved over the years. Full details are
-provided in @ref{Language History, ,The Evolution of the @code{awk} Language}.
-The language described in this @value{DOCUMENT}
-is often referred to as ``new @code{awk}.''
-
-Because of this, many systems have multiple
-versions of @code{awk}.
-Some systems have an @code{awk} utility that implements the
-original version of the @code{awk} language, and a @code{nawk} utility
-for the new version. Others have an @code{oawk} for the ``old @code{awk}''
-language, and plain @code{awk} for the new one. Still others only
-have one version, usually the new one.@footnote{Often, these systems
-use @code{gawk} for their @code{awk} implementation!}
-
-All in all, this makes it difficult for you to know which version of
-@code{awk} you should run when writing your programs. The best advice
-we can give here is to check your local documentation. Look for @code{awk},
-@code{oawk}, and @code{nawk}, as well as for @code{gawk}. Chances are, you
-will have some version of new @code{awk} on your system, and that is what
-you should use when running your programs. (Of course, if you're reading
-this @value{DOCUMENT}, chances are good that you have @code{gawk}!)
-
-Throughout this @value{DOCUMENT}, whenever we refer to a language feature
-that should be available in any complete implementation of POSIX @code{awk},
-we simply use the term @code{awk}. When referring to a feature that is
-specific to the GNU implementation, we use the term @code{gawk}.
+@node Running gawk, Sample Data Files, Getting Started, Getting Started
+@section How to Run @command{awk} Programs
-@node Running gawk, Very Simple, Names, Getting Started
-@section How to Run @code{awk} Programs
-
-@cindex command line formats
-@cindex running @code{awk} programs
-There are several ways to run an @code{awk} program. If the program is
-short, it is easiest to include it in the command that runs @code{awk},
+@cindex command-line formats
+@cindex running @command{awk} programs
+There are several ways to run an @command{awk} program. If the program is
+short, it is easiest to include it in the command that runs @command{awk},
like this:
@example
awk '@var{program}' @var{input-file1} @var{input-file2} @dots{}
@end example
-@noindent
-where @var{program} consists of a series of patterns and actions, as
-described earlier.
-(The reason for the single quotes is described below, in
-@ref{One-shot, ,One-shot Throw-away @code{awk} Programs}.)
-
When the program is long, it is usually more convenient to put it in a file
and run it with a command like this:
@@ -1179,22 +1636,28 @@ and run it with a command like this:
awk -f @var{program-file} @var{input-file1} @var{input-file2} @dots{}
@end example
+This @value{SECTION} discusses both mechanisms, along with several
+variations of each.
+
@menu
-* One-shot:: Running a short throw-away @code{awk} program.
+* One-shot:: Running a short throw-away @command{awk}
+ program.
* Read Terminal:: Using no input files (input from terminal
instead).
-* Long:: Putting permanent @code{awk} programs in
+* Long:: Putting permanent @command{awk} programs in
files.
-* Executable Scripts:: Making self-contained @code{awk} programs.
-* Comments:: Adding documentation to @code{gawk} programs.
+* Executable Scripts:: Making self-contained @command{awk} programs.
+* Comments:: Adding documentation to @command{gawk}
+ programs.
+* Quoting:: More discussion of shell quoting issues.
@end menu
@node One-shot, Read Terminal, Running gawk, Running gawk
-@subsection One-shot Throw-away @code{awk} Programs
+@subsection One-Shot Throw-Away @command{awk} Programs
-Once you are familiar with @code{awk}, you will often type in simple
+Once you are familiar with @command{awk}, you will often type in simple
programs the moment you want to use them. Then you can write the
-program as the first argument of the @code{awk} command, like this:
+program as the first argument of the @command{awk} command, like this:
@example
awk '@var{program}' @var{input-file1} @var{input-file2} @dots{}
@@ -1206,21 +1669,27 @@ where @var{program} consists of a series of @var{patterns} and
@cindex single quotes, why needed
This command format instructs the @dfn{shell}, or command interpreter,
-to start @code{awk} and use the @var{program} to process records in the
-input file(s). There are single quotes around @var{program} so that
-the shell doesn't interpret any @code{awk} characters as special shell
-characters. They also cause the shell to treat all of @var{program} as
-a single argument for @code{awk} and allow @var{program} to be more
+to start @command{awk} and use the @var{program} to process records in the
+input file(s). There are single quotes around @var{program} so
+the shell won't interpret any @command{awk} characters as special shell
+characters. The quotes also cause the shell to treat all of @var{program} as
+a single argument for @command{awk}, and allow @var{program} to be more
than one line long.
-This format is also useful for running short or medium-sized @code{awk}
+This format is also useful for running short or medium-sized @command{awk}
programs from shell scripts, because it avoids the need for a separate
-file for the @code{awk} program. A self-contained shell script is more
-reliable since there are no other files to misplace.
-
-@ref{One-liners, , Useful One Line Programs}, presents several short,
+file for the @command{awk} program. A self-contained shell script is more
+reliable because there are no other files to misplace.
+
+@ref{Very Simple, ,Some Simple Examples},
+@ifnotinfo
+later in this @value{CHAPTER},
+@end ifnotinfo
+presents several short,
self-contained programs.
+@c Removed for gawk 3.1, doesn't really add anything here.
+@ignore
As an interesting side point, the command
@example
@@ -1230,34 +1699,35 @@ awk '/foo/' @var{files} @dots{}
@noindent
is essentially the same as
-@cindex @code{egrep}
+@cindex @command{egrep} utility
@example
egrep foo @var{files} @dots{}
@end example
+@end ignore
@node Read Terminal, Long, One-shot, Running gawk
-@subsection Running @code{awk} without Input Files
+@subsection Running @command{awk} Without Input Files
@cindex standard input
@cindex input, standard
-You can also run @code{awk} without any input files. If you type the
-command line:
+You can also run @command{awk} without any input files. If you type the
+following command line:
@example
awk '@var{program}'
@end example
@noindent
-then @code{awk} applies the @var{program} to the @dfn{standard input},
+@command{awk} applies the @var{program} to the @dfn{standard input},
which usually means whatever you type on the terminal. This continues
-until you indicate end-of-file by typing @kbd{Control-d}.
+until you indicate end-of-file by typing @kbd{Ctrl-d}.
(On other operating systems, the end-of-file character may be different.
-For example, on OS/2 and MS-DOS, it is @kbd{Control-z}.)
+For example, on OS/2 and MS-DOS, it is @kbd{Ctrl-z}.)
-For example, the following program prints a friendly piece of advice
-(from Douglas Adams' @cite{The Hitchhiker's Guide to the Galaxy}),
-to keep you from worrying about the complexities of computer programming
-(@samp{BEGIN} is a feature we haven't discussed yet).
+As an example, the following program prints a friendly piece of advice
+(from Douglas Adams's @cite{The Hitchhiker's Guide to the Galaxy}),
+to keep you from worrying about the complexities of computer programming.
+(@code{BEGIN} is a feature we haven't discussed yet.):
@example
$ awk "BEGIN @{ print \"Don't Panic!\" @}"
@@ -1267,11 +1737,14 @@ $ awk "BEGIN @{ print \"Don't Panic!\" @}"
@cindex quoting, shell
@cindex shell quoting
This program does not read any input. The @samp{\} before each of the
-inner double quotes is necessary because of the shell's quoting rules,
-in particular because it mixes both single quotes and double quotes.
-
-This next simple @code{awk} program
-emulates the @code{cat} utility; it copies whatever you type at the
+inner double quotes is necessary because of the shell's quoting
+rules---in particular because it mixes both single quotes and
+double quotes.@footnote{Although we generally recommend the use of single
+quotes around the program text, double quotes are needed here in order to
+put the single quote into the message.}
+
+This next simple @command{awk} program
+emulates the @command{cat} utility; it copies whatever you type at the
keyboard to its standard output. (Why this works is explained shortly.)
@example
@@ -1284,7 +1757,7 @@ Four score and seven years ago, ...
@print{} Four score and seven years ago, ...
What, me worry?
@print{} What, me worry?
-@kbd{Control-d}
+@kbd{Ctrl-d}
@end example
@node Long, Executable Scripts, Read Terminal, Running gawk
@@ -1292,18 +1765,19 @@ What, me worry?
@cindex running long programs
@cindex @code{-f} option
+@cindex command-line option, @code{-f}
@cindex program file
-@cindex file, @code{awk} program
-Sometimes your @code{awk} programs can be very long. In this case it is
-more convenient to put the program into a separate file. To tell
-@code{awk} to use that file for its program, you type:
+@cindex file, @command{awk} program
+Sometimes your @command{awk} programs can be very long. In this case, it is
+more convenient to put the program into a separate file. In order to tell
+@command{awk} to use that file for its program, you type:
@example
awk -f @var{source-file} @var{input-file1} @var{input-file2} @dots{}
@end example
-The @samp{-f} instructs the @code{awk} utility to get the @code{awk} program
-from the file @var{source-file}. Any file name can be used for
+The @option{-f} instructs the @command{awk} utility to get the @command{awk} program
+from the file @var{source-file}. Any @value{FN} can be used for
@var{source-file}. For example, you could put the program:
@example
@@ -1327,112 +1801,106 @@ awk "BEGIN @{ print \"Don't Panic!\" @}"
@cindex quoting, shell
@cindex shell quoting
@noindent
-which was explained earlier (@pxref{Read Terminal, ,Running @code{awk} without Input Files}).
-Note that you don't usually need single quotes around the file name that you
-specify with @samp{-f}, because most file names don't contain any of the shell's
-special characters. Notice that in @file{advice}, the @code{awk}
+This was explained earlier
+(@pxref{Read Terminal, ,Running @command{awk} Without Input Files}).
+Note that you don't usually need single quotes around the @value{FN} that you
+specify with @option{-f}, because most @value{FN}s don't contain any of the shell's
+special characters. Notice that in @file{advice}, the @command{awk}
program did not have single quotes around it. The quotes are only needed
-for programs that are provided on the @code{awk} command line.
+for programs that are provided on the @command{awk} command line.
-If you want to identify your @code{awk} program files clearly as such,
-you can add the extension @file{.awk} to the file name. This doesn't
-affect the execution of the @code{awk} program, but it does make
+If you want to identify your @command{awk} program files clearly as such,
+you can add the extension @file{.awk} to the @value{FN}. This doesn't
+affect the execution of the @command{awk} program but it does make
``housekeeping'' easier.
@node Executable Scripts, Comments, Long, Running gawk
-@subsection Executable @code{awk} Programs
+@subsection Executable @command{awk} Programs
@cindex executable scripts
@cindex scripts, executable
-@cindex self contained programs
-@cindex program, self contained
+@cindex self-contained programs
+@cindex program, self-contained
@cindex @code{#!} (executable scripts)
-Once you have learned @code{awk}, you may want to write self-contained
-@code{awk} scripts, using the @samp{#!} script mechanism. You can do
+Once you have learned @command{awk}, you may want to write self-contained
+@command{awk} scripts, using the @samp{#!} script mechanism. You can do
this on many Unix systems@footnote{The @samp{#!} mechanism works on
Linux systems,
-Unix systems derived from Berkeley Unix, System V Release 4, and some System
-V Release 3 systems.} (and someday on the GNU system).
-
+systems derived from the 4.4-Lite Berkeley Software Distribution,
+and most commercial Unix systems.} as well as on the GNU system.
For example, you could update the file @file{advice} to look like this:
@example
#! /bin/awk -f
-BEGIN @{ print "Don't Panic!" @}
+BEGIN @{ print "Don't Panic!" @}
@end example
@noindent
-After making this file executable (with the @code{chmod} utility), you
-can simply type @samp{advice}
-at the shell, and the system will arrange to run @code{awk}@footnote{The
-line beginning with @samp{#!} lists the full file name of an interpreter
-to be run, and an optional initial command line argument to pass to that
+After making this file executable (with the @command{chmod} utility),
+simply type @samp{advice}
+at the shell and the system arranges to run @command{awk}@footnote{The
+line beginning with @samp{#!} lists the full @value{FN} of an interpreter
+to run and an optional initial command-line argument to pass to that
interpreter. The operating system then runs the interpreter with the given
argument and the full argument list of the executed program. The first argument
-in the list is the full file name of the @code{awk} program. The rest of the
-argument list will either be options to @code{awk}, or data files,
-or both.} as if you had typed @samp{awk -f advice}.
+in the list is the full @value{FN} of the @command{awk} program. The rest of the
+argument list is either options to @command{awk}, or @value{DF}s,
+or both.} as if you had
+typed @samp{awk -f advice}:
@example
-@group
+$ chmod +x advice
$ advice
@print{} Don't Panic!
-@end group
@end example
@noindent
-Self-contained @code{awk} scripts are useful when you want to write a
-program which users can invoke without their having to know that the program is
-written in @code{awk}.
-
-@strong{Caution:} You should not put more than one argument on the @samp{#!}
-line after the path to @code{awk}. This will not work. The operating system
-treats the rest of the line as a single agument, and passes it to @code{awk}.
-Doing this will lead to confusing behavior: most likely a usage diagnostic
-of some sort from @code{awk}.
-
-@cindex shell scripts
-@cindex scripts, shell
-Some older systems do not support the @samp{#!} mechanism. You can get a
-similar effect using a regular shell script. It would look something
-like this:
+Self-contained @command{awk} scripts are useful when you want to write a
+program that users can invoke without their having to know that the program is
+written in @command{awk}.
-@example
-: The colon ensures execution by the standard shell.
-awk '@var{program}' "$@@"
-@end example
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Portability Issues with @samp{#!}
+@cindex advanced notes
-Using this technique, it is @emph{vital} to enclose the @var{program} in
-single quotes to protect it from interpretation by the shell. If you
-omit the quotes, only a shell wizard can predict the results.
+Some systems limit the length of the interpreter name to 32 characters.
+Often, this can be dealt with by using a symbolic link.
-The @code{"$@@"} causes the shell to forward all the command line
-arguments to the @code{awk} program, without interpretation. The first
-line, which starts with a colon, is used so that this shell script will
-work even if invoked by a user who uses the C shell. (Not all older systems
-obey this convention, but many do.)
-@c 2e:
-@c Someday: (See @cite{The Bourne Again Shell}, by ??.)
+You should not put more than one argument on the @samp{#!}
+line after the path to @command{awk}. It does not work. The operating system
+treats the rest of the line as a single argument and passes it to @command{awk}.
+Doing this leads to confusing behavior---most likely a usage diagnostic
+of some sort from @command{awk}.
-@node Comments, , Executable Scripts, Running gawk
-@subsection Comments in @code{awk} Programs
+@cindex portability issues
+Finally,
+the value of @code{ARGV[0]}
+(@pxref{Built-in Variables})
+varies depending upon your operating system.
+Some systems put @samp{awk} there, some put the full pathname
+of @command{awk} (such as @file{/bin/awk}), and some put the name
+of your script (@samp{advice}). Don't rely on the value of @code{ARGV[0]}
+to provide your script name.
+
+@node Comments, Quoting, Executable Scripts, Running gawk
+@subsection Comments in @command{awk} Programs
@cindex @code{#} (comment)
@cindex comments
@cindex use of comments
-@cindex documenting @code{awk} programs
+@cindex documenting @command{awk} programs
@cindex programs, documenting
A @dfn{comment} is some text that is included in a program for the sake
-of human readers; it is not really part of the program. Comments
-can explain what the program does, and how it works. Nearly all
-programming languages have provisions for comments, because programs are
-typically hard to understand without their extra help.
+of human readers; it is not really an executable part of the program. Comments
+can explain what the program does and how it works. Nearly all
+programming languages have provisions for comments, as programs are
+typically hard to understand without them.
-In the @code{awk} language, a comment starts with the sharp sign
-character, @samp{#}, and continues to the end of the line.
+In the @command{awk} language, a comment starts with the sharp sign
+character (@samp{#}) and continues to the end of the line.
The @samp{#} does not have to be the first character on the line. The
-@code{awk} language ignores the rest of a line following a sharp sign.
+@command{awk} language ignores the rest of a line following a sharp sign.
For example, we could have put the following into @file{advice}:
@example
@@ -1441,72 +1909,310 @@ For example, we could have put the following into @file{advice}:
BEGIN @{ print "Don't Panic!" @}
@end example
-You can put comment lines into keyboard-composed throw-away @code{awk}
-programs also, but this usually isn't very useful; the purpose of a
-comment is to help you or another person understand the program at
-a later time.
+You can put comment lines into keyboard-composed throw-away @command{awk}
+programs, but this usually isn't very useful; the purpose of a
+comment is to help you or another person understand the program
+when reading it at a later time.
+@cindex quoting, shell
+@cindex shell quoting
@strong{Caution:} As mentioned in
-@ref{One-shot, ,One-shot Throw-away @code{awk} Programs},
+@ref{One-shot, ,One-Shot Throw-Away @command{awk} Programs},
you can enclose small to medium programs in single quotes, in order to keep
your shell scripts self-contained. When doing so, @emph{don't} put
an apostrophe (i.e., a single quote) into a comment (or anywhere else
-in your program). The shell will interpret the quote as the closing
-quote for the entire program. As a result, usually the shell will
-print a message about mismatched quotes, and if @code{awk} actually
+in your program). The shell interprets the quote as the closing
+quote for the entire program. As a result, usually the shell
+prints a message about mismatched quotes, and if @command{awk} actually
runs, it will probably print strange messages about syntax errors.
-For example:
+For example, look at the following:
+
+@example
+$ awk '@{ print "hello" @} # let's be cute'
+>
+@end example
+
+The shell sees that the first two quotes match, and that
+a new quoted object begins at the end of the command-line.
+It therefore prompts with the secondary prompt, waiting for more input.
+With Unix @command{awk}, closing the quoted string produces this result:
+
+@example
+$ awk '@{ print "hello" @} # let's be cute'
+> '
+@error{} awk: can't open file be
+@error{} source line number 1
+@end example
+
+Putting a backslash before the single quote in @samp{let's} wouldn't help,
+since backslashes are not special inside single quotes.
+The next @value{SUBSECTION} describes the shell's quoting rules.
+
+@node Quoting, , Comments, Running gawk
+@subsection Shell Quoting Issues
+@c the indexing here is purposely different, until we
+@c get a way to mark the defining instance for an index entry
+@cindex quoting rules, shell
+@cindex shell quoting rules
+
+For short to medium length @command{awk} programs, it is most convenient
+to enter the program on the @command{awk} command line.
+This is best done by enclosing the entire program in single quotes.
+This is true whether you are entering the program interactively at
+the shell prompt, or writing it as part of a larger shell script:
@example
-awk 'BEGIN @{ print "hello" @} # let's be cute'
+awk '@var{program text}' @var{input-file1} @var{input-file2} @dots{}
@end example
-@node Very Simple, Two Rules, Running gawk, Getting Started
-@section A Very Simple Example
+@cindex @command{csh} utility
+Once you are working with the shell, it is helpful to have a basic
+knowledge of shell quoting rules. The following rules apply only to
+POSIX-compliant, Bourne-style shells (such as @command{bash}, the GNU Bourne-Again
+Shell). If you use @command{csh}, you're on your own.
+
+@itemize @bullet
+@item
+Quoted items can be concatenated with nonquoted items as well as with other
+quoted items. The shell turns everything into one argument for
+the command.
+
+@item
+Preceding any single character with a backslash (@samp{\}) quotes
+that character. The shell removes the backslash and passes the quoted
+character on to the command.
-The following command runs a simple @code{awk} program that searches the
-input file @file{BBS-list} for the string of characters: @samp{foo}. (A
+@item
+Single quotes protect everything between the opening and closing quotes.
+The shell does no interpretation of the quoted text, passing it on verbatim
+to the command.
+It is @emph{impossible} to embed a single quote inside single-quoted text.
+Refer back to
+@ref{Comments, ,Comments in @command{awk} Programs},
+for an example showing what happens if you try.
+
+@item
+Double quotes protect most things between the opening and closing quotes.
+The shell does at least variable and command substitution on the quoted text.
+Different shells may do additional kinds of processing on double-quoted text.
+
+Since certain characters within double-quoted text are processed by the shell,
+they must be @dfn{escaped} within the text. Of note are the characters
+@samp{$}, @samp{`}, @samp{\} and @samp{"}, all of which must be preceded by
+a backslash within double-quoted text if they are to be passed on literally
+to the program. (The leading backslash is stripped first.)
+Thus, the example seen
+@ifnotinfo
+previously
+@end ifnotinfo
+in @ref{Read Terminal, ,Running @command{awk} Without Input Files},
+is applicable:
+
+@example
+$ awk "BEGIN @{ print \"Don't Panic!\" @}"
+@print{} Don't Panic!
+@end example
+
+Note that the single quote is not special within double quotes.
+
+@item
+Null strings are removed when they occur as part of a non-null
+command-line argument, while explicit non-null objects are kept.
+For example, to specify that the field separator @code{FS} should
+be set to the null string, use:
+
+@example
+awk -F "" '@var{program}' @var{files} # correct
+@end example
+
+@noindent
+Don't use this:
+
+@example
+awk -F"" '@var{program}' @var{files} # wrong!
+@end example
+
+@noindent
+In the second case, @command{awk} will attempt to use the text of the program
+as the value of @code{FS}, and the first @value{FN} as the text of the program!
+This results in syntax errors at best, and confusing behavior at worst.
+@end itemize
+
+@cindex shell quoting, tricks
+Mixing single and double quotes is difficult. You have to resort
+to shell quoting tricks, like this:
+
+@example
+$ awk 'BEGIN @{ print "Here is a single quote <'"'"'>" @}'
+@print{} Here is a single quote <'>
+@end example
+
+@noindent
+This program consists of three concatenated quoted strings. The first and the
+third are single-quoted, the second is double-quoted.
+
+This can be ``simplified'' to:
+
+@example
+$ awk 'BEGIN @{ print "Here is a single quote <'\''>" @}'
+@print{} Here is a single quote <'>
+@end example
+
+@noindent
+Judge for yourself which of these two is the more readable.
+
+Another option is to use double quotes, escaping the embedded, @command{awk}-level
+double quotes:
+
+@example
+$ awk "BEGIN @{ print \"Here is a single quote <'>\" @}"
+@print{} Here is a single quote <'>
+@end example
+
+@noindent
+This option is also painful, because double quotes, backslashes, and dollar signs
+are very common in @command{awk} programs.
+
+If you really need both single and double quotes in your @command{awk}
+program, it is probably best to move it into a separate file, where
+the shell won't be part of the picture, and you can say what you mean.
+
+@node Sample Data Files, Very Simple, Running gawk, Getting Started
+@section @value{DDF}s for the Examples
+@c For gawk >= 3.2, update these data files. No-one has such slow modems!
+
+@cindex input file, sample
+@cindex sample input files
+@cindex @file{BBS-list} file
+Many of the examples in this @value{DOCUMENT} take their input from two sample
+@value{DF}s. The first, called @file{BBS-list}, represents a list of
+computer bulletin board systems together with information about those systems.
+The second @value{DF}, called @file{inventory-shipped}, contains
+information about monthly shipments. In both files,
+each line is considered to be one @dfn{record}.
+
+In the file @file{BBS-list}, each record contains the name of a computer
+bulletin board, its phone number, the board's baud rate(s), and a code for
+the number of hours it is operational. An @samp{A} in the last column
+means the board operates 24 hours a day. A @samp{B} in the last
+column means the board only operates on evening and weekend hours.
+A @samp{C} means the board operates only on weekends:
+
+@c 2e: Update the baud rates to reflect today's faster modems
+@example
+@c system if test ! -d eg ; then mkdir eg ; fi
+@c system if test ! -d eg/lib ; then mkdir eg/lib ; fi
+@c system if test ! -d eg/data ; then mkdir eg/data ; fi
+@c system if test ! -d eg/prog ; then mkdir eg/prog ; fi
+@c system if test ! -d eg/misc ; then mkdir eg/misc ; fi
+@c file eg/data/BBS-list
+aardvark 555-5553 1200/300 B
+alpo-net 555-3412 2400/1200/300 A
+barfly 555-7685 1200/300 A
+bites 555-1675 2400/1200/300 A
+camelot 555-0542 300 C
+core 555-2912 1200/300 C
+fooey 555-1234 2400/1200/300 B
+foot 555-6699 1200/300 B
+macfoo 555-6480 1200/300 A
+sdace 555-3430 2400/1200/300 A
+sabafoo 555-2127 1200/300 C
+@c endfile
+@end example
+
+@cindex @file{inventory-shipped} file
+The second @value{DF}, called @file{inventory-shipped}, represents
+information about shipments during the year.
+Each record contains the month, the number
+of green crates shipped, the number of red boxes shipped, the number of
+orange bags shipped, and the number of blue packages shipped,
+respectively. There are 16 entries, covering the 12 months of last year
+and the first four months of the current year.
+
+@example
+@c file eg/data/inventory-shipped
+Jan 13 25 15 115
+Feb 15 32 24 226
+Mar 15 24 34 228
+Apr 31 52 63 420
+May 16 34 29 208
+Jun 31 42 75 492
+Jul 24 34 67 436
+Aug 15 34 47 316
+Sep 13 55 37 277
+Oct 29 54 68 525
+Nov 20 87 82 577
+Dec 17 35 61 401
+
+Jan 21 36 64 620
+Feb 26 58 80 652
+Mar 24 75 70 495
+Apr 21 70 74 514
+@c endfile
+@end example
+
+@ifinfo
+If you are reading this in GNU Emacs using Info, you can copy the regions
+of text showing these sample files into your own test files. This way you
+can try out the examples shown in the remainder of this document. You do
+this by using the command @kbd{M-x write-region} to copy text from the Info
+file into a file for use with @command{awk}
+(@xref{Misc File Ops, , Miscellaneous File Operations, emacs, GNU Emacs Manual},
+for more information). Using this information, create your own
+@file{BBS-list} and @file{inventory-shipped} files and practice what you
+learn in this @value{DOCUMENT}.
+
+@cindex Texinfo
+If you are using the stand-alone version of Info,
+see @ref{Extract Program, ,Extracting Programs from Texinfo Source Files},
+for an @command{awk} program that extracts these @value{DF}s from
+@file{gawk.texi}, the Texinfo source file for this Info file.
+@end ifinfo
+
+@node Very Simple, Two Rules, Sample Data Files, Getting Started
+@section Some Simple Examples
+
+The following command runs a simple @command{awk} program that searches the
+input file @file{BBS-list} for the character string @samp{foo}. (A
string of characters is usually called a @dfn{string}.
-The term @dfn{string} is perhaps based on similar usage in English, such
-as ``a string of pearls,'' or, ``a string of cars in a train.'')
+The term @dfn{string} is based on similar usage in English, such
+as ``a string of pearls,'' or, ``a string of cars in a train.''):
@example
awk '/foo/ @{ print $0 @}' BBS-list
@end example
@noindent
-When lines containing @samp{foo} are found, they are printed, because
+When lines containing @samp{foo} are found, they are printed because
@w{@samp{print $0}} means print the current line. (Just @samp{print} by
itself means the same thing, so we could have written that
instead.)
-You will notice that slashes, @samp{/}, surround the string @samp{foo}
-in the @code{awk} program. The slashes indicate that @samp{foo}
-is a pattern to search for. This type of pattern is called a
-@dfn{regular expression}, and is covered in more detail later
+You will notice that slashes (@samp{/}) surround the string @samp{foo}
+in the @command{awk} program. The slashes indicate that @samp{foo}
+is the pattern to search for. This type of pattern is called a
+@dfn{regular expression}, which is covered in more detail later
(@pxref{Regexp, ,Regular Expressions}).
The pattern is allowed to match parts of words.
There are
-single-quotes around the @code{awk} program so that the shell won't
+single quotes around the @command{awk} program so that the shell won't
interpret any of it as special shell characters.
Here is what this program prints:
@example
-@group
$ awk '/foo/ @{ print $0 @}' BBS-list
@print{} fooey 555-1234 2400/1200/300 B
@print{} foot 555-6699 1200/300 B
@print{} macfoo 555-6480 1200/300 A
@print{} sabafoo 555-2127 1200/300 C
-@end group
@end example
@cindex action, default
@cindex pattern, default
@cindex default action
@cindex default pattern
-In an @code{awk} rule, either the pattern or the action can be omitted,
+In an @command{awk} rule, either the pattern or the action can be omitted,
but not both. If the pattern is omitted, then the action is performed
for @emph{every} input line. If the action is omitted, the default
action is to print all lines that match the pattern.
@@ -1514,28 +2220,133 @@ action is to print all lines that match the pattern.
@cindex empty action
@cindex action, empty
Thus, we could leave out the action (the @code{print} statement and the curly
-braces) in the above example, and the result would be the same: all
-lines matching the pattern @samp{foo} would be printed. By comparison,
+braces) in the above example and the result would be the same: all
+lines matching the pattern @samp{foo} are printed. By comparison,
omitting the @code{print} statement but retaining the curly braces makes an
-empty action that does nothing; then no lines would be printed.
+empty action that does nothing (i.e., no lines are printed).
+
+@cindex one-liners
+Many practical @command{awk} programs are just a line or two. Following is a
+collection of useful, short programs to get you started. Some of these
+programs contain constructs that haven't been covered yet. (The description
+of the program will give you a good idea of what is going on, but please
+read the rest of the @value{DOCUMENT} to become an @command{awk} expert!)
+Most of the examples use a @value{DF} named @file{data}. This is just a
+placeholder; if you use these programs yourself, substitute
+your own @value{FN}s for @file{data}.
+For future reference, note that there is often more than
+one way to do things in @command{awk}. At some point, you may want
+to look back at these examples and see if
+you can come up with different ways to do the same things shown here:
+
+@itemize @bullet
+@item
+Print the length of the longest input line:
+
+@example
+awk '@{ if (length($0) > max) max = length($0) @}
+ END @{ print max @}' data
+@end example
+
+@item
+Print every line that is longer than 80 characters:
+
+@example
+awk 'length($0) > 80' data
+@end example
+
+The sole rule has a relational expression as its pattern and it has no
+action---so the default action, printing the record, is used.
+
+@cindex @command{expand} utility
+@item
+Print the length of the longest line in @file{data}:
+
+@example
+expand data | awk '@{ if (x < length()) x = length() @}
+ END @{ print "maximum line length is " x @}'
+@end example
+
+The input is processed by the @command{expand} utility to change tabs
+into spaces, so the widths compared are actually the right-margin columns.
+
+@item
+Print every line that has at least one field:
+
+@example
+awk 'NF > 0' data
+@end example
+
+This is an easy way to delete blank lines from a file (or rather, to
+create a new file similar to the old file but from which the blank lines
+have been removed).
+
+@item
+Print seven random numbers from 0 to 100, inclusive:
+
+@example
+awk 'BEGIN @{ for (i = 1; i <= 7; i++)
+ print int(101 * rand()) @}'
+@end example
+
+@item
+Print the total number of bytes used by @var{files}:
+
+@example
+ls -l @var{files} | awk '@{ x += $5 @}
+ END @{ print "total bytes: " x @}'
+@end example
+
+@item
+Print the total number of kilobytes used by @var{files}:
+
+@c Don't use \ continuation, not discussed yet
+@example
+ls -l @var{files} | awk '@{ x += $5 @}
+ END @{ print "total K-bytes: " (x + 1023)/1024 @}'
+@end example
+
+@item
+Print a sorted list of the login names of all users:
+
+@example
+awk -F: '@{ print $1 @}' /etc/passwd | sort
+@end example
+
+@item
+Count lines in a file:
+
+@example
+awk 'END @{ print NR @}' data
+@end example
+
+@item
+Print the even-numbered lines in the @value{DF}:
+
+@example
+awk 'NR % 2 == 0' data
+@end example
+
+If you use the expression @samp{NR % 2 == 1} instead,
+it would print the odd-numbered lines.
+@end itemize
@node Two Rules, More Complex, Very Simple, Getting Started
@section An Example with Two Rules
-@cindex how @code{awk} works
+@cindex how @command{awk} works
-The @code{awk} utility reads the input files one line at a
-time. For each line, @code{awk} tries the patterns of each of the rules.
-If several patterns match then several actions are run, in the order in
-which they appear in the @code{awk} program. If no patterns match, then
+The @command{awk} utility reads the input files one line at a
+time. For each line, @command{awk} tries the patterns of each of the rules.
+If several patterns match, then several actions are run in the order in
+which they appear in the @command{awk} program. If no patterns match, then
no actions are run.
-After processing all the rules (perhaps none) that match the line,
-@code{awk} reads the next line (however,
+After processing all the rules that match the line (and perhaps there are none),
+@command{awk} reads the next line. (However,
@pxref{Next Statement, ,The @code{next} Statement},
-and also @pxref{Nextfile Statement, ,The @code{nextfile} Statement}).
+and also @pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
This continues until the end of the file is reached.
-
-For example, the @code{awk} program:
+For example, the following @command{awk} program contains two rules:
@example
/12/ @{ print $0 @}
@@ -1543,16 +2354,16 @@ For example, the @code{awk} program:
@end example
@noindent
-contains two rules. The first rule has the string @samp{12} as the
+The first rule has the string @samp{12} as the
pattern and @samp{print $0} as the action. The second rule has the
string @samp{21} as the pattern and also has @samp{print $0} as the
action. Each rule's action is enclosed in its own pair of braces.
-This @code{awk} program prints every line that contains the string
+This program prints every line that contains the string
@samp{12} @emph{or} the string @samp{21}. If a line contains both
strings, it is printed twice, once by each rule.
-This is what happens if we run this program on our two sample data files,
+This is what happens if we run this program on our two sample @value{DF}s,
@file{BBS-list} and @file{inventory-shipped}, as shown here:
@example
@@ -1574,53 +2385,51 @@ $ awk '/12/ @{ print $0 @}
@end example
@noindent
-Note how the line in @file{BBS-list} beginning with @samp{sabafoo}
-was printed twice, once for each rule.
+Note how the line beginning with @samp{sabafoo}
+in @file{BBS-list} was printed twice, once for each rule.
@node More Complex, Statements/Lines, Two Rules, Getting Started
@section A More Complex Example
-@ignore
-We have to use ls -lg here to get portable output across Unix systems.
-The POSIX ls matches this behavior too. Sigh.
-@end ignore
-Here is an example to give you an idea of what typical @code{awk}
-programs do. This example shows how @code{awk} can be used to
+Now that we've mastered some simple tasks, let's look at
+what typical @command{awk}
+programs do. This example shows how @command{awk} can be used to
summarize, select, and rearrange the output of another utility. It uses
features that haven't been covered yet, so don't worry if you don't
-understand all the details.
+understand all the details:
@example
-ls -lg | awk '$6 == "Nov" @{ sum += $5 @}
+ls -l | awk '$6 == "Nov" @{ sum += $5 @}
END @{ print sum @}'
@end example
-@cindex @code{csh}, backslash continuation
-@cindex backslash continuation in @code{csh}
+@cindex @command{csh} utility
+@cindex @command{csh}, backslash continuation
+@cindex backslash continuation, in @command{csh}
+@cindex @command{ls} utility
This command prints the total number of bytes in all the files in the
current directory that were last modified in November (of any year).
-(In the C shell you would need to type a semicolon and then a backslash
-at the end of the first line; in a POSIX-compliant shell, such as the
-Bourne shell or Bash, the GNU Bourne-Again shell, you can type the example
-as shown.)
-@ignore
-FIXME: how can users tell what shell they are running? Need a footnote
-or something, but getting into this is a distraction.
-@end ignore
-
-The @w{@samp{ls -lg}} part of this example is a system command that gives
-you a listing of the files in a directory, including file size and the date
+@footnote{In the C shell (@command{csh}), you need to type
+a semicolon and then a backslash at the end of the first line; see
+@ref{Statements/Lines, ,@command{awk} Statements Versus Lines}, for an
+explanation as to why. In a POSIX-compliant shell, such as the Bourne
+shell or @command{bash}, you can type the example as shown. If the command
+@samp{echo $path} produces an empty output line, you are most likely
+using a POSIX-compliant shell. Otherwise, you are probably using the
+C shell or a shell derived from it.}
+The @w{@samp{ls -l}} part of this example is a system command that gives
+you a listing of the files in a directory, including each file's size and the date
the file was last modified. Its output looks like this:
@example
-rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile
--rw-r--r-- 1 arnold user 10809 Nov 7 13:03 gawk.h
--rw-r--r-- 1 arnold user 983 Apr 13 12:14 gawk.tab.h
--rw-r--r-- 1 arnold user 31869 Jun 15 12:20 gawk.y
--rw-r--r-- 1 arnold user 22414 Nov 7 13:03 gawk1.c
--rw-r--r-- 1 arnold user 37455 Nov 7 13:03 gawk2.c
--rw-r--r-- 1 arnold user 27511 Dec 9 13:07 gawk3.c
--rw-r--r-- 1 arnold user 7989 Nov 7 13:03 gawk4.c
+-rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h
+-rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h
+-rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awk.y
+-rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c
+-rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c
+-rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c
+-rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c
@end example
@noindent
@@ -1630,37 +2439,38 @@ the file. The fourth field identifies the group of the file.
The fifth field contains the size of the file in bytes. The
sixth, seventh and eighth fields contain the month, day, and time,
respectively, that the file was last modified. Finally, the ninth field
-contains the name of the file.
+contains the name of the file.@footnote{On some
+very old systems, you may need to use @samp{ls -lg} to get this output.}
@cindex automatic initialization
@cindex initialization, automatic
-The @samp{$6 == "Nov"} in our @code{awk} program is an expression that
-tests whether the sixth field of the output from @w{@samp{ls -lg}}
+The @samp{$6 == "Nov"} in our @command{awk} program is an expression that
+tests whether the sixth field of the output from @w{@samp{ls -l}}
matches the string @samp{Nov}. Each time a line has the string
@samp{Nov} for its sixth field, the action @samp{sum += $5} is
-performed. This adds the fifth field (the file size) to the variable
-@code{sum}. As a result, when @code{awk} has finished reading all the
-input lines, @code{sum} is the sum of the sizes of files whose
-lines matched the pattern. (This works because @code{awk} variables
+performed. This adds the fifth field (the file's size) to the variable
+@code{sum}. As a result, when @command{awk} has finished reading all the
+input lines, @code{sum} is the total of the sizes of the files whose
+lines matched the pattern. (This works because @command{awk} variables
are automatically initialized to zero.)
-After the last line of output from @code{ls} has been processed, the
-@code{END} rule is executed, and the value of @code{sum} is
-printed. In this example, the value of @code{sum} would be 80600.
+After the last line of output from @command{ls} has been processed, the
+@code{END} rule executes and prints the value of @code{sum}.
+In this example, the value of @code{sum} is 140963.
-These more advanced @code{awk} techniques are covered in later sections
-(@pxref{Action Overview, ,Overview of Actions}). Before you can move on to more
-advanced @code{awk} programming, you have to know how @code{awk} interprets
+These more advanced @command{awk} techniques are covered in later sections
+(@pxref{Action Overview, ,Actions}). Before you can move on to more
+advanced @command{awk} programming, you have to know how @command{awk} interprets
your input and displays your output. By manipulating fields and using
@code{print} statements, you can produce some very useful and impressive
looking reports.
@node Statements/Lines, Other Features, More Complex, Getting Started
-@section @code{awk} Statements Versus Lines
+@section @command{awk} Statements Versus Lines
@cindex line break
@cindex newline
-Most often, each line in an @code{awk} program is a separate statement or
+Most often, each line in an @command{awk} program is a separate statement or
separate rule, like this:
@example
@@ -1668,27 +2478,30 @@ awk '/12/ @{ print $0 @}
/21/ @{ print $0 @}' BBS-list inventory-shipped
@end example
-However, @code{gawk} will ignore newlines after any of the following:
+However, @command{gawk} ignores newlines after any of the following
+symbols and keywords:
@example
, @{ ? : || && do else
@end example
@noindent
-A newline at any other point is considered the end of the statement.
-(Splitting lines after @samp{?} and @samp{:} is a minor @code{gawk}
-extension. The @samp{?} and @samp{:} referred to here is the
-three operand conditional expression described in
-@ref{Conditional Exp, ,Conditional Expressions}.)
+A newline at any other point is considered the end of the
+statement.@footnote{The @samp{?} and @samp{:} referred to here is the
+three-operand conditional expression described in
+@ref{Conditional Exp, ,Conditional Expressions}.
+Splitting lines after @samp{?} and @samp{:} is a minor @command{gawk}
+extension; if @option{--posix} is specified
+(@pxref{Options, , Command-Line Options}), then this extension is disabled.}
@cindex backslash continuation
@cindex continuation of lines
@cindex line continuation
If you would like to split a single statement into two lines at a point
where a newline would terminate it, you can @dfn{continue} it by ending the
-first line with a backslash character, @samp{\}. The backslash must be
-the final character on the line to be recognized as a continuation
-character. This is allowed absolutely anywhere in the statement, even
+first line with a backslash character (@samp{\}). The backslash must be
+the final character on the line in order to be recognized as a continuation
+character. A backslash is allowed anywhere in the statement, even
in the middle of a string or regular expression. For example:
@example
@@ -1699,26 +2512,28 @@ awk '/This regular expression is too long, so continue it\
@noindent
@cindex portability issues
We have generally not used backslash continuation in the sample programs
-in this @value{DOCUMENT}. Since in @code{gawk} there is no limit on the
-length of a line, it is never strictly necessary; it just makes programs
-more readable. For this same reason, as well as for clarity, we have
-kept most statements short in the sample programs presented throughout
-the @value{DOCUMENT}. Backslash continuation is most useful when your
-@code{awk} program is in a separate source file, instead of typed in on
-the command line. You should also note that many @code{awk}
-implementations are more particular about where you may use backslash
-continuation. For example, they may not allow you to split a string
-constant using backslash continuation. Thus, for maximal portability of
-your @code{awk} programs, it is best not to split your lines in the
-middle of a regular expression or a string.
-
-@cindex @code{csh}, backslash continuation
-@cindex backslash continuation in @code{csh}
-@strong{Caution: backslash continuation does not work as described above
-with the C shell.} Continuation with backslash works for @code{awk}
-programs in files, and also for one-shot programs @emph{provided} you
-are using a POSIX-compliant shell, such as the Bourne shell or Bash, the
-GNU Bourne-Again shell. But the C shell (@code{csh}) behaves
+in this @value{DOCUMENT}. In @command{gawk}, there is no limit on the
+length of a line, so backslash continuation is never strictly necessary;
+it just makes programs more readable. For this same reason, as well as
+for clarity, we have kept most statements short in the sample programs
+presented throughout the @value{DOCUMENT}. Backslash continuation is
+most useful when your @command{awk} program is in a separate source file
+instead of entered from the command line. You should also note that
+many @command{awk} implementations are more particular about where you
+may use backslash continuation. For example, they may not allow you to
+split a string constant using backslash continuation. Thus, for maximum
+portability of your @command{awk} programs, it is best not to split your
+lines in the middle of a regular expression or a string.
+@c 10/2000: gawk, mawk, and current bell labs awk allow it,
+@c solaris 2.7 nawk does not. Solaris /usr/xpg4/bin/awk does though! sigh.
+
+@cindex @command{csh} utility
+@cindex @command{csh}, backslash continuation
+@cindex backslash continuation, in @command{csh}
+@strong{Caution:} @emph{Backslash continuation does not work as described
+above with the C shell.} It works for @command{awk} programs in files and
+for one-shot programs, @emph{provided} you are using a POSIX-compliant
+shell, such as the Unix Bourne shell or @command{bash}. But the C shell behaves
differently! There, you must use two backslashes in a row, followed by
a newline. Note also that when using the C shell, @emph{every} newline
in your awk program must be escaped with a backslash. To illustrate:
@@ -1735,185 +2550,117 @@ in your awk program must be escaped with a backslash. To illustrate:
Here, the @samp{%} and @samp{?} are the C shell's primary and secondary
prompts, analogous to the standard shell's @samp{$} and @samp{>}.
-@code{awk} is a line-oriented language. Each rule's action has to
+Compare the previous example to how it is done with a POSIX-compliant shell:
+
+@example
+$ awk 'BEGIN @{
+> print \
+> "hello, world"
+> @}'
+@print{} hello, world
+@end example
+
+@command{awk} is a line-oriented language. Each rule's action has to
begin on the same line as the pattern. To have the pattern and action
-on separate lines, you @emph{must} use backslash continuation---there
+on separate lines, you @emph{must} use backslash continuation; there
is no other way.
-@cindex backslash continuation and comments
+@cindex backslash continuation, and comments
@cindex comments and backslash continuation
-Note that backslash continuation and comments do not mix. As soon
-as @code{awk} sees the @samp{#} that starts a comment, it ignores
-@emph{everything} on the rest of the line. For example:
+Another thing to keep in mind is that backslash continuation and
+comments do not mix. As soon as @command{awk} sees the @samp{#} that
+starts a comment, it ignores @emph{everything} on the rest of the
+line. For example:
@example
-@group
$ gawk 'BEGIN @{ print "dont panic" # a friendly \
> BEGIN rule
> @}'
@error{} gawk: cmd. line:2: BEGIN rule
@error{} gawk: cmd. line:2: ^ parse error
-@end group
@end example
@noindent
-Here, it looks like the backslash would continue the comment onto the
+In this case, it looks like the backslash would continue the comment onto the
next line. However, the backslash-newline combination is never even
-noticed, since it is ``hidden'' inside the comment. Thus, the
-@samp{BEGIN} is noted as a syntax error.
+noticed because it is ``hidden'' inside the comment. Thus, the
+@code{BEGIN} is noted as a syntax error.
@cindex multiple statements on one line
-When @code{awk} statements within one rule are short, you might want to put
-more than one of them on a line. You do this by separating the statements
-with a semicolon, @samp{;}.
-
+When @command{awk} statements within one rule are short, you might want to put
+more than one of them on a line. This is accomplished by separating the statements
+with a semicolon (@samp{;}).
This also applies to the rules themselves.
-Thus, the previous program could have been written:
+Thus, the program shown at the start of this @value{SECTION}
+could also be written this way:
@example
/12/ @{ print $0 @} ; /21/ @{ print $0 @}
@end example
@noindent
-@strong{Note:} the requirement that rules on the same line must be
-separated with a semicolon was not in the original @code{awk}
+@strong{Note:} The requirement that states that rules on the same line must be
+separated with a semicolon was not in the original @command{awk}
language; it was added for consistency with the treatment of statements
within an action.
@node Other Features, When, Statements/Lines, Getting Started
-@section Other Features of @code{awk}
+@section Other Features of @command{awk}
-The @code{awk} language provides a number of predefined, or built-in variables, which
-your programs can use to get information from @code{awk}. There are other
-variables your program can set to control how @code{awk} processes your
-data.
+The @command{awk} language provides a number of predefined, or
+@dfn{built-in}, variables that your programs can use to get information
+from @command{awk}. There are other variables your program can set
+as well to control how @command{awk} processes your data.
-In addition, @code{awk} provides a number of built-in functions for doing
+In addition, @command{awk} provides a number of built-in functions for doing
common computational and string related operations.
+@command{gawk} provides built-in functions for working with timestamps,
+performing bit manipulation, and for runtime string translation.
-As we develop our presentation of the @code{awk} language, we introduce
+As we develop our presentation of the @command{awk} language, we introduce
most of the variables and many of the functions. They are defined
systematically in @ref{Built-in Variables}, and
@ref{Built-in, ,Built-in Functions}.
-@node When, , Other Features, Getting Started
-@section When to Use @code{awk}
+@node When, , Other Features, Getting Started
+@section When to Use @command{awk}
-@cindex when to use @code{awk}
-@cindex applications of @code{awk}
-You might wonder how @code{awk} might be useful for you. Using
+@cindex uses of @command{awk}
+@cindex applications of @command{awk}
+Now that you've seen some of what @command{awk} can do,
+you might wonder how @command{awk} could be useful for you. By using
utility programs, advanced patterns, field separators, arithmetic
statements, and other selection criteria, you can produce much more
-complex output. The @code{awk} language is very useful for producing
+complex output. The @command{awk} language is very useful for producing
reports from large amounts of raw data, such as summarizing information
-from the output of other utility programs like @code{ls}.
+from the output of other utility programs like @command{ls}.
(@xref{More Complex, ,A More Complex Example}.)
-Programs written with @code{awk} are usually much smaller than they would
-be in other languages. This makes @code{awk} programs easy to compose and
-use. Often, @code{awk} programs can be quickly composed at your terminal,
-used once, and thrown away. Since @code{awk} programs are interpreted, you
+Programs written with @command{awk} are usually much smaller than they would
+be in other languages. This makes @command{awk} programs easy to compose and
+use. Often, @command{awk} programs can be quickly composed at your terminal,
+used once, and thrown away. Because @command{awk} programs are interpreted, you
can avoid the (usually lengthy) compilation part of the typical
edit-compile-test-debug cycle of software development.
-Complex programs have been written in @code{awk}, including a complete
+Complex programs have been written in @command{awk}, including a complete
retargetable assembler for eight-bit microprocessors (@pxref{Glossary}, for
-more information) and a microcode assembler for a special purpose Prolog
-computer. However, @code{awk}'s capabilities are strained by tasks of
+more information), and a microcode assembler for a special purpose Prolog
+computer. However, @command{awk}'s capabilities are strained by tasks of
such complexity.
-If you find yourself writing @code{awk} scripts of more than, say, a few
+If you find yourself writing @command{awk} scripts of more than, say, a few
hundred lines, you might consider using a different programming
language. Emacs Lisp is a good choice if you need sophisticated string
or pattern matching capabilities. The shell is also good at string and
pattern matching; in addition, it allows powerful use of the system
-utilities. More conventional languages, such as C, C++, and Lisp, offer
+utilities. More conventional languages, such as C, C++, and Java, offer
better facilities for system programming and for managing the complexity
of large programs. Programs in these languages may require more lines
-of source code than the equivalent @code{awk} programs, but they are
+of source code than the equivalent @command{awk} programs, but they are
easier to maintain and usually run more efficiently.
-@node One-liners, Regexp, Getting Started, Top
-@chapter Useful One Line Programs
-
-@cindex one-liners
-Many useful @code{awk} programs are short, just a line or two. Here is a
-collection of useful, short programs to get you started. Some of these
-programs contain constructs that haven't been covered yet. The description
-of the program will give you a good idea of what is going on, but please
-read the rest of the @value{DOCUMENT} to become an @code{awk} expert!
-
-Most of the examples use a data file named @file{data}. This is just a
-placeholder; if you were to use these programs yourself, you would substitute
-your own file names for @file{data}.
-
-@ifinfo
-Since you are reading this in Info, each line of the example code is
-enclosed in quotes, to represent text that you would type literally.
-The examples themselves represent shell commands that use single quotes
-to keep the shell from interpreting the contents of the program.
-When reading the examples, focus on the text between the open and close
-quotes.
-@end ifinfo
-
-@table @code
-@item awk '@{ if (length($0) > max) max = length($0) @}
-@itemx @ @ @ @ @ END @{ print max @}' data
-This program prints the length of the longest input line.
-
-@item awk 'length($0) > 80' data
-This program prints every line that is longer than 80 characters. The sole
-rule has a relational expression as its pattern, and has no action (so the
-default action, printing the record, is used).
-
-@item expand@ data@ |@ awk@ '@{ if (x < length()) x = length() @}
-@itemx @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ END @{ print "maximum line length is " x @}'
-This program prints the length of the longest line in @file{data}. The input
-is processed by the @code{expand} program to change tabs into spaces,
-so the widths compared are actually the right-margin columns.
-
-@item awk 'NF > 0' data
-This program prints every line that has at least one field. This is an
-easy way to delete blank lines from a file (or rather, to create a new
-file similar to the old file but from which the blank lines have been
-deleted).
-
-@c Karl Berry points out that new users probably don't want to see
-@c multiple ways to do things, just the `best' way. He's probably
-@c right. At some point it might be worth adding something about there
-@c often being multiple ways to do things in awk, but for now we'll
-@c just take this one out.
-@ignore
-@item awk '@{ if (NF > 0) print @}' data
-This program also prints every line that has at least one field. Here we
-allow the rule to match every line, and then decide in the action whether
-to print.
-@end ignore
-
-@item awk@ 'BEGIN@ @{@ for (i = 1; i <= 7; i++)
-@itemx @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ print int(101 * rand()) @}'
-This program prints seven random numbers from zero to 100, inclusive.
-
-@item ls -lg @var{files} | awk '@{ x += $5 @} ; END @{ print "total bytes: " x @}'
-This program prints the total number of bytes used by @var{files}.
-
-@item ls -lg @var{files} | awk '@{ x += $5 @}
-@itemx @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ @ END @{ print "total K-bytes: " (x + 1023)/1024 @}'
-This program prints the total number of kilobytes used by @var{files}.
-
-@item awk -F: '@{ print $1 @}' /etc/passwd | sort
-This program prints a sorted list of the login names of all users.
-
-@item awk 'END @{ print NR @}' data
-This program counts lines in a file.
-
-@item awk 'NR % 2 == 0' data
-This program prints the even numbered lines in the data file.
-If you were to use the expression @samp{NR % 2 == 1} instead,
-it would print the odd numbered lines.
-@end table
-
-@node Regexp, Reading Files, One-liners, Top
+@node Regexp, Reading Files, Getting Started, Top
@chapter Regular Expressions
@cindex pattern, regular expressions
@cindex regexp
@@ -1922,29 +2669,30 @@ it would print the odd numbered lines.
A @dfn{regular expression}, or @dfn{regexp}, is a way of describing a
set of strings.
-Because regular expressions are such a fundamental part of @code{awk}
-programming, their format and use deserve a separate chapter.
+Because regular expressions are such a fundamental part of @command{awk}
+programming, their format and use deserve a separate @value{CHAPTER}.
A regular expression enclosed in slashes (@samp{/})
-is an @code{awk} pattern that matches every input record whose text
+is an @command{awk} pattern that matches every input record whose text
belongs to that set.
-
The simplest regular expression is a sequence of letters, numbers, or
both. Such a regexp matches any string that contains that sequence.
Thus, the regexp @samp{foo} matches any string containing @samp{foo}.
Therefore, the pattern @code{/foo/} matches any input record containing
-the three characters @samp{foo}, @emph{anywhere} in the record. Other
+the three characters @samp{foo} @emph{anywhere} in the record. Other
kinds of regexps let you specify more complicated classes of strings.
-@iftex
-Initially, the examples will be simple. As we explain more about how
-regular expressions work, we will present more complicated examples.
-@end iftex
+@ifnotinfo
+Initially, the examples in this @value{CHAPTER} are simple.
+As we explain more about how
+regular expressions work, we will present more complicated instances.
+@end ifnotinfo
@menu
* Regexp Usage:: How to Use Regular Expressions.
* Escape Sequences:: How to write non-printing characters.
* Regexp Operators:: Regular Expression Operators.
+* Character Lists:: What can go between @samp{[...]}.
* GNU Regexp Operators:: Operators specific to GNU software.
* Case-sensitivity:: How to do case-insensitive matching.
* Leftmost Longest:: How much text matches.
@@ -1957,53 +2705,49 @@ regular expressions work, we will present more complicated examples.
A regular expression can be used as a pattern by enclosing it in
slashes. Then the regular expression is tested against the
entire text of each record. (Normally, it only needs
-to match some part of the text in order to succeed.) For example, this
-prints the second field of each record that contains the three
-characters @samp{foo} anywhere in it:
+to match some part of the text in order to succeed.) For example, the
+following prints the second field of each record that contains the string
+@samp{foo} anywhere in it:
@example
-@group
$ awk '/foo/ @{ print $2 @}' BBS-list
@print{} 555-1234
@print{} 555-6699
@print{} 555-6480
@print{} 555-2127
-@end group
@end example
-@cindex regexp matching operators
+@cindex regexp operators
@cindex string-matching operators
@cindex operators, string-matching
@cindex operators, regexp matching
-@cindex regexp match/non-match operators
@cindex @code{~} operator
@cindex @code{!~} operator
Regular expressions can also be used in matching expressions. These
expressions allow you to specify the string to match against; it need
-not be the entire current input record. The two operators, @samp{~}
-and @samp{!~}, perform regular expression comparisons. Expressions
-using these operators can be used as patterns or in @code{if},
+not be the entire current input record. The two operators @samp{~}
+and @samp{!~} perform regular expression comparisons. Expressions
+using these operators can be used as patterns, or in @code{if},
@code{while}, @code{for}, and @code{do} statements.
-@ifinfo
-@c adding this xref in TeX screws up the formatting too much
(@xref{Statements, ,Control Statements in Actions}.)
-@end ifinfo
+For example:
-@table @code
-@item @var{exp} ~ /@var{regexp}/
-This is true if the expression @var{exp} (taken as a string)
-is matched by @var{regexp}. The following example matches, or selects,
-all input records with the upper-case letter @samp{J} somewhere in the
+@example
+@var{exp} ~ /@var{regexp}/
+@end example
+
+@noindent
+is true if the expression @var{exp} (taken as a string)
+matches @var{regexp}. The following example matches, or selects,
+all input records with the uppercase letter @samp{J} somewhere in the
first field:
@example
-@group
$ awk '$1 ~ /J/' inventory-shipped
@print{} Jan 13 25 15 115
@print{} Jun 31 42 75 492
@print{} Jul 24 34 67 436
@print{} Jan 21 36 64 620
-@end group
@end example
So does this:
@@ -2012,27 +2756,30 @@ So does this:
awk '@{ if ($1 ~ /J/) print @}' inventory-shipped
@end example
-@item @var{exp} !~ /@var{regexp}/
-This is true if the expression @var{exp} (taken as a character string)
-is @emph{not} matched by @var{regexp}. The following example matches,
+This next example is true if the expression @var{exp}
+(taken as a character string)
+does @emph{not} match @var{regexp}:
+
+@example
+@var{exp} !~ /@var{regexp}/
+@end example
+
+The following example matches,
or selects, all input records whose first field @emph{does not} contain
-the upper-case letter @samp{J}:
+the uppercase letter @samp{J}:
@example
-@group
$ awk '$1 !~ /J/' inventory-shipped
@print{} Feb 15 32 24 226
@print{} Mar 15 24 34 228
@print{} Apr 31 52 63 420
@print{} May 16 34 29 208
@dots{}
-@end group
@end example
-@end table
@cindex regexp constant
-When a regexp is written enclosed in slashes, like @code{/foo/}, we call it
-a @dfn{regexp constant}, much like @code{5.27} is a numeric constant, and
+When a regexp is enclosed in slashes, such as @code{/foo/}, we call it
+a @dfn{regexp constant}, much like @code{5.27} is a numeric constant and
@code{"foo"} is a string constant.
@node Escape Sequences, Regexp Operators, Regexp Usage, Regexp
@@ -2040,13 +2787,12 @@ a @dfn{regexp constant}, much like @code{5.27} is a numeric constant, and
@cindex escape sequence notation
Some characters cannot be included literally in string constants
-(@code{"foo"}) or regexp constants (@code{/foo/}). You represent them
-instead with @dfn{escape sequences}, which are character sequences
-beginning with a backslash (@samp{\}).
-
-One use of an escape sequence is to include a double-quote character in
-a string constant. Since a plain double-quote would end the string, you
-must use @samp{\"} to represent an actual double-quote character as a
+(@code{"foo"}) or regexp constants (@code{/foo/}).
+Instead, they should be represented with @dfn{escape sequences},
+which are character sequences beginning with a backslash (@samp{\}).
+One use of an escape sequence is to include a double quote character in
+a string constant. Because a plain double quote ends the string, you
+must use @samp{\"} to represent an actual double quote character as a
part of the string. For example:
@example
@@ -2055,7 +2801,7 @@ $ awk 'BEGIN @{ print "He said \"hi!\" to her." @}'
@end example
The backslash character itself is another character that cannot be
-included normally; you write @samp{\\} to put one backslash in the
+included normally; you must write @samp{\\} to put one backslash in the
string or regexp. Thus, the string whose contents are the two characters
@samp{"} and @samp{\} must be written @code{"\"\\"}.
@@ -2064,264 +2810,392 @@ such as tab or newline. While there is nothing to stop you from entering most
unprintable characters directly in a string constant or regexp constant,
they may look ugly.
-Here is a table of all the escape sequences used in @code{awk}, and
-what they represent. Unless noted otherwise, all of these escape
-sequences apply to both string constants and regexp constants.
+The following table lists
+all the escape sequences used in @command{awk} and
+what they represent. Unless noted otherwise, all these escape
+sequences apply to both string constants and regexp constants:
-@c @cartouche
@table @code
@item \\
A literal backslash, @samp{\}.
-@cindex @code{awk} language, V.4 version
+@cindex @command{awk} language, V.4 version
+@cindex @code{\a} escape sequence
@item \a
-The ``alert'' character, @kbd{Control-g}, ASCII code 7 (BEL).
+The ``alert'' character, @kbd{Ctrl-g}, ASCII code 7 (BEL).
+(This usually makes some sort of audible noise.)
+@cindex @code{\b} escape sequence
@item \b
-Backspace, @kbd{Control-h}, ASCII code 8 (BS).
+Backspace, @kbd{Ctrl-h}, ASCII code 8 (BS).
+@cindex @code{\f} escape sequence
@item \f
-Formfeed, @kbd{Control-l}, ASCII code 12 (FF).
+Formfeed, @kbd{Ctrl-l}, ASCII code 12 (FF).
+@cindex @code{\n} escape sequence
@item \n
-Newline, @kbd{Control-j}, ASCII code 10 (LF).
+Newline, @kbd{Ctrl-j}, ASCII code 10 (LF).
+@cindex @code{\r} escape sequence
@item \r
-Carriage return, @kbd{Control-m}, ASCII code 13 (CR).
+Carriage return, @kbd{Ctrl-m}, ASCII code 13 (CR).
+@cindex @code{\t} escape sequence
@item \t
-Horizontal tab, @kbd{Control-i}, ASCII code 9 (HT).
+Horizontal tab, @kbd{Ctrl-i}, ASCII code 9 (HT).
-@cindex @code{awk} language, V.4 version
+@cindex @command{awk} language, V.4 version
+@cindex @code{\v} escape sequence
@item \v
-Vertical tab, @kbd{Control-k}, ASCII code 11 (VT).
+Vertical tab, @kbd{Ctrl-k}, ASCII code 11 (VT).
+@cindex @code{\}@var{nnn} escape sequence (octal)
@item \@var{nnn}
-The octal value @var{nnn}, where @var{nnn} are one to three digits
+The octal value @var{nnn}, where @var{nnn} stands for 1 to 3 digits
between @samp{0} and @samp{7}. For example, the code for the ASCII ESC
(escape) character is @samp{\033}.
-@cindex @code{awk} language, V.4 version
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @code{\x} escape sequence
+@cindex @command{awk} language, V.4 version
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@item \x@var{hh}@dots{}
-The hexadecimal value @var{hh}, where @var{hh} are hexadecimal
-digits (@samp{0} through @samp{9} and either @samp{A} through @samp{F} or
-@samp{a} through @samp{f}). Like the same construct in ANSI C, the escape
-sequence continues until the first non-hexadecimal digit is seen. However,
-using more than two hexadecimal digits produces undefined results. (The
-@samp{\x} escape sequence is not allowed in POSIX @code{awk}.)
-
+The hexadecimal value @var{hh}, where @var{hh} stands for a sequence
+of hexadecimal digits (@samp{0} through @samp{9}, and either @samp{A}
+through @samp{F} or @samp{a} through @samp{f}). Like the same construct
+in ISO C, the escape sequence continues until the first non-hexadecimal
+digit is seen. However, using more than two hexadecimal digits produces
+undefined results. (The @samp{\x} escape sequence is not allowed in
+POSIX @command{awk}.)
+
+@cindex @code{\/} escape sequence
@item \/
A literal slash (necessary for regexp constants only).
-You use this when you wish to write a regexp
-constant that contains a slash. Since the regexp is delimited by
+This expression is used when you want to write a regexp
+constant that contains a slash. Because the regexp is delimited by
slashes, you need to escape the slash that is part of the pattern,
-in order to tell @code{awk} to keep processing the rest of the regexp.
+in order to tell @command{awk} to keep processing the rest of the regexp.
+@cindex @code{\"} escape sequence
@item \"
-A literal double-quote (necessary for string constants only).
-You use this when you wish to write a string
-constant that contains a double-quote. Since the string is delimited by
-double-quotes, you need to escape the quote that is part of the string,
-in order to tell @code{awk} to keep processing the rest of the string.
+A literal double quote (necessary for string constants only).
+This expression is used when you want to write a string
+constant that contains a double quote. Because the string is delimited by
+double quotes, you need to escape the quote that is part of the string,
+in order to tell @command{awk} to keep processing the rest of the string.
@end table
-@c @end cartouche
-
-In @code{gawk}, there are additional two character sequences that begin
-with backslash that have special meaning in regexps.
-@xref{GNU Regexp Operators, ,Additional Regexp Operators Only in @code{gawk}}.
-In a string constant,
-what happens if you place a backslash before something that is not one of
-the characters listed above? POSIX @code{awk} purposely leaves this case
-undefined. There are two choices.
+In @command{gawk}, a number of additional two-character sequences that begin
+with a backslash have special meaning in regexps.
+@xref{GNU Regexp Operators, ,@command{gawk}-Specific Regexp Operators}.
-@itemize @bullet
-@item
-Strip the backslash out. This is what Unix @code{awk} and @code{gawk} both do.
-For example, @code{"a\qc"} is the same as @code{"aqc"}.
-
-@item
-Leave the backslash alone. Some other @code{awk} implementations do this.
-In such implementations, @code{"a\qc"} is the same as if you had typed
-@code{"a\\qc"}.
-@end itemize
-
-In a regexp, a backslash before any character that is not in the above table,
+In a regexp, a backslash before any character that is not in the above table
and not listed in
-@ref{GNU Regexp Operators, ,Additional Regexp Operators Only in @code{gawk}},
+@ref{GNU Regexp Operators, ,@command{gawk}-Specific Regexp Operators},
means that the next character should be taken literally, even if it would
-normally be a regexp operator. E.g., @code{/a\+b/} matches the three
+normally be a regexp operator. For example, @code{/a\+b/} matches the three
characters @samp{a+b}.
@cindex portability issues
For complete portability, do not use a backslash before any character not
-listed in the table above.
-
-Another interesting question arises. Suppose you use an octal or hexadecimal
-escape to represent a regexp metacharacter
-(@pxref{Regexp Operators, , Regular Expression Operators}).
-Does @code{awk} treat the character as a literal character, or as a regexp
-operator?
-
-@cindex dark corner
-It turns out that historically, such characters were taken literally (d.c.).
-However, the POSIX standard indicates that they should be treated
-as real metacharacters, and this is what @code{gawk} does.
-However, in compatibility mode (@pxref{Options, ,Command Line Options}),
-@code{gawk} treats the characters represented by octal and hexadecimal
-escape sequences literally when used in regexp constants. Thus,
-@code{/a\52b/} is equivalent to @code{/a\*b/}.
+shown in the table above.
To summarize:
-@enumerate 1
+@itemize @bullet
@item
The escape sequences in the table above are always processed first,
for both string constants and regexp constants. This happens very early,
-as soon as @code{awk} reads your program.
+as soon as @command{awk} reads your program.
@item
-@code{gawk} processes both regexp constants and dynamic regexps
+@command{gawk} processes both regexp constants and dynamic regexps
(@pxref{Computed Regexps, ,Using Dynamic Regexps}),
for the special operators listed in
-@ref{GNU Regexp Operators, ,Additional Regexp Operators Only in @code{gawk}}.
+@ref{GNU Regexp Operators, ,@command{gawk}-Specific Regexp Operators}.
@item
A backslash before any other character means to treat that character
literally.
-@end enumerate
+@end itemize
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Backslash Before Regular Characters
+@cindex advanced notes
+
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+If you place a backslash in a string constant before something that is
+not one of the characters listed above, POSIX @command{awk} purposely
+leaves what happens as undefined. There are two choices:
+
+@cindex automatic warnings
+@cindex warnings, automatic
+@table @asis
+@item Strip the backslash out
+This is what Unix @command{awk} and @command{gawk} both do.
+For example, @code{"a\qc"} is the same as @code{"aqc"}.
+(Because this is such an easy bug to both introduce and to miss,
+@command{gawk} warns you about it.)
+Consider @samp{FS = @w{"[ \t]+\|[ \t]+"}} to use vertical bars
+surrounded by whitespace as the field separator. There should be
+two backslashes in the string, @samp{FS = @w{"[ \t]+\\|[ \t]+"}}.)
+@c I did this! This is why I added the warning.
+
+@item Leave the backslash alone
+Some other @command{awk} implementations do this.
+In such implementations, @code{"a\qc"} is the same as if you had typed
+@code{"a\\qc"}.
+@end table
-@node Regexp Operators, GNU Regexp Operators, Escape Sequences, Regexp
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Escape Sequences for Metacharacters
+@cindex advanced notes
+
+Suppose you use an octal or hexadecimal
+escape to represent a regexp metacharacter
+(@pxref{Regexp Operators, , Regular Expression Operators}).
+Does @command{awk} treat the character as a literal character or as a regexp
+operator?
+
+@cindex dark corner
+Historically, such characters were taken literally.
+@value{DARKCORNER}
+However, the POSIX standard indicates that they should be treated
+as real metacharacters, which is what @command{gawk} does.
+In compatibility mode (@pxref{Options, ,Command-Line Options}),
+@command{gawk} treats the characters represented by octal and hexadecimal
+escape sequences literally when used in regexp constants. Thus,
+@code{/a\52b/} is equivalent to @code{/a\*b/}.
+
+@node Regexp Operators, Character Lists, Escape Sequences, Regexp
@section Regular Expression Operators
@cindex metacharacters
@cindex regular expression metacharacters
@cindex regexp operators
-You can combine regular expressions with the following characters,
-called @dfn{regular expression operators}, or @dfn{metacharacters}, to
+You can combine regular expressions with special characters,
+called @dfn{regular expression operators} or @dfn{metacharacters}, to
increase the power and versatility of regular expressions.
The escape sequences described
-@iftex
-above
-@end iftex
+@ifnotinfo
+earlier
+@end ifnotinfo
in @ref{Escape Sequences},
-are valid inside a regexp. They are introduced by a @samp{\}. They
+are valid inside a regexp. They are introduced by a @samp{\}, and
are recognized and converted into the corresponding real characters as
the very first step in processing regexps.
-Here is a table of metacharacters. All characters that are not escape
-sequences and that are not listed in the table stand for themselves.
+Here is a list of metacharacters. All characters that are not escape
+sequences and that are not listed in the table stand for themselves:
@table @code
@item \
This is used to suppress the special meaning of a character when
-matching. For example:
-
-@example
-\$
-@end example
-
-@noindent
+matching. For example, @samp{\$}
matches the character @samp{$}.
-@c NEEDED
-@page
@cindex anchors in regexps
@cindex regexp, anchors
+@cindex Texinfo
@item ^
-This matches the beginning of a string. For example:
-
-@example
-^@@chapter
-@end example
-
-@noindent
-matches the @samp{@@chapter} at the beginning of a string, and can be used
+This matches the beginning of a string. For example, @samp{^@@chapter}
+matches @samp{@@chapter} at the beginning of a string, and can be used
to identify chapter beginnings in Texinfo source files.
-The @samp{^} is known as an @dfn{anchor}, since it anchors the pattern to
-matching only at the beginning of the string.
+The @samp{^} is known as an @dfn{anchor}, because it anchors the pattern to
+match only at the beginning of the string.
It is important to realize that @samp{^} does not match the beginning of
-a line embedded in a string. In this example the condition is not true:
+a line embedded in a string.
+The condition is not true in the following example:
@example
if ("line1\nLINE 2" ~ /^L/) @dots{}
@end example
@item $
-This is similar to @samp{^}, but it matches only at the end of a string.
-For example:
-
-@example
-p$
-@end example
-
-@noindent
-matches a record that ends with a @samp{p}. The @samp{$} is also an anchor,
-and also does not match the end of a line embedded in a string. In this
-example the condition is not true:
+This is similar to @samp{^} but it matches only at the end of a string.
+For example, @samp{p$}
+matches a record that ends with a @samp{p}. The @samp{$} is an anchor
+and does not match the end of a line embedded in a string.
+The condition is not true in the following example:
@example
if ("line1\nLINE 2" ~ /1$/) @dots{}
@end example
@item .
-The period, or dot, matches any single character,
-@emph{including} the newline character. For example:
-
-@example
-.P
-@end example
-
-@noindent
+This matches any single character,
+@emph{including} the newline character. For example, @samp{.P}
matches any single character followed by a @samp{P} in a string. Using
-concatenation we can make a regular expression like @samp{U.A}, which
+concatenation, we can make a regular expression such as @samp{U.A}, that
matches any three-character sequence that begins with @samp{U} and ends
with @samp{A}.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-In strict POSIX mode (@pxref{Options, ,Command Line Options}),
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+In strict POSIX mode (@pxref{Options, ,Command-Line Options}),
@samp{.} does not match the @sc{nul}
character, which is a character with all bits equal to zero.
-Otherwise, @sc{nul} is just another character. Other versions of @code{awk}
+Otherwise, @sc{nul} is just another character. Other versions of @command{awk}
may not be able to match the @sc{nul} character.
-@ignore
-2e: Add stuff that character list is the POSIX terminology. In other
- literature known as character set or character class.
-@end ignore
-
@cindex character list
+@cindex character set (regexp component)
+@cindex character class
+@cindex bracket expression
@item [@dots{}]
-This is called a @dfn{character list}. It matches any @emph{one} of the
-characters that are enclosed in the square brackets. For example:
+This is called a @dfn{character list}.@footnote{In other literature,
+you may see a character list referred to as either a
+@dfn{character set}, a @dfn{character class} or a @dfn{bracket expression}.}
+It matches any @emph{one} of the characters that are enclosed in
+the square brackets. For example, @samp{[MVX]} matches any one of
+the characters @samp{M}, @samp{V}, or @samp{X}, in a string. A full
+discussion of what can be inside the square brackets of a character list
+is given in
+@ref{Character Lists, ,Using Character Lists}.
-@example
-[MVX]
-@end example
+@cindex complemented character list
+@cindex character list, complemented
+@item [^ @dots{}]
+This is a @dfn{complemented character list}. The first character after
+the @samp{[} @emph{must} be a @samp{^}. It matches any characters
+@emph{except} those in the square brackets. For example, @samp{[^awk]}
+matches any character that is not an @samp{a}, a @samp{w},
+or a @samp{k}.
-@noindent
-matches any one of the characters @samp{M}, @samp{V}, or @samp{X} in a
-string.
+@item |
+This is the @dfn{alternation operator} and it is used to specify
+alternatives.
+The @samp{|} has the lowest precedence of all the regular
+expression operators.
+For example, @samp{^P|[[:digit:]]}
+matches any string that matches either @samp{^P} or @samp{[[:digit:]]}. This
+means it matches any string that starts with @samp{P} or contains a digit.
-Ranges of characters are indicated by using a hyphen between the beginning
-and ending characters, and enclosing the whole thing in brackets. For
-example:
+The alternation applies to the largest possible regexps on either side.
+
+@cindex Texinfo
+@item (@dots{})
+Parentheses are used for grouping in regular expressions, similar to
+arithmetic. They can be used to concatenate regular expressions
+containing the alternation operator, @samp{|}. For example,
+@samp{@@(samp|code)\@{[^@}]+\@}} matches both @samp{@@code@{foo@}} and
+@samp{@@samp@{bar@}}.
+(These are Texinfo formatting control sequences.)
+
+@item *
+This symbol means that the preceding regular expression should be
+repeated as many times as necessary to find a match. For example, @samp{ph*}
+applies the @samp{*} symbol to the preceding @samp{h} and looks for matches
+of one @samp{p} followed by any number of @samp{h}s. This also matches
+just @samp{p} if no @samp{h}s are present.
+
+The @samp{*} repeats the @emph{smallest} possible preceding expression.
+(Use parentheses if you want to repeat a larger expression.) It finds
+as many repetitions as possible. For example,
+@samp{awk '/\(c[ad][ad]*r x\)/ @{ print @}' sample}
+prints every record in @file{sample} containing a string of the form
+@samp{(car x)}, @samp{(cdr x)}, @samp{(cadr x)}, and so on.
+Notice the escaping of the parentheses by preceding them
+with backslashes.
+
+@item +
+This symbol is similar to @samp{*} except that the preceding expression must be
+matched at least once. This means that @samp{wh+y}
+would match @samp{why} and @samp{whhy}, but not @samp{wy}, whereas
+@samp{wh*y} would match all three of these strings.
+The following is a simpler
+way of writing the last @samp{*} example:
@example
-[0-9]
+awk '/\(c[ad]+r x\)/ @{ print @}' sample
@end example
-@noindent
-matches any digit.
-Multiple ranges are allowed. E.g., the list @code{@w{[A-Za-z0-9]}} is a
-common way to express the idea of ``all alphanumeric characters.''
+@item ?
+This symbol is similar to @samp{*} except that the preceding expression can be
+matched either once or not at all. For example, @samp{fe?d}
+matches @samp{fed} and @samp{fd}, but nothing else.
+
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@cindex interval expressions
+@item @{@var{n}@}
+@itemx @{@var{n},@}
+@itemx @{@var{n},@var{m}@}
+One or two numbers inside braces denote an @dfn{interval expression}.
+If there is one number in the braces, the preceding regexp is repeated
+@var{n} times.
+If there are two numbers separated by a comma, the preceding regexp is
+repeated @var{n} to @var{m} times.
+If there is one number followed by a comma, then the preceding regexp
+is repeated at least @var{n} times:
+
+@table @code
+@item wh@{3@}y
+Matches @samp{whhhy}, but not @samp{why} or @samp{whhhhy}.
+
+@item wh@{3,5@}y
+Matches @samp{whhhy}, @samp{whhhhy}, or @samp{whhhhhy}, only.
+
+@item wh@{2,@}y
+Matches @samp{whhy} or @samp{whhhy}, and so on.
+@end table
-To include one of the characters @samp{\}, @samp{]}, @samp{-} or @samp{^} in a
+Interval expressions were not traditionally available in @command{awk}.
+They were added as part of the POSIX standard to make @command{awk}
+and @command{egrep} consistent with each other.
+
+However, because old programs may use @samp{@{} and @samp{@}} in regexp
+constants, by default @command{gawk} does @emph{not} match interval expressions
+in regexps. If either @option{--posix} or @option{--re-interval} are specified
+(@pxref{Options, , Command-Line Options}), then interval expressions
+are allowed in regexps.
+
+For new programs that use @samp{@{} and @samp{@}} in regexp constants,
+it is good practice to always escape them with a backslash. Then the
+regexp constants are valid and work the way you want them to, using
+any version of @command{awk}.@footnote{Use two backslashes if you're
+using a string constant with a regexp operator or function.}
+@end table
+
+@cindex precedence, regexp operators
+@cindex regexp operators, precedence of
+In regular expressions, the @samp{*}, @samp{+}, and @samp{?} operators,
+as well as the braces @samp{@{} and @samp{@}},
+have
+the highest precedence, followed by concatenation, and finally by @samp{|}.
+As in arithmetic, parentheses can change how operators are grouped.
+
+In POSIX @command{awk} and @command{gawk}, the @samp{*}, @samp{+}, and @samp{?} operators
+stand for themselves when there is nothing in the regexp that precedes them.
+For example, @samp{/+/} matches a literal plus sign. However, many other versions of
+@command{awk} treat such a usage as a syntax error.
+
+If @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+POSIX character classes and interval expressions are not available in
+regular expressions.
+
+@node Character Lists, GNU Regexp Operators, Regexp Operators, Regexp
+@section Using Character Lists
+
+Within a character list, a @dfn{range expression} consists of two
+characters separated by a hyphen. It matches any single character that
+sorts between the two characters, using the locale's
+collating sequence and character set. For example, in the default C
+locale, @samp{[a-dx-z]} is equivalent to @samp{[abcdxyz]}. Many locales
+sort characters in dictionary order, and in these locales,
+@samp{[a-dx-z]} is typically not equivalent to @samp{[abcdxyz]}; instead it
+might be equivalent to @samp{[aBbCcDdxXyYz]}, for example. To obtain
+the traditional interpretation of bracket expressions, you can use the C
+locale by setting the @env{LC_ALL} environment variable to the value
+@samp{C}.
+
+To include one of the characters @samp{\}, @samp{]}, @samp{-}, or @samp{^} in a
character list, put a @samp{\} in front of it. For example:
@example
@@ -2329,32 +3203,37 @@ character list, put a @samp{\} in front of it. For example:
@end example
@noindent
-matches either @samp{d}, or @samp{]}.
+matches either @samp{d} or @samp{]}.
-@cindex @code{egrep}
+@cindex @command{egrep} utility
This treatment of @samp{\} in character lists
-is compatible with other @code{awk}
-implementations, and is also mandated by POSIX.
-The regular expressions in @code{awk} are a superset
+is compatible with other @command{awk}
+implementations and is also mandated by POSIX.
+The regular expressions in @command{awk} are a superset
of the POSIX specification for Extended Regular Expressions (EREs).
POSIX EREs are based on the regular expressions accepted by the
-traditional @code{egrep} utility.
+traditional @command{egrep} utility.
-@cindex character classes
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex character class
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@dfn{Character classes} are a new feature introduced in the POSIX standard.
A character class is a special notation for describing
-lists of characters that have a specific attribute, but where the
-actual characters themselves can vary from country to country and/or
+lists of characters that have a specific attribute, but the
+actual characters can vary from country to country and/or
from character set to character set. For example, the notion of what
-is an alphabetic character differs in the USA and in France.
+is an alphabetic character differs between the United States and France.
A character class is only valid in a regexp @emph{inside} the
brackets of a character list. Character classes consist of @samp{[:},
a keyword denoting the class, and @samp{:]}. Here are the character
-classes defined by the POSIX standard.
+classes defined by the POSIX standard:
+
+@c the regular table is commented out while trying out the multitable.
+@c leave it here in case we need to go back, but make sure the text
+@c still corresponds!
+@ignore
@table @code
@item [:alnum:]
Alphanumeric characters.
@@ -2372,366 +3251,233 @@ Control characters.
Numeric characters.
@item [:graph:]
-Characters that are printable and are also visible.
-(A space is printable, but not visible, while an @samp{a} is both.)
+Characters that are printable and visible.
+(A space is printable but not visible, whereas an @samp{a} is both.)
@item [:lower:]
-Lower-case alphabetic characters.
+Lowercase alphabetic characters.
@item [:print:]
-Printable characters (characters that are not control characters.)
+Printable characters (characters that are not control characters).
@item [:punct:]
-Punctuation characters (characters that are not letter, digits,
+Punctuation characters (characters that are not letters, digits,
control characters, or space characters).
@item [:space:]
Space characters (such as space, tab, and formfeed, to name a few).
@item [:upper:]
-Upper-case alphabetic characters.
+Uppercase alphabetic characters.
@item [:xdigit:]
Characters that are hexadecimal digits.
@end table
+@end ignore
-For example, before the POSIX standard, to match alphanumeric
-characters, you had to write @code{/[A-Za-z0-9]/}. If your
+@multitable {@code{[:xdigit:]}} {Characters that are both printable and visible. (A space is}
+@item @code{[:alnum:]} @tab Alphanumeric characters.
+@item @code{[:alpha:]} @tab Alphabetic characters.
+@item @code{[:blank:]} @tab Space and tab characters.
+@item @code{[:cntrl:]} @tab Control characters.
+@item @code{[:digit:]} @tab Numeric characters.
+@item @code{[:graph:]} @tab Characters that are both printable and visible.
+(A space is printable but not visible, whereas an @samp{a} is both.)
+@item @code{[:lower:]} @tab Lowercase alphabetic characters.
+@item @code{[:print:]} @tab Printable characters (characters that are not control characters).
+@item @code{[:punct:]} @tab Punctuation characters (characters that are not letters, digits,
+control characters, or space characters).
+@item @code{[:space:]} @tab Space characters (such as space, tab, and formfeed, to name a few).
+@item @code{[:upper:]} @tab Uppercase alphabetic characters.
+@item @code{[:xdigit:]} @tab Characters that are hexadecimal digits.
+@end multitable
+
+For example, before the POSIX standard, you had to write @code{/[A-Za-z0-9]/}
+to match alphanumeric characters. If your
character set had other alphabetic characters in it, this would not
-match them. With the POSIX character classes, you can write
-@code{/[[:alnum:]]/}, and this will match @emph{all} the alphabetic
+match them, and if your character set collated differently from
+ASCII, this might not even match the ASCII alphanumeric characters.
+With the POSIX character classes, you can write
+@code{/[[:alnum:]]/} to match the alphabetic
and numeric characters in your character set.
@cindex collating elements
Two additional special sequences can appear in character lists.
These apply to non-ASCII character sets, which can have single symbols
(called @dfn{collating elements}) that are represented with more than one
-character, as well as several characters that are equivalent for
-@dfn{collating}, or sorting, purposes. (E.g., in French, a plain ``e''
+character. They can also have several characters that are equivalent for
+@dfn{collating}, or sorting, purposes. (For example, in French, a plain ``e''
and a grave-accented ``@`e'' are equivalent.)
@table @asis
@cindex collating symbols
@item Collating Symbols
-A @dfn{collating symbol} is a multi-character collating element enclosed in
+A @dfn{collating symbol} is a multicharacter collating element enclosed between
@samp{[.} and @samp{.]}. For example, if @samp{ch} is a collating element,
-then @code{[[.ch.]]} is a regexp that matches this collating element, while
+then @code{[[.ch.]]} is a regexp that matches this collating element, whereas
@code{[ch]} is a regexp that matches either @samp{c} or @samp{h}.
@cindex equivalence classes
@item Equivalence Classes
An @dfn{equivalence class} is a locale-specific name for a list of
-characters that are equivalent. The name is enclosed in
+characters that are equal. The name is enclosed between
@samp{[=} and @samp{=]}.
For example, the name @samp{e} might be used to represent all of
-``e,'' ``@`e,'' and ``@'e.'' In this case, @code{[[=e]]} is a regexp
-that matches any of @samp{e}, @samp{@'e}, or @samp{@`e}.
+``e,'' ``@`e,'' and ``@'e.'' In this case, @code{[[=e=]]} is a regexp
+that matches any of @samp{e}, @samp{@'e}, or @samp{@`e}.
@end table
These features are very valuable in non-English speaking locales.
-@strong{Caution:} The library functions that @code{gawk} uses for regular
+@strong{Caution:} The library functions that @command{gawk} uses for regular
expression matching currently only recognize POSIX character classes;
they do not recognize collating symbols or equivalence classes.
@c maybe one day ...
-@cindex complemented character list
-@cindex character list, complemented
-@item [^ @dots{}]
-This is a @dfn{complemented character list}. The first character after
-the @samp{[} @emph{must} be a @samp{^}. It matches any characters
-@emph{except} those in the square brackets. For example:
-
-@example
-[^0-9]
-@end example
-
-@noindent
-matches any character that is not a digit.
-
-@item |
-This is the @dfn{alternation operator}, and it is used to specify
-alternatives. For example:
-
-@example
-^P|[0-9]
-@end example
-
-@noindent
-matches any string that matches either @samp{^P} or @samp{[0-9]}. This
-means it matches any string that starts with @samp{P} or contains a digit.
-
-The alternation applies to the largest possible regexps on either side.
-In other words, @samp{|} has the lowest precedence of all the regular
-expression operators.
-
-@item (@dots{})
-Parentheses are used for grouping in regular expressions as in
-arithmetic. They can be used to concatenate regular expressions
-containing the alternation operator, @samp{|}. For example,
-@samp{@@(samp|code)\@{[^@}]+\@}} matches both @samp{@@code@{foo@}} and
-@samp{@@samp@{bar@}}. (These are Texinfo formatting control sequences.)
-
-@item *
-This symbol means that the preceding regular expression is to be
-repeated as many times as necessary to find a match. For example:
-
-@example
-ph*
-@end example
-
-@noindent
-applies the @samp{*} symbol to the preceding @samp{h} and looks for matches
-of one @samp{p} followed by any number of @samp{h}s. This will also match
-just @samp{p} if no @samp{h}s are present.
-
-The @samp{*} repeats the @emph{smallest} possible preceding expression.
-(Use parentheses if you wish to repeat a larger expression.) It finds
-as many repetitions as possible. For example:
+@node GNU Regexp Operators, Case-sensitivity, Character Lists, Regexp
+@section @command{gawk}-Specific Regexp Operators
-@example
-awk '/\(c[ad][ad]*r x\)/ @{ print @}' sample
-@end example
-
-@noindent
-prints every record in @file{sample} containing a string of the form
-@samp{(car x)}, @samp{(cdr x)}, @samp{(cadr x)}, and so on.
-Notice the escaping of the parentheses by preceding them
-with backslashes.
-
-@item +
-This symbol is similar to @samp{*}, but the preceding expression must be
-matched at least once. This means that:
-
-@example
-wh+y
-@end example
-
-@noindent
-would match @samp{why} and @samp{whhy} but not @samp{wy}, whereas
-@samp{wh*y} would match all three of these strings. This is a simpler
-way of writing the last @samp{*} example:
-
-@example
-awk '/\(c[ad]+r x\)/ @{ print @}' sample
-@end example
-
-@item ?
-This symbol is similar to @samp{*}, but the preceding expression can be
-matched either once or not at all. For example:
-
-@example
-fe?d
-@end example
-
-@noindent
-will match @samp{fed} and @samp{fd}, but nothing else.
-
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-@cindex interval expressions
-@item @{@var{n}@}
-@itemx @{@var{n},@}
-@itemx @{@var{n},@var{m}@}
-One or two numbers inside braces denote an @dfn{interval expression}.
-If there is one number in the braces, the preceding regexp is repeated
-@var{n} times.
-If there are two numbers separated by a comma, the preceding regexp is
-repeated @var{n} to @var{m} times.
-If there is one number followed by a comma, then the preceding regexp
-is repeated at least @var{n} times.
-
-@table @code
-@item wh@{3@}y
-matches @samp{whhhy} but not @samp{why} or @samp{whhhhy}.
-
-@item wh@{3,5@}y
-matches @samp{whhhy} or @samp{whhhhy} or @samp{whhhhhy}, only.
-
-@item wh@{2,@}y
-matches @samp{whhy} or @samp{whhhy}, and so on.
-@end table
-
-Interval expressions were not traditionally available in @code{awk}.
-As part of the POSIX standard they were added, to make @code{awk}
-and @code{egrep} consistent with each other.
-
-However, since old programs may use @samp{@{} and @samp{@}} in regexp
-constants, by default @code{gawk} does @emph{not} match interval expressions
-in regexps. If either @samp{--posix} or @samp{--re-interval} are specified
-(@pxref{Options, , Command Line Options}), then interval expressions
-are allowed in regexps.
-@end table
-
-@cindex precedence, regexp operators
-@cindex regexp operators, precedence of
-In regular expressions, the @samp{*}, @samp{+}, and @samp{?} operators,
-as well as the braces @samp{@{} and @samp{@}},
-have
-the highest precedence, followed by concatenation, and finally by @samp{|}.
-As in arithmetic, parentheses can change how operators are grouped.
-
-If @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}),
-character classes and interval expressions are not available in
-regular expressions.
-
-The next
-@ifinfo
-node
-@end ifinfo
-@iftex
-section
-@end iftex
-discusses the GNU-specific regexp operators, and provides
-more detail concerning how command line options affect the way @code{gawk}
-interprets the characters in regular expressions.
-
-@node GNU Regexp Operators, Case-sensitivity, Regexp Operators, Regexp
-@section Additional Regexp Operators Only in @code{gawk}
-
-@c This section adapted from the regex-0.12 manual
+@c This section adapted (long ago) from the regex-0.12 manual
@cindex regexp operators, GNU specific
+@cindex word, regexp definition of
GNU software that deals with regular expressions provides a number of
additional regexp operators. These operators are described in this
-section, and are specific to @code{gawk}; they are not available in other
-@code{awk} implementations.
-
-@cindex word, regexp definition of
-Most of the additional operators are for dealing with word matching.
+@value{SECTION} and are specific to @command{gawk};
+they are not available in other @command{awk} implementations.
+Most of the additional operators deal with word matching.
For our purposes, a @dfn{word} is a sequence of one or more letters, digits,
-or underscores (@samp{_}).
+or underscores (@samp{_}):
@table @code
@cindex @code{\w} regexp operator
@item \w
-This operator matches any word-constituent character, i.e.@: any
-letter, digit, or underscore. Think of it as a short-hand for
-@c @w{@code{[A-Za-z0-9_]}} or
+Matches any word-constituent character---that is, it matches any
+letter, digit, or underscore. Think of it as short-hand for
@w{@code{[[:alnum:]_]}}.
@cindex @code{\W} regexp operator
@item \W
-This operator matches any character that is not word-constituent.
-Think of it as a short-hand for
-@c @w{@code{[^A-Za-z0-9_]}} or
+Matches any character that is not word-constituent.
+Think of it as short-hand for
@w{@code{[^[:alnum:]_]}}.
@cindex @code{\<} regexp operator
@item \<
-This operator matches the empty string at the beginning of a word.
-For example, @code{/\<away/} matches @samp{away}, but not
+Matches the empty string at the beginning of a word.
+For example, @code{/\<away/} matches @samp{away} but not
@samp{stowaway}.
@cindex @code{\>} regexp operator
@item \>
-This operator matches the empty string at the end of a word.
-For example, @code{/stow\>/} matches @samp{stow}, but not @samp{stowaway}.
+Matches the empty string at the end of a word.
+For example, @code{/stow\>/} matches @samp{stow} but not @samp{stowaway}.
@cindex @code{\y} regexp operator
@cindex word boundaries, matching
@item \y
-This operator matches the empty string at either the beginning or the
-end of a word (the word boundar@strong{y}). For example, @samp{\yballs?\y}
-matches either @samp{ball} or @samp{balls} as a separate word.
+Matches the empty string at either the beginning or the
+end of a word (i.e., the word boundar@strong{y}). For example, @samp{\yballs?\y}
+matches either @samp{ball} or @samp{balls}, as a separate word.
@cindex @code{\B} regexp operator
@item \B
-This operator matches the empty string within a word. In other words,
-@samp{\B} matches the empty string that occurs between two
+Matches the empty string that occurs between two
word-constituent characters. For example,
-@code{/\Brat\B/} matches @samp{crate}, but it does not match @samp{dirty rat}.
+@code{/\Brat\B/} matches @samp{crate} but it does not match @samp{dirty rat}.
@samp{\B} is essentially the opposite of @samp{\y}.
@end table
+@cindex buffer matching operators
There are two other operators that work on buffers. In Emacs, a
-@dfn{buffer} is, naturally, an Emacs buffer. For other programs, the
-regexp library routines that @code{gawk} uses consider the entire
-string to be matched as the buffer.
+@dfn{buffer} is, naturally, an Emacs buffer. For other programs,
+@command{gawk}'s regexp library routines consider the entire
+string to match as the buffer.
-For @code{awk}, since @samp{^} and @samp{$} always work in terms
-of the beginning and end of strings, these operators don't add any
-new capabilities. They are provided for compatibility with other GNU
-software.
-
-@cindex buffer matching operators
@table @code
-@cindex @code{\`} regexp operator
@item \`
-This operator matches the empty string at the
-beginning of the buffer.
+@cindex @code{\`} regexp operator
+Matches the empty string at the
+beginning of a buffer (string).
@cindex @code{\'} regexp operator
@item \'
-This operator matches the empty string at the
-end of the buffer.
+Matches the empty string at the
+end of a buffer (string).
@end table
-In other GNU software, the word boundary operator is @samp{\b}. However,
-that conflicts with the @code{awk} language's definition of @samp{\b}
-as backspace, so @code{gawk} uses a different letter.
+Because @samp{^} and @samp{$} always work in terms of the beginning
+and end of strings, these operators don't add any new capabilities
+for @command{awk}. They are provided for compatibility with other
+GNU software.
+In other GNU software, the word-boundary operator is @samp{\b}. However,
+that conflicts with the @command{awk} language's definition of @samp{\b}
+as backspace, so @command{gawk} uses a different letter.
An alternative method would have been to require two backslashes in the
-GNU operators, but this was deemed to be too confusing, and the current
+GNU operators, but this was deemed too confusing. The current
method of using @samp{\y} for the GNU @samp{\b} appears to be the
lesser of two evils.
@c NOTE!!! Keep this in sync with the same table in the summary appendix!
-@cindex regexp, effect of command line options
-The various command line options
-(@pxref{Options, ,Command Line Options})
-control how @code{gawk} interprets characters in regexps.
+@c
+@c Should really do this with file inclusion.
+@cindex regexp, effect of command-line options
+The various command-line options
+(@pxref{Options, ,Command-Line Options})
+control how @command{gawk} interprets characters in regexps:
@table @asis
@item No options
-In the default case, @code{gawk} provides all the facilities of
-POSIX regexps and the GNU regexp operators described
-@iftex
-above.
-@end iftex
-@ifinfo
+In the default case, @command{gawk} provides all the facilities of
+POSIX regexps and the
+@ifnotinfo
+previously described
+GNU regexp operators.
+@end ifnotinfo
+@ifnottex
+GNU regexp operators described
in @ref{Regexp Operators, ,Regular Expression Operators}.
-@end ifinfo
+@end ifnottex
However, interval expressions are not supported.
@item @code{--posix}
-Only POSIX regexps are supported, the GNU operators are not special
+Only POSIX regexps are supported; the GNU operators are not special
(e.g., @samp{\w} matches a literal @samp{w}). Interval expressions
are allowed.
@item @code{--traditional}
-Traditional Unix @code{awk} regexps are matched. The GNU operators
-are not special, interval expressions are not available, and neither
+Traditional Unix @command{awk} regexps are matched. The GNU operators
+are not special, interval expressions are not available, nor
are the POSIX character classes (@code{[[:alnum:]]} and so on).
Characters described by octal and hexadecimal escape sequences are
treated literally, even if they represent regexp metacharacters.
@item @code{--re-interval}
-Allow interval expressions in regexps, even if @samp{--traditional}
+Allow interval expressions in regexps, even if @option{--traditional}
has been provided.
@end table
@node Case-sensitivity, Leftmost Longest, GNU Regexp Operators, Regexp
-@section Case-sensitivity in Matching
+@section Case Sensitivity in Matching
@cindex case sensitivity
@cindex ignoring case
Case is normally significant in regular expressions, both when matching
-ordinary characters (i.e.@: not metacharacters), and inside character
-sets. Thus a @samp{w} in a regular expression matches only a lower-case
-@samp{w} and not an upper-case @samp{W}.
+ordinary characters (i.e., not metacharacters) and inside character
+sets. Thus, a @samp{w} in a regular expression matches only a lowercase
+@samp{w} and not an uppercase @samp{W}.
The simplest way to do a case-independent match is to use a character
-list: @samp{[Ww]}. However, this can be cumbersome if you need to use it
-often; and it can make the regular expressions harder to
-read. There are two alternatives that you might prefer.
+list---for example, @samp{[Ww]}. However, this can be cumbersome if
+you need to use it often and it can make the regular expressions harder
+to read. There are two alternatives that you might prefer.
-One way to do a case-insensitive match at a particular point in the
+One way to perform a case-insensitive match at a particular point in the
program is to convert the data to a single case, using the
@code{tolower} or @code{toupper} built-in string functions (which we
haven't discussed yet;
-@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+@pxref{String Functions, ,String Manipulation Functions}).
For example:
@example
@@ -2739,75 +3485,66 @@ tolower($1) ~ /foo/ @{ @dots{} @}
@end example
@noindent
-converts the first field to lower-case before matching against it.
-This will work in any POSIX-compliant implementation of @code{awk}.
+converts the first field to lowercase before matching against it.
+This works in any POSIX-compliant @command{awk}.
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
@cindex @code{~} operator
@cindex @code{!~} operator
-@vindex IGNORECASE
-Another method, specific to @code{gawk}, is to set the variable
-@code{IGNORECASE} to a non-zero value (@pxref{Built-in Variables}).
+@cindex @code{IGNORECASE} variable
+Another method, specific to @command{gawk}, is to set the variable
+@code{IGNORECASE} to a nonzero value (@pxref{Built-in Variables}).
When @code{IGNORECASE} is not zero, @emph{all} regexp and string
operations ignore case. Changing the value of
-@code{IGNORECASE} dynamically controls the case sensitivity of your
+@code{IGNORECASE} dynamically controls the case sensitivity of the
program as it runs. Case is significant by default because
-@code{IGNORECASE} (like most variables) is initialized to zero.
+@code{IGNORECASE} (like most variables) is initialized to zero:
@example
-@group
x = "aB"
if (x ~ /ab/) @dots{} # this test will fail
-@end group
-@group
IGNORECASE = 1
if (x ~ /ab/) @dots{} # now it will succeed
-@end group
@end example
In general, you cannot use @code{IGNORECASE} to make certain rules
-case-insensitive and other rules case-sensitive, because there is no way
-to set @code{IGNORECASE} just for the pattern of a particular rule.
-@ignore
-This isn't quite true. Consider:
-
- IGNORECASE=1 && /foObAr/ { .... }
- IGNORECASE=0 || /foobar/ { .... }
-
-But that's pretty bad style and I don't want to get into it at this
-late date.
-@end ignore
-To do this, you must use character lists or @code{tolower}. However, one
-thing you can do only with @code{IGNORECASE} is turn case-sensitivity on
-or off dynamically for all the rules at once.
-
-@code{IGNORECASE} can be set on the command line, or in a @code{BEGIN} rule
-(@pxref{Other Arguments, ,Other Command Line Arguments}; also
+case-insensitive and other rules case-sensitive, because there is no
+straightforward way
+to set @code{IGNORECASE} just for the pattern of
+a particular rule.@footnote{Experienced C and C++ programmers will note
+that it is possible, using something like
+@samp{IGNORECASE = 1 && /foObAr/ @{ @dots{} @}}
+and
+@samp{IGNORECASE = 0 || /foobar/ @{ @dots{} @}}.
+However, this is somewhat obscure and we don't recommend it.}
+To do this, use either character lists or @code{tolower}. However, one
+thing you can do with @code{IGNORECASE} only is dynamically turn
+case-sensitivity on or off for all the rules at once.
+
+@code{IGNORECASE} can be set on the command line or in a @code{BEGIN} rule
+(@pxref{Other Arguments, ,Other Command-Line Arguments}; also
@pxref{Using BEGIN/END, ,Startup and Cleanup Actions}).
Setting @code{IGNORECASE} from the command line is a way to make
a program case-insensitive without having to edit it.
-Prior to version 3.0 of @code{gawk}, the value of @code{IGNORECASE}
-only affected regexp operations. It did not affect string comparison
+Prior to @command{gawk} 3.0, the value of @code{IGNORECASE}
+affected regexp operations only. It did not affect string comparison
with @samp{==}, @samp{!=}, and so on.
-Beginning with version 3.0, both regexp and string comparison
-operations are affected by @code{IGNORECASE}.
+Beginning with @value{PVERSION} 3.0, both regexp and string comparison
+operations are also affected by @code{IGNORECASE}.
@cindex ISO 8859-1
@cindex ISO Latin-1
-Beginning with version 3.0 of @code{gawk}, the equivalences between upper-case
-and lower-case characters are based on the ISO-8859-1 (ISO Latin-1)
+Beginning with @command{gawk} 3.0,
+the equivalences between upper-
+and lowercase characters are based on the ISO-8859-1 (ISO Latin-1)
character set. This character set is a superset of the traditional 128
ASCII characters, that also provides a number of characters suitable
for use with European languages.
-@ignore
-A pure ASCII character set can be used instead if @code{gawk} is compiled
-with @samp{-DUSE_PURE_ASCII}.
-@end ignore
-The value of @code{IGNORECASE} has no effect if @code{gawk} is in
-compatibility mode (@pxref{Options, ,Command Line Options}).
+The value of @code{IGNORECASE} has no effect if @command{gawk} is in
+compatibility mode (@pxref{Options, ,Command-Line Options}).
Case is always significant in compatibility mode.
@node Leftmost Longest, Computed Regexps, Case-sensitivity, Regexp
@@ -2815,26 +3552,23 @@ Case is always significant in compatibility mode.
@cindex leftmost longest match
@cindex matching, leftmost longest
-Consider the following example:
+Consider the following:
@example
echo aaaabcd | awk '@{ sub(/a+/, "<A>"); print @}'
@end example
-This example uses the @code{sub} function (which we haven't discussed yet,
-@pxref{String Functions, ,Built-in Functions for String Manipulation})
+This example uses the @code{sub} function (which we haven't discussed yet;
+@pxref{String Functions, ,String Manipulation Functions})
to make a change to the input record. Here, the regexp @code{/a+/}
indicates ``one or more @samp{a} characters,'' and the replacement
text is @samp{<A>}.
-The input contains four @samp{a} characters. What will the output be?
-In other words, how many is ``one or more''---will @code{awk} match two,
-three, or all four @samp{a} characters?
-
-The answer is, @code{awk} (and POSIX) regular expressions always match
+The input contains four @samp{a} characters.
+@command{awk} (and POSIX) regular expressions always match
the leftmost, @emph{longest} sequence of input characters that can
-match. Thus, in this example, all four @samp{a} characters are
-replaced with @samp{<A>}.
+match. Thus, all four @samp{a} characters are
+replaced with @samp{<A>} in this example:
@example
$ echo aaaabcd | awk '@{ sub(/a+/, "<A>"); print @}'
@@ -2845,12 +3579,12 @@ For simple match/no-match tests, this is not so important. But when doing
text matching and substitutions with the @code{match}, @code{sub}, @code{gsub},
and @code{gensub} functions, it is very important.
@ifinfo
-@xref{String Functions, ,Built-in Functions for String Manipulation},
+@xref{String Functions, ,String Manipulation Functions},
for more information on these functions.
@end ifinfo
Understanding this principle is also important for regexp-based record
-and field splitting (@pxref{Records, ,How Input is Split into Records},
-and also @pxref{Field Separators, ,Specifying How Fields are Separated}).
+and field splitting (@pxref{Records, ,How Input Is Split into Records},
+and also @pxref{Field Separators, ,Specifying How Fields Are Separated}).
@node Computed Regexps, , Leftmost Longest, Regexp
@section Using Dynamic Regexps
@@ -2861,37 +3595,33 @@ and also @pxref{Field Separators, ,Specifying How Fields are Separated}).
@cindex regexp, dynamic
@cindex @code{~} operator
@cindex @code{!~} operator
-The right hand side of a @samp{~} or @samp{!~} operator need not be a
-regexp constant (i.e.@: a string of characters between slashes). It may
-be any expression. The expression is evaluated, and converted if
-necessary to a string; the contents of the string are used as the
+The righthand side of a @samp{~} or @samp{!~} operator need not be a
+regexp constant (i.e., a string of characters between slashes). It may
+be any expression. The expression is evaluated and converted to a string
+if necessary; the contents of the string are used as the
regexp. A regexp that is computed in this way is called a @dfn{dynamic
-regexp}. For example:
+regexp}:
@example
-BEGIN @{ identifier_regexp = "[A-Za-z_][A-Za-z_0-9]*" @}
-$0 ~ identifier_regexp @{ print @}
+BEGIN @{ digits_regexp = "[[:digit:]]+" @}
+$0 ~ digits_regexp @{ print @}
@end example
@noindent
-sets @code{identifier_regexp} to a regexp that describes @code{awk}
-variable names, and tests if the input record matches this regexp.
-
-@ignore
-Do we want to use "^[A-Za-z_][A-Za-z_0-9]*$" to restrict the entire
-record to just identifiers? Doing that also would disrupt the flow of
-the text.
-@end ignore
+This sets @code{digits_regexp} to a regexp that describes one or more digits,
+and tests whether the input record matches this regexp.
+@c @strong{Caution:}
+When using the @samp{~} and @samp{!~}
@strong{Caution:} When using the @samp{~} and @samp{!~}
operators, there is a difference between a regexp constant
-enclosed in slashes, and a string constant enclosed in double quotes.
+enclosed in slashes and a string constant enclosed in double quotes.
If you are going to use a string constant, you have to understand that
-the string is in essence scanned @emph{twice}; the first time when
-@code{awk} reads your program, and the second time when it goes to
-match the string on the left-hand side of the operator with the pattern
+the string is, in essence, scanned @emph{twice}: the first time when
+@command{awk} reads your program, and the second time when it goes to
+match the string on the lefthand side of the operator with the pattern
on the right. This is true of any string valued expression (such as
-@code{identifier_regexp} above), not just string constants.
+@code{digits_regexp} shown previously), not just string constants.
@cindex regexp constants, difference between slashes and quotes
What difference does it make if the string is
@@ -2901,8 +3631,8 @@ string, you have to type two backslashes.
For example, @code{/\*/} is a regexp constant for a literal @samp{*}.
Only one backslash is needed. To do the same thing with a string,
-you would have to type @code{"\\*"}. The first backslash escapes the
-second one, so that the string actually contains the
+you have to type @code{"\\*"}. The first backslash escapes the
+second one so that the string actually contains the
two characters @samp{\} and @samp{*}.
@cindex common mistakes
@@ -2910,26 +3640,58 @@ two characters @samp{\} and @samp{*}.
@cindex errors, common
Given that you can use both regexp and string constants to describe
regular expressions, which should you use? The answer is ``regexp
-constants,'' for several reasons.
+constants,'' for several reasons:
-@enumerate 1
+@itemize @bullet
@item
-String constants are more complicated to write, and
+String constants are more complicated to write and
more difficult to read. Using regexp constants makes your programs
less error-prone. Not understanding the difference between the two
kinds of constants is a common source of errors.
@item
-It is also more efficient to use regexp constants: @code{awk} can note
-that you have supplied a regexp and store it internally in a form that
+It is more efficient to use regexp constants. @command{awk} can note
+that you have supplied a regexp, and store it internally in a form that
makes pattern matching more efficient. When using a string constant,
-@code{awk} must first convert the string into this internal form, and
+@command{awk} must first convert the string into this internal form and
then perform the pattern matching.
@item
-Using regexp constants is better style; it shows clearly that you
+Using regexp constants is better form; it shows clearly that you
intend a regexp match.
-@end enumerate
+@end itemize
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Using @code{\n} in Character Lists of Dynamic Regexps
+@cindex advanced notes
+@cindex dynamic regular expressions with embedded newlines
+@cindex regexp, dynamic, with embedded newlines
+@cindex newlines, embedded in dynamic regexps
+@cindex embedded newlines, in dynamic regexps
+
+Some commercial versions of @command{awk} do not allow the newline
+character to be used inside a character list for a dynamic regexp:
+
+@example
+$ awk '$0 ~ "[ \t\n]"'
+@error{} awk: newline in character class [
+@error{} ]...
+@error{} source line number 1
+@error{} context is
+@error{} >>> <<<
+@end example
+
+But a newline in a regexp constant works with no problem:
+
+@example
+$ awk '$0 ~ /[ \t\n]/'
+here is a sample line
+@print{} here is a sample line
+@kbd{Ctrl-d}
+@end example
+
+@command{gawk} does not have this problem, and it isn't likely to
+occur often in practice, but it's worth noting for future reference.
@node Reading Files, Printing, Regexp, Top
@chapter Reading Input Files
@@ -2937,25 +3699,26 @@ intend a regexp match.
@cindex reading files
@cindex input
@cindex standard input
-@vindex FILENAME
-In the typical @code{awk} program, all input is read either from the
-standard input (by default the keyboard, but often a pipe from another
-command) or from files whose names you specify on the @code{awk} command
-line. If you specify input files, @code{awk} reads them in order, reading
-all the data from one before going on to the next. The name of the current
-input file can be found in the built-in variable @code{FILENAME}
+@cindex @code{FILENAME} variable
+In the typical @command{awk} program, all input is read either from the
+standard input (by default, this is the keyboard but often it is a pipe from another
+command), or from files whose names you specify on the @command{awk}
+command line. If you specify input files, @command{awk} reads them
+in order, processing all the data from one before going on to the next.
+The name of the current input file can be found in the built-in variable
+@code{FILENAME}
(@pxref{Built-in Variables}).
-The input is read in units called @dfn{records}, and processed by the
+The input is read in units called @dfn{records}, and is processed by the
rules of your program one record at a time.
By default, each record is one line. Each
record is automatically split into chunks called @dfn{fields}.
This makes it more convenient for programs to work on the parts of a record.
-On rare occasions you will need to use the @code{getline} command.
+On rare occasions, you may need to use the @code{getline} command.
The @code{getline} command is valuable, both because it
can do explicit input from any number of files, and because the files
-used with it do not have to be named on the @code{awk} command line
+used with it do not have to be named on the @command{awk} command line
(@pxref{Getline, ,Explicit Input with @code{getline}}).
@menu
@@ -2971,49 +3734,62 @@ used with it do not have to be named on the @code{awk} command line
@end menu
@node Records, Fields, Reading Files, Reading Files
-@section How Input is Split into Records
+@section How Input Is Split into Records
+
+@cindex number of records, @code{NR}, @code{FNR}
+@cindex @code{NR} variable
+@cindex @code{FNR} variable
+The @command{awk} utility divides the input for your @command{awk}
+program into records and fields.
+@command{awk} keeps track of the number of records that have
+been read
+so far
+from the current input file. This value is stored in a
+built-in variable called @code{FNR}. It is reset to zero when a new
+file is started. Another built-in variable, @code{NR}, is the total
+number of input records read so far from all @value{DF}s. It starts at zero,
+but is never automatically reset to zero.
@cindex record separator, @code{RS}
@cindex changing the record separator
@cindex record, definition of
-@vindex RS
-The @code{awk} utility divides the input for your @code{awk}
-program into records and fields.
+@cindex @code{RS} variable
Records are separated by a character called the @dfn{record separator}.
By default, the record separator is the newline character.
This is why records are, by default, single lines.
-You can use a different character for the record separator by
+A different character can be used for the record separator by
assigning the character to the built-in variable @code{RS}.
-You can change the value of @code{RS} in the @code{awk} program,
-like any other variable, with the
-assignment operator, @samp{=} (@pxref{Assignment Ops, ,Assignment Expressions}).
+Like any other variable,
+the value of @code{RS} can be changed in the @command{awk} program
+with the assignment operator, @samp{=}
+(@pxref{Assignment Ops, ,Assignment Expressions}).
The new record-separator character should be enclosed in quotation marks,
-which indicate
-a string constant. Often the right time to do this is at the beginning
-of execution, before any input has been processed, so that the very
-first record will be read with the proper separator. To do this, use
-the special @code{BEGIN} pattern
-(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}). For
-example:
+which indicate a string constant. Often the right time to do this is
+at the beginning of execution, before any input is processed,
+so that the very first record is read with the proper separator.
+To do this, use the special @code{BEGIN} pattern
+(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
+For example:
@example
-awk 'BEGIN @{ RS = "/" @} ; @{ print $0 @}' BBS-list
+awk 'BEGIN @{ RS = "/" @}
+ @{ print $0 @}' BBS-list
@end example
@noindent
changes the value of @code{RS} to @code{"/"}, before reading any input.
This is a string whose first character is a slash; as a result, records
are separated by slashes. Then the input file is read, and the second
-rule in the @code{awk} program (the action with no pattern) prints each
-record. Since each @code{print} statement adds a newline at the end of
-its output, the effect of this @code{awk} program is to copy the input
+rule in the @command{awk} program (the action with no pattern) prints each
+record. Because each @code{print} statement adds a newline at the end of
+its output, the effect of this @command{awk} program is to copy the input
with each slash changed to a newline. Here are the results of running
the program on @file{BBS-list}:
@example
-@group
-$ awk 'BEGIN @{ RS = "/" @} ; @{ print $0 @}' BBS-list
+$ awk 'BEGIN @{ RS = "/" @}
+> @{ print $0 @}' BBS-list
@print{} aardvark 555-5553 1200
@print{} 300 B
@print{} alpo-net 555-3412 2400
@@ -3040,13 +3816,12 @@ $ awk 'BEGIN @{ RS = "/" @} ; @{ print $0 @}' BBS-list
@print{} sabafoo 555-2127 1200
@print{} 300 C
@print{}
-@end group
@end example
@noindent
Note that the entry for the @samp{camelot} BBS is not split.
-In the original data file
-(@pxref{Sample Data Files, , Data Files for the Examples}),
+In the original @value{DF}
+(@pxref{Sample Data Files, ,@value{DDF}s for the Examples}),
the line looks like this:
@example
@@ -3054,11 +3829,16 @@ camelot 555-0542 300 C
@end example
@noindent
-It only has one baud rate; there are no slashes in the record.
+It has one baud rate only, so there are no slashes in the record,
+unlike the others which have two or more baud rates.
+In fact, this record is treated as part of the record
+for the @samp{core} BBS; the newline separating them in the output
+is the original newline in the @value{DF}, not the one added by
+@command{awk} when it printed the record!
Another way to change the record separator is on the command line,
using the variable-assignment feature
-(@pxref{Other Arguments, ,Other Command Line Arguments}).
+(@pxref{Other Arguments, ,Other Command-Line Arguments}):
@example
awk '@{ print $0 @}' RS="/" BBS-list
@@ -3069,44 +3849,43 @@ This sets @code{RS} to @samp{/} before processing @file{BBS-list}.
Using an unusual character such as @samp{/} for the record separator
produces correct behavior in the vast majority of cases. However,
-the following (extreme) pipeline prints a surprising @samp{1}. There
-is one field, consisting of a newline. The value of the built-in
-variable @code{NF} is the number of fields in the current record.
+the following (extreme) pipeline prints a surprising @samp{1}:
@example
-@group
$ echo | awk 'BEGIN @{ RS = "a" @} ; @{ print NF @}'
@print{} 1
-@end group
@end example
+There is one field, consisting of a newline. The value of the built-in
+variable @code{NF} is the number of fields in the current record.
+
@cindex dark corner
-@noindent
Reaching the end of an input file terminates the current input record,
-even if the last character in the file is not the character in @code{RS}
-(d.c.).
+even if the last character in the file is not the character in @code{RS}.
+@value{DARKCORNER}
@cindex empty string
-The empty string, @code{""} (a string of no characters), has a special meaning
-as the value of @code{RS}: it means that records are separated
-by one or more blank lines, and nothing else.
+The empty string @code{""} (a string without any characters)
+has a special meaning
+as the value of @code{RS}. It means that records are separated
+by one or more blank lines and nothing else.
@xref{Multiple Line, ,Multiple-Line Records}, for more details.
-If you change the value of @code{RS} in the middle of an @code{awk} run,
+If you change the value of @code{RS} in the middle of an @command{awk} run,
the new value is used to delimit subsequent records, but the record
-currently being processed (and records already processed) are not
+currently being processed, as well as records already processed, are not
affected.
-@vindex RT
+@cindex @code{RT} variable
@cindex record terminator, @code{RT}
@cindex terminator, record
-@cindex differences between @code{gawk} and @code{awk}
-After the end of the record has been determined, @code{gawk}
+@cindex differences between @command{gawk} and @command{awk}
+@cindex regular expressions as record separators
+After the end of the record has been determined, @command{gawk}
sets the variable @code{RT} to the text in the input that matched
@code{RS}.
-
-@cindex regular expressions as record separators
-The value of @code{RS} is in fact not limited to a one-character
+When using @command{gawk},
+the value of @code{RS} is not limited to a one-character
string. It can be any regular expression
(@pxref{Regexp, ,Regular Expressions}).
In general, each record
@@ -3116,18 +3895,17 @@ actually at work in the usual case, where @code{RS} contains just a
newline: a record ends at the beginning of the next matching string (the
next newline in the input) and the following record starts just after
the end of this string (at the first character of the following line).
-The newline, since it matches @code{RS}, is not part of either record.
+The newline, because it matches @code{RS}, is not part of either record.
-When @code{RS} is a single character, @code{RT} will
-contain the same single character. However, when @code{RS} is a
-regular expression, then @code{RT} becomes more useful; it contains
+When @code{RS} is a single character, @code{RT}
+contains the same single character. However, when @code{RS} is a
+regular expression, @code{RT} contains
the actual input text that matched the regular expression.
The following example illustrates both of these features.
It sets @code{RS} equal to a regular expression that
-matches either a newline, or a series of one or more upper-case letters
-with optional leading and/or trailing white space
-(@pxref{Regexp, , Regular Expressions}).
+matches either a newline or a series of one or more uppercase letters
+with optional leading and/or trailing whitespace:
@example
$ echo record 1 AAAA record 2 BBBB record 3 |
@@ -3141,29 +3919,55 @@ $ echo record 1 AAAA record 2 BBBB record 3 |
@noindent
The final line of output has an extra blank line. This is because the
-value of @code{RT} is a newline, and then the @code{print} statement
+value of @code{RT} is a newline, and the @code{print} statement
supplies its own terminating newline.
-
@xref{Simple Sed, ,A Simple Stream Editor}, for a more useful example
of @code{RS} as a regexp and @code{RT}.
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
The use of @code{RS} as a regular expression and the @code{RT}
-variable are @code{gawk} extensions; they are not available in
+variable are @command{gawk} extensions; they are not available in
compatibility mode
-(@pxref{Options, ,Command Line Options}).
+(@pxref{Options, ,Command-Line Options}).
In compatibility mode, only the first character of the value of
@code{RS} is used to determine the end of the record.
-@cindex number of records, @code{NR}, @code{FNR}
-@vindex NR
-@vindex FNR
-The @code{awk} utility keeps track of the number of records that have
-been read so far from the current input file. This value is stored in a
-built-in variable called @code{FNR}. It is reset to zero when a new
-file is started. Another built-in variable, @code{NR}, is the total
-number of input records read so far from all data files. It starts at zero
-but is never automatically reset to zero.
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: @code{RS = "\0"} Is Not Portable
+@cindex advanced notes
+@cindex portability issues
+
+There are times when you might want to treat an entire @value{DF} as a
+single record. The only way to make this happen is to give @code{RS}
+a value that you know doesn't occur in the input file. This is hard
+to do in a general way, such that a program always works for arbitrary
+input files.
+@c can you say `understatement' boys and girls?
+
+You might think that for text files, the @sc{nul} character, which
+consists of a character with all bits equal to zero, is a good
+value to use for @code{RS} in this case:
+
+@example
+BEGIN @{ RS = "\0" @} # whole file becomes one record?
+@end example
+
+@cindex differences between @command{gawk} and @command{awk}
+@command{gawk} in fact accepts this, and uses the @sc{nul}
+character for the record separator.
+However, this usage is @emph{not} portable
+to other @command{awk} implementations.
+
+@cindex dark corner
+All other @command{awk} implementations@footnote{At least that we know
+about.} store strings internally as C-style strings. C strings use the
+@sc{nul} character as the string terminator. In effect, this means that
+@samp{RS = "\0"} is the same as @samp{RS = ""}.
+@value{DARKCORNER}
+
+The best way to treat a whole file as a single record is to
+simply read the file in, one record at a time, concatenating each
+record onto the end of the previous ones.
@node Fields, Non-Constant Fields, Records, Reading Files
@section Examining Fields
@@ -3171,72 +3975,65 @@ but is never automatically reset to zero.
@cindex examining fields
@cindex fields
@cindex accessing fields
-When @code{awk} reads an input record, the record is
+When @command{awk} reads an input record, the record is
automatically separated or @dfn{parsed} by the interpreter into chunks
-called @dfn{fields}. By default, fields are separated by whitespace,
+called @dfn{fields}. By default, fields are separated by @dfn{whitespace},
like words in a line.
-Whitespace in @code{awk} means any string of one or more spaces,
-tabs or newlines;@footnote{In POSIX @code{awk}, newlines are not
-considered whitespace for separating fields.} other characters such as
-formfeed, and so on, that are
-considered whitespace by other languages are @emph{not} considered
-whitespace by @code{awk}.
+Whitespace in @command{awk} means any string of one or more spaces,
+tabs, or newlines;@footnote{In POSIX @command{awk}, newlines are not
+considered whitespace for separating fields.} other characters, such as
+formfeed, vertical tab, etc.@: that are
+considered whitespace by other languages, are @emph{not} considered
+whitespace by @command{awk}.
The purpose of fields is to make it more convenient for you to refer to
these pieces of the record. You don't have to use them---you can
-operate on the whole record if you wish---but fields are what make
-simple @code{awk} programs so powerful.
+operate on the whole record if you want---but fields are what make
+simple @command{awk} programs so powerful.
-@cindex @code{$} (field operator)
+@cindex @code{$} field operator
@cindex field operator @code{$}
-To refer to a field in an @code{awk} program, you use a dollar-sign,
-@samp{$}, followed by the number of the field you want. Thus, @code{$1}
-refers to the first field, @code{$2} to the second, and so on. For
-example, suppose the following is a line of input:
+A dollar-sign (@samp{$}) is used
+to refer to a field in an @command{awk} program,
+followed by the number of the field you want. Thus, @code{$1}
+refers to the first field, @code{$2} to the second, and so on.
+(Unlike the Unix shells, the field numbers are not limited to single digits.
+@code{$127} is the one hundred and twenty-seventh field in the record.)
+For example, suppose the following is a line of input:
@example
This seems like a pretty nice example.
@end example
@noindent
-Here the first field, or @code{$1}, is @samp{This}; the second field, or
-@code{$2}, is @samp{seems}; and so on. Note that the last field,
+Here the first field, or @code{$1}, is @samp{This}, the second field, or
+@code{$2}, is @samp{seems}, and so on. Note that the last field,
@code{$7}, is @samp{example.}. Because there is no space between the
@samp{e} and the @samp{.}, the period is considered part of the seventh
field.
-@vindex NF
+@cindex @code{NF} variable
@cindex number of fields, @code{NF}
-@code{NF} is a built-in variable whose value
-is the number of fields in the current record.
-@code{awk} updates the value of @code{NF} automatically, each time
-a record is read.
-
-No matter how many fields there are, the last field in a record can be
-represented by @code{$NF}. So, in the example above, @code{$NF} would
-be the same as @code{$7}, which is @samp{example.}. Why this works is
-explained below (@pxref{Non-Constant Fields, ,Non-constant Field Numbers}).
-If you try to reference a field beyond the last one, such as @code{$8}
-when the record has only seven fields, you get the empty string.
-@c the empty string acts like 0 in some contexts, but I don't want to
-@c get into that here....
-
-@code{$0}, which looks like a reference to the ``zeroth'' field, is
-a special case: it represents the whole input record. @code{$0} is
-used when you are not interested in fields.
-
-@c NEEDED
-@page
+@code{NF} is a built-in variable whose value is the number of fields
+in the current record. @command{awk} automatically updates the value
+of @code{NF} each time it reads a record. No matter how many fields
+there are, the last field in a record can be represented by @code{$NF}.
+So, @code{$NF} is the same as @code{$7}, which is @samp{example.}.
+If you try to reference a field beyond the last
+one (such as @code{$8} when the record has only seven fields), you get
+the empty string. (If used in a numeric operation, you get zero.)
+
+The use of @code{$0}, which looks like a reference to the ``zeroth'' field, is
+a special case: it represents the whole input record
+when you are not interested in specific fields.
Here are some more examples:
@example
-@group
$ awk '$1 ~ /foo/ @{ print $0 @}' BBS-list
@print{} fooey 555-1234 2400/1200/300 B
@print{} foot 555-6699 1200/300 B
@print{} macfoo 555-6480 1200/300 A
@print{} sabafoo 555-2127 1200/300 C
-@end group
@end example
@noindent
@@ -3249,24 +4046,21 @@ expression.
By contrast, the following example
looks for @samp{foo} in @emph{the entire record} and prints the first
-field and the last field for each input record containing a
-match.
+field and the last field for each matching input record:
@example
-@group
$ awk '/foo/ @{ print $1, $NF @}' BBS-list
@print{} fooey B
@print{} foot B
@print{} macfoo A
@print{} sabafoo C
-@end group
@end example
@node Non-Constant Fields, Changing Fields, Fields, Reading Files
-@section Non-constant Field Numbers
+@section Non-Constant Field Numbers
The number of a field does not need to be a constant. Any expression in
-the @code{awk} language can be used after a @samp{$} to refer to a
+the @command{awk} language can be used after a @samp{$} to refer to a
field. The value of the expression specifies the field number. If the
value is a string, rather than a number, it is converted to a number.
Consider this example:
@@ -3281,93 +4075,92 @@ first record, two in the second, etc. So this example prints the first
field of the first record, the second field of the second record, and so
on. For the twentieth record, field number 20 is printed; most likely,
the record has fewer than 20 fields, so this prints a blank line.
-
Here is another example of using expressions as field numbers:
@example
awk '@{ print $(2*2) @}' BBS-list
@end example
-@code{awk} must evaluate the expression @samp{(2*2)} and use
+@command{awk} evaluates the expression @samp{(2*2)} and uses
its value as the number of the field to print. The @samp{*} sign
represents multiplication, so the expression @samp{2*2} evaluates to four.
The parentheses are used so that the multiplication is done before the
@samp{$} operation; they are necessary whenever there is a binary
operator in the field-number expression. This example, then, prints the
hours of operation (the fourth field) for every line of the file
-@file{BBS-list}. (All of the @code{awk} operators are listed, in
+@file{BBS-list}. (All of the @command{awk} operators are listed, in
order of decreasing precedence, in
@ref{Precedence, , Operator Precedence (How Operators Nest)}.)
If the field number you compute is zero, you get the entire record.
-Thus, @code{$(2-2)} has the same value as @code{$0}. Negative field
-numbers are not allowed; trying to reference one will usually terminate
-your running @code{awk} program. (The POSIX standard does not define
-what happens when you reference a negative field number. @code{gawk}
-will notice this and terminate your program. Other @code{awk}
+Thus, @samp{$(2-2)} has the same value as @code{$0}. Negative field
+numbers are not allowed; trying to reference one usually terminates
+the program. (The POSIX standard does not define
+what happens when you reference a negative field number. @command{gawk}
+notices this and terminates your program. Other @command{awk}
implementations may behave differently.)
As mentioned in @ref{Fields, ,Examining Fields},
-the number of fields in the current record is stored in the built-in
+@command{awk} stores the current record's number of fields in the built-in
variable @code{NF} (also @pxref{Built-in Variables}). The expression
-@code{$NF} is not a special feature: it is the direct consequence of
+@code{$NF} is not a special feature---it is the direct consequence of
evaluating @code{NF} and using its value as a field number.
@node Changing Fields, Field Separators, Non-Constant Fields, Reading Files
@section Changing the Contents of a Field
-@cindex field, changing contents of
+@cindex fields, changing contents of
@cindex changing contents of a field
@cindex assignment to fields
-You can change the contents of a field as seen by @code{awk} within an
-@code{awk} program; this changes what @code{awk} perceives as the
-current input record. (The actual input is untouched; @code{awk} @emph{never}
+The contents of a field, as seen by @command{awk}, can be changed within an
+@command{awk} program; this changes what @command{awk} perceives as the
+current input record. (The actual input is untouched; @command{awk} @emph{never}
modifies the input file.)
-
Consider this example and its output:
@example
-@group
-$ awk '@{ $3 = $2 - 10; print $2, $3 @}' inventory-shipped
+$ awk '@{ nboxes = $3 ; $3 = $3 - 10
+> print nboxes, $3 @}' inventory-shipped
@print{} 13 3
@print{} 15 5
@print{} 15 5
@dots{}
-@end group
@end example
@noindent
+The program first saves the original value of field three in the variable
+@code{nboxes}.
The @samp{-} sign represents subtraction, so this program reassigns
-field three, @code{$3}, to be the value of field two minus ten,
-@samp{$2 - 10}. (@xref{Arithmetic Ops, ,Arithmetic Operators}.)
-Then field two, and the new value for field three, are printed.
-
-In order for this to work, the text in field @code{$2} must make sense
-as a number; the string of characters must be converted to a number in
-order for the computer to do arithmetic on it. The number resulting
-from the subtraction is converted back to a string of characters which
+field three, @code{$3}, as the original value of field three minus ten:
+@samp{$3 - 10}. (@xref{Arithmetic Ops, ,Arithmetic Operators}.)
+Then it prints the original and new values for field three.
+(Someone in the warehouse made a consistent mistake while inventorying
+the red boxes.)
+
+For this to work, the text in field @code{$2} must make sense
+as a number; the string of characters must be converted to a number
+for the computer to do arithmetic on it. The number resulting
+from the subtraction is converted back to a string of characters that
then becomes field three.
@xref{Conversion, ,Conversion of Strings and Numbers}.
-When you change the value of a field (as perceived by @code{awk}), the
+When the value of a field is changed (as perceived by @command{awk}), the
text of the input record is recalculated to contain the new field where
-the old one was. Therefore, @code{$0} changes to reflect the altered
+the old one was. In other words, @code{$0} changes to reflect the altered
field. Thus, this program
prints a copy of the input file, with 10 subtracted from the second
-field of each line.
+field of each line:
@example
-@group
$ awk '@{ $2 = $2 - 10; print $0 @}' inventory-shipped
@print{} Jan 3 25 15 115
@print{} Feb 5 32 24 226
@print{} Mar 5 24 34 228
@dots{}
-@end group
@end example
-You can also assign contents to fields that are out of range. For
-example:
+It is also possible to also assign contents to fields that are out
+of range. For example:
@example
$ awk '@{ $6 = ($5 + $4 + $3 + $2)
@@ -3384,17 +4177,17 @@ We've just created @code{$6}, whose value is the sum of fields
represents addition. For the file @file{inventory-shipped}, @code{$6}
represents the total number of parcels shipped for a particular month.
-Creating a new field changes @code{awk}'s internal copy of the current
-input record---the value of @code{$0}. Thus, if you do @samp{print $0}
+Creating a new field changes @command{awk}'s internal copy of the current
+input record, which is the value of @code{$0}. Thus, if you do @samp{print $0}
after adding a field, the record printed includes the new field, with
the appropriate number of field separators between it and the previously
existing fields.
This recomputation affects and is affected by
-@code{NF} (the number of fields; @pxref{Fields, ,Examining Fields}),
-and by a feature that has not been discussed yet,
+@code{NF} (the number of fields; @pxref{Fields, ,Examining Fields}).
+It is also affected by a feature that has not been discussed yet:
the @dfn{output field separator}, @code{OFS},
-which is used to separate the fields (@pxref{Output Separators}).
+used to separate the fields (@pxref{Output Separators}).
For example, the value of @code{NF} is set to the number of the highest
field you create.
@@ -3413,29 +4206,26 @@ else
@noindent
should print @samp{everything is normal}, because @code{NF+1} is certain
to be out of range. (@xref{If Statement, ,The @code{if}-@code{else} Statement},
-for more information about @code{awk}'s @code{if-else} statements.
+for more information about @command{awk}'s @code{if-else} statements.
@xref{Typing and Comparison, ,Variable Typing and Comparison Expressions},
for more information about the @samp{!=} operator.)
It is important to note that making an assignment to an existing field
-will change the
-value of @code{$0}, but will not change the value of @code{NF},
+changes the
+value of @code{$0} but does not change the value of @code{NF},
even when you assign the empty string to a field. For example:
@example
-@group
$ echo a b c d | awk '@{ OFS = ":"; $2 = ""
> print $0; print NF @}'
@print{} a::c:d
@print{} 4
-@end group
@end example
@noindent
-The field is still there; it just has an empty value. You can tell
-because there are two colons in a row.
-
-This example shows what happens if you create a new field.
+The field is still there; it just has an empty value, denoted by
+the two colons between @samp{a} and @samp{c}.
+This example shows what happens if you create a new field:
@example
$ echo a b c d | awk '@{ OFS = ":"; $2 = ""; $6 = "new"
@@ -3445,50 +4235,48 @@ $ echo a b c d | awk '@{ OFS = ":"; $2 = ""; $6 = "new"
@end example
@noindent
-The intervening field, @code{$5} is created with an empty value
+The intervening field, @code{$5}, is created with an empty value
(indicated by the second pair of adjacent colons),
and @code{NF} is updated with the value six.
-Finally, decrementing @code{NF} will lose the values of the fields
-after the new value of @code{NF}, and @code{$0} will be recomputed.
+@c FIXME: Verify that this is in POSIX
+@cindex dark corner
+Decrementing @code{NF} throws away the values of the fields
+after the new value of @code{NF} and recomputes @code{$0}.
+@value{DARKCORNER}
Here is an example:
@example
-$ echo a b c d e f | ../gawk '@{ print "NF =", NF;
-> NF = 3; print $0 @}'
+$ echo a b c d e f | awk '@{ print "NF =", NF;
+> NF = 3; print $0 @}'
@print{} NF = 6
@print{} a b c
@end example
-@node Field Separators, Constant Size, Changing Fields, Reading Files
-@section Specifying How Fields are Separated
+@cindex portability issues
+@strong{Caution:} Some versions of @command{awk} don't
+rebuild @code{$0} when @code{NF} is decremented. Caveat emptor.
-This section is rather long; it describes one of the most fundamental
-operations in @code{awk}.
+@node Field Separators, Constant Size, Changing Fields, Reading Files
+@section Specifying How Fields Are Separated
@menu
-* Basic Field Splitting:: How fields are split with single characters
- or simple strings.
* Regexp Field Splitting:: Using regexps as the field separator.
* Single Character Fields:: Making each character a separate field.
-* Command Line Field Separator:: Setting @code{FS} from the command line.
+* Command Line Field Separator:: Setting @code{FS} from the command-line.
* Field Splitting Summary:: Some final points and a summary table.
@end menu
-@node Basic Field Splitting, Regexp Field Splitting, Field Separators, Field Separators
-@subsection The Basics of Field Separating
-@vindex FS
+@cindex @code{FS} variable
@cindex fields, separating
@cindex field separator, @code{FS}
-
The @dfn{field separator}, which is either a single character or a regular
-expression, controls the way @code{awk} splits an input record into fields.
-@code{awk} scans the input record for character sequences that
+expression, controls the way @command{awk} splits an input record into fields.
+@command{awk} scans the input record for character sequences that
match the separator; the fields themselves are the text between the matches.
-In the examples below, we use the bullet symbol ``@bullet{}'' to represent
-spaces in the output.
-
+In the examples that follow, we use the bullet symbol (@bullet{}) to
+represent spaces in the output.
If the field separator is @samp{oo}, then the following line:
@example
@@ -3496,7 +4284,7 @@ moo goo gai pan
@end example
@noindent
-would be split into three fields: @samp{m}, @samp{@bullet{}g} and
+is split into three fields: @samp{m}, @samp{@bullet{}g}, and
@samp{@bullet{}gai@bullet{}pan}.
Note the leading spaces in the values of the second and third fields.
@@ -3504,15 +4292,15 @@ Note the leading spaces in the values of the second and third fields.
@cindex mistakes, common
@cindex errors, common
The field separator is represented by the built-in variable @code{FS}.
-Shell programmers take note! @code{awk} does @emph{not} use the name @code{IFS}
-which is used by the POSIX compatible shells (such as the Bourne shell,
-@code{sh}, or the GNU Bourne-Again Shell, Bash).
+Shell programmers take note: @command{awk} does @emph{not} use the
+name @code{IFS} that is used by the POSIX-compliant shells (such as
+the Unix Bourne shell, @command{sh}, or @command{bash}).
-You can change the value of @code{FS} in the @code{awk} program with the
+The value of @code{FS} can be changed in the @command{awk} program with the
assignment operator, @samp{=} (@pxref{Assignment Ops, ,Assignment Expressions}).
-Often the right time to do this is at the beginning of execution,
+Often the right time to do this is at the beginning of execution
before any input has been processed, so that the very first record
-will be read with the proper separator. To do this, use the special
+is read with the proper separator. To do this, use the special
@code{BEGIN} pattern
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
For example, here we set the value of @code{FS} to the string
@@ -3523,69 +4311,57 @@ awk 'BEGIN @{ FS = "," @} ; @{ print $2 @}'
@end example
@noindent
-Given the input line,
+Given the input line:
@example
John Q. Smith, 29 Oak St., Walamazoo, MI 42139
@end example
@noindent
-this @code{awk} program extracts and prints the string
+this @command{awk} program extracts and prints the string
@samp{@bullet{}29@bullet{}Oak@bullet{}St.}.
@cindex field separator, choice of
@cindex regular expressions as field separators
-Sometimes your input data will contain separator characters that don't
+Sometimes the input data contains separator characters that don't
separate fields the way you thought they would. For instance, the
person's name in the example we just used might have a title or
-suffix attached, such as @samp{John Q. Smith, LXIX}. From input
-containing such a name:
+suffix attached, such as:
@example
John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139
@end example
@noindent
-@c careful of an overfull hbox here!
-the above program would extract @samp{@bullet{}LXIX}, instead of
+The same program would extract @samp{@bullet{}LXIX}, instead of
@samp{@bullet{}29@bullet{}Oak@bullet{}St.}.
If you were expecting the program to print the
-address, you would be surprised. The moral is: choose your data layout and
+address, you would be surprised. The moral is to choose your data layout and
separator characters carefully to prevent such problems.
+(If the data is not in a form that is easy to process, perhaps you
+can massage it first with a separate @command{awk} program.)
-@iftex
-As you know, normally,
-@end iftex
-@ifinfo
-Normally,
-@end ifinfo
-fields are separated by whitespace sequences
-(spaces, tabs and newlines), not by single spaces: two spaces in a row do not
+Fields are normally separated by whitespace sequences
+(spaces, tabs, and newlines), not by single spaces. Two spaces in a row do not
delimit an empty field. The default value of the field separator @code{FS}
-is a string containing a single space, @w{@code{" "}}. If this value were
-interpreted in the usual way, each space character would separate
+is a string containing a single space, @w{@code{" "}}. If @command{awk}
+interpreted this value in the usual way, each space character would separate
fields, so two spaces in a row would make an empty field between them.
The reason this does not happen is that a single space as the value of
-@code{FS} is a special case: it is taken to specify the default manner
+@code{FS} is a special case---it is taken to specify the default manner
of delimiting fields.
If @code{FS} is any other single character, such as @code{","}, then
each occurrence of that character separates two fields. Two consecutive
occurrences delimit an empty field. If the character occurs at the
beginning or the end of the line, that too delimits an empty field. The
-space character is the only single character which does not follow these
+space character is the only single character that does not follow these
rules.
-@node Regexp Field Splitting, Single Character Fields, Basic Field Splitting, Field Separators
+@node Regexp Field Splitting, Single Character Fields, Field Separators, Field Separators
@subsection Using Regular Expressions to Separate Fields
-The previous
-@iftex
-subsection
-@end iftex
-@ifinfo
-node
-@end ifinfo
+The previous @value{SUBSECTION}
discussed the use of single characters or simple strings as the
value of @code{FS}.
More generally, the value of @code{FS} may be a string containing any
@@ -3598,33 +4374,33 @@ FS = ", \t"
@noindent
makes every area of an input line that consists of a comma followed by a
-space and a tab, into a field separator. (@samp{\t}
+space and a tab into a field separator.
+@ifinfo
+(@samp{\t}
is an @dfn{escape sequence} that stands for a tab;
@pxref{Escape Sequences},
for the complete list of similar escape sequences.)
+@end ifinfo
-For a less trivial example of a regular expression, suppose you want
-single spaces to separate fields the way single commas were used above.
-You can set @code{FS} to @w{@code{"[@ ]"}} (left bracket, space, right
+For a less trivial example of a regular expression, try using
+single spaces to separate fields the way single commas are used.
+@code{FS} can be set to @w{@code{"[@ ]"}} (left bracket, space, right
bracket). This regular expression matches a single space and nothing else
(@pxref{Regexp, ,Regular Expressions}).
There is an important difference between the two cases of @samp{FS = @w{" "}}
-(a single space) and @samp{FS = @w{"[ \t\n]+"}} (left bracket, space,
-backslash, ``t'', backslash, ``n'', right bracket, which is a regular
-expression matching one or more spaces, tabs, or newlines). For both
-values of @code{FS}, fields are separated by runs of spaces, tabs
-and/or newlines. However, when the value of @code{FS} is @w{@code{"
-"}}, @code{awk} will first strip leading and trailing whitespace from
-the record, and then decide where the fields are.
-
+(a single space) and @samp{FS = @w{"[ \t\n]+"}}
+(a regular expression matching one or more spaces, tabs, or newlines).
+For both values of @code{FS}, fields are separated by @dfn{runs}
+(multiple adjacent occurrences) of spaces, tabs,
+and/or newlines. However, when the value of @code{FS} is @w{@code{" "}},
+@command{awk} first strips leading and trailing whitespace from
+the record and then decides where the fields are.
For example, the following pipeline prints @samp{b}:
@example
-@group
$ echo ' a b c d ' | awk '@{ print $2 @}'
@print{} b
-@end group
@end example
@noindent
@@ -3632,7 +4408,7 @@ However, this pipeline prints @samp{a} (note the extra spaces around
each letter):
@example
-$ echo ' a b c d ' | awk 'BEGIN @{ FS = "[ \t]+" @}
+$ echo ' a b c d ' | awk 'BEGIN @{ FS = "[ \t\n]+" @}
> @{ print $2 @}'
@print{} a
@end example
@@ -3640,7 +4416,7 @@ $ echo ' a b c d ' | awk 'BEGIN @{ FS = "[ \t]+" @}
@noindent
@cindex null string
@cindex empty string
-In this case, the first field is @dfn{null}, or empty.
+In this case, the first field is @dfn{null} or empty.
The stripping of leading and trailing whitespace also comes into
play whenever @code{$0} is recomputed. For instance, study this pipeline:
@@ -3655,49 +4431,50 @@ $ echo ' a b c d' | awk '@{ print; $2 = $2; print @}'
The first @code{print} statement prints the record as it was read,
with leading whitespace intact. The assignment to @code{$2} rebuilds
@code{$0} by concatenating @code{$1} through @code{$NF} together,
-separated by the value of @code{OFS}. Since the leading whitespace
+separated by the value of @code{OFS}. Because the leading whitespace
was ignored when finding @code{$1}, it is not part of the new @code{$0}.
Finally, the last @code{print} statement prints the new @code{$0}.
@node Single Character Fields, Command Line Field Separator, Regexp Field Splitting, Field Separators
@subsection Making Each Character a Separate Field
-@cindex differences between @code{gawk} and @code{awk}
-@cindex single character fields
+@cindex differences between @command{gawk} and @command{awk}
+@cindex single-character fields
There are times when you may want to examine each character
-of a record separately. In @code{gawk}, this is easy to do, you
-simply assign the null string (@code{""}) to @code{FS}. In this case,
-each individual character in the record will become a separate field.
-Here is an example:
+of a record separately. This can be done in @command{gawk} by
+simply assigning the null string (@code{""}) to @code{FS}. In this case,
+each individual character in the record becomes a separate field.
+For example:
@example
-@group
$ echo a b | gawk 'BEGIN @{ FS = "" @}
-> @{
+> @{
> for (i = 1; i <= NF; i = i + 1)
> print "Field", i, "is", $i
> @}'
@print{} Field 1 is a
@print{} Field 2 is
@print{} Field 3 is b
-@end group
@end example
@cindex dark corner
-Traditionally, the behavior for @code{FS} equal to @code{""} was not defined.
-In this case, Unix @code{awk} would simply treat the entire record
-as only having one field (d.c.). In compatibility mode
-(@pxref{Options, ,Command Line Options}),
-if @code{FS} is the null string, then @code{gawk} will also
-behave this way.
+Traditionally, the behavior of @code{FS} equal to @code{""} was not defined.
+In this case, most versions of Unix @command{awk} simply treat the entire record
+as only having one field.
+@value{DARKCORNER}
+In compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+if @code{FS} is the null string, then @command{gawk} also
+behaves this way.
@node Command Line Field Separator, Field Splitting Summary, Single Character Fields, Field Separators
@subsection Setting @code{FS} from the Command Line
@cindex @code{-F} option
+@cindex command-line option, @code{-F}
@cindex field separator, on command line
@cindex command line, setting @code{FS} on
-@code{FS} can be set on the command line. You use the @samp{-F} option to
+@code{FS} can be set on the command line. Use the @option{-F} option to
do so. For example:
@example
@@ -3705,64 +4482,59 @@ awk -F, '@var{program}' @var{input-files}
@end example
@noindent
-sets @code{FS} to be the @samp{,} character. Notice that the option uses
-a capital @samp{F}. Contrast this with @samp{-f}, which specifies a file
-containing an @code{awk} program. Case is significant in command line options:
-the @samp{-F} and @samp{-f} options have nothing to do with each other.
+sets @code{FS} to the @samp{,} character. Notice that the option uses
+a capital @samp{F} instead of a lowercase @option{-f}, which specifies a file
+containing an @command{awk} program. Case is significant in command-line
+options:
+the @option{-F} and @option{-f} options have nothing to do with each other.
You can use both options at the same time to set the @code{FS} variable
-@emph{and} get an @code{awk} program from a file.
+@emph{and} get an @command{awk} program from a file.
-The value used for the argument to @samp{-F} is processed in exactly the
-same way as assignments to the built-in variable @code{FS}. This means that
-if the field separator contains special characters, they must be escaped
-appropriately. For example, to use a @samp{\} as the field separator, you
-would have to type:
+The value used for the argument to @option{-F} is processed in exactly the
+same way as assignments to the built-in variable @code{FS}.
+Any special characters in the field separator must be escaped
+appropriately. For example, to use a @samp{\} as the field separator
+on the command line, you would have to type:
@example
-# same as FS = "\\"
+# same as FS = "\\"
awk -F\\\\ '@dots{}' files @dots{}
@end example
@noindent
-Since @samp{\} is used for quoting in the shell, @code{awk} will see
-@samp{-F\\}. Then @code{awk} processes the @samp{\\} for escape
+Because @samp{\} is used for quoting in the shell, @command{awk} sees
+@samp{-F\\}. Then @command{awk} processes the @samp{\\} for escape
characters (@pxref{Escape Sequences}), finally yielding
-a single @samp{\} to be used for the field separator.
+a single @samp{\} to use for the field separator.
@cindex historical features
As a special case, in compatibility mode
-(@pxref{Options, ,Command Line Options}), if the
-argument to @samp{-F} is @samp{t}, then @code{FS} is set to the tab
-character. This is because if you type @samp{-F\t} at the shell,
-without any quotes, the @samp{\} gets deleted, so @code{awk} figures that you
-really want your fields to be separated with tabs, and not @samp{t}s.
-Use @samp{-v FS="t"} on the command line if you really do want to separate
-your fields with @samp{t}s
-(@pxref{Options, ,Command Line Options}).
+(@pxref{Options, ,Command-Line Options}),
+if the argument to @option{-F} is @samp{t}, then @code{FS} is set to
+the tab character. If you type @samp{-F\t} at the
+shell, without any quotes, the @samp{\} gets deleted, so @command{awk}
+figures that you really want your fields to be separated with tabs and
+not @samp{t}s. Use @samp{-v FS="t"} or @samp{-F"[t]"} on the command line
+if you really do want to separate your fields with @samp{t}s.
-For example, let's use an @code{awk} program file called @file{baud.awk}
-that contains the pattern @code{/300/}, and the action @samp{print $1}.
-Here is the program:
+For example, let's use an @command{awk} program file called @file{baud.awk}
+that contains the pattern @code{/300/} and the action @samp{print $1}:
@example
/300/ @{ print $1 @}
@end example
-Let's also set @code{FS} to be the @samp{-} character, and run the
+Let's also set @code{FS} to be the @samp{-} character and run the
program on the file @file{BBS-list}. The following command prints a
list of the names of the bulletin boards that operate at 300 baud and
the first three digits of their phone numbers:
@c tweaked to make the tex output look better in @smallbook
@example
-@group
$ awk -F- -f baud.awk BBS-list
@print{} aardvark 555
@print{} alpo
@print{} barfly 555
-@dots{}
-@end group
-@ignore
@print{} bites 555
@print{} camelot 555
@print{} core 555
@@ -3771,13 +4543,11 @@ $ awk -F- -f baud.awk BBS-list
@print{} macfoo 555
@print{} sdace 555
@print{} sabafoo 555
-@end ignore
@end example
@noindent
-Note the second line of output. In the original file
-(@pxref{Sample Data Files, ,Data Files for the Examples}),
-the second line looked like this:
+Note the second line of output. The second line
+in the original file looked like this:
@example
alpo-net 555-3412 2400/1200/300 A
@@ -3788,44 +4558,79 @@ separator, instead of the @samp{-} in the phone number that was
originally intended. This demonstrates why you have to be careful in
choosing your field and record separators.
+Perhaps the most common use of a single character as the field
+separator occurs when processing the Unix system password file.
On many Unix systems, each user has a separate entry in the system password
file, one line per user. The information in these lines is separated
-by colons. The first field is the user's logon name, and the second is
-the user's encrypted password. A password file entry might look like this:
+by colons. The first field is the user's logon name and the second is
+the user's (encrypted or shadow) password. A password file entry might look
+like this:
+@cindex Robbins, Arnold
@example
-arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh
+arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash
@end example
-The following program searches the system password file, and prints
+The following program searches the system password file and prints
the entries for users who have no password:
@example
awk -F: '$2 == ""' /etc/passwd
@end example
-@node Field Splitting Summary, , Command Line Field Separator, Field Separators
+@node Field Splitting Summary, , Command Line Field Separator, Field Separators
@subsection Field Splitting Summary
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-According to the POSIX standard, @code{awk} is supposed to behave
-as if each record is split into fields at the time that it is read.
-In particular, this means that you can change the value of @code{FS}
-after a record is read, and the value of the fields (i.e.@: how they were split)
+The following
+table
+summarizes how fields are split, based on the
+value of @code{FS}. (@samp{==} means ``is equal to.'')
+
+@table @code
+@item FS == " "
+Fields are separated by runs of whitespace. Leading and trailing
+whitespace are ignored. This is the default.
+
+@item FS == @var{any other single character}
+Fields are separated by each occurrence of the character. Multiple
+successive occurrences delimit empty fields, as do leading and
+trailing occurrences.
+The character can even be a regexp metacharacter; it does not need
+to be escaped.
+
+@item FS == @var{regexp}
+Fields are separated by occurrences of characters that match @var{regexp}.
+Leading and trailing matches of @var{regexp} delimit empty fields.
+
+@item FS == ""
+Each individual character in the record becomes a separate field.
+(This is a @command{gawk} extension; it is not specified by the
+POSIX standard.)
+@end table
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Changing @code{FS} Does Not Affect the Fields
+
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+According to the POSIX standard, @command{awk} is supposed to behave
+as if each record is split into fields at the time it is read.
+In particular, this means that if you change the value of @code{FS}
+after a record is read, the value of the fields (i.e., how they were split)
should reflect the old value of @code{FS}, not the new one.
@cindex dark corner
-@cindex @code{sed} utility
+@cindex @command{sed} utility
@cindex stream editor
-However, many implementations of @code{awk} do not work this way. Instead,
+However, many implementations of @command{awk} do not work this way. Instead,
they defer splitting the fields until a field is actually
-referenced. The fields will be split
-using the @emph{current} value of @code{FS}! (d.c.)
+referenced. The fields are split
+using the @emph{current} value of @code{FS}!
+@value{DARKCORNER}
This behavior can be difficult
to diagnose. The following example illustrates the difference
between the two methods.
-(The @code{sed}@footnote{The @code{sed} utility is a ``stream editor.''
+(The @command{sed}@footnote{The @command{sed} utility is a ``stream editor.''
Its behavior is also defined by the POSIX standard.}
command prints just the first line of @file{/etc/passwd}.)
@@ -3834,94 +4639,83 @@ sed 1q /etc/passwd | awk '@{ FS = ":" ; print $1 @}'
@end example
@noindent
-will usually print
+which usually prints:
@example
root
@end example
@noindent
-on an incorrect implementation of @code{awk}, while @code{gawk}
-will print something like
+on an incorrect implementation of @command{awk}, while @command{gawk}
+prints something like:
@example
root:nSijPlPhZZwgE:0:0:Root:/:
@end example
-The following table summarizes how fields are split, based on the
-value of @code{FS}. (@samp{==} means ``is equal to.'')
-
-@c @cartouche
-@table @code
-@item FS == " "
-Fields are separated by runs of whitespace. Leading and trailing
-whitespace are ignored. This is the default.
-
-@item FS == @var{any other single character}
-Fields are separated by each occurrence of the character. Multiple
-successive occurrences delimit empty fields, as do leading and
-trailing occurrences.
-The character can even be a regexp metacharacter; it does not need
-to be escaped.
-
-@item FS == @var{regexp}
-Fields are separated by occurrences of characters that match @var{regexp}.
-Leading and trailing matches of @var{regexp} delimit empty fields.
-
-@item FS == ""
-Each individual character in the record becomes a separate field.
-@end table
-@c @end cartouche
-
@node Constant Size, Multiple Line, Field Separators, Reading Files
-@section Reading Fixed-width Data
+@section Reading Fixed-Width Data
+
+@ifnotinfo
+@strong{Note:} This @value{SECTION} discusses an advanced
+feature of @command{gawk}. If you are a novice @command{awk} user,
+you might want to skip it on the first reading.
+@end ifnotinfo
-(This section discusses an advanced, experimental feature. If you are
-a novice @code{awk} user, you may wish to skip it on the first reading.)
+@ifinfo
+(This @value{SECTION} discusses an advanced feature of @command{awk}.
+If you are a novice @command{awk} user, you might want to skip it on
+the first reading.)
+@end ifinfo
-@code{gawk} version 2.13 introduced a new facility for dealing with
-fixed-width fields with no distinctive field separator. Data of this
-nature arises, for example, in the input for old FORTRAN programs where
-numbers are run together; or in the output of programs that did not
+@command{gawk} @value{PVERSION} 2.13 introduced a facility for dealing with
+fixed-width fields with no distinctive field separator. For example,
+data of this nature arises in the input for old Fortran programs where
+numbers are run together, or in the output of programs that did not
anticipate the use of their output as input for other programs.
An example of the latter is a table where all the columns are lined up by
the use of a variable number of spaces and @emph{empty fields are just
-spaces}. Clearly, @code{awk}'s normal field splitting based on @code{FS}
-will not work well in this case. Although a portable @code{awk} program
+spaces}. Clearly, @command{awk}'s normal field splitting based on @code{FS}
+does not work well in this case. Although a portable @command{awk} program
can use a series of @code{substr} calls on @code{$0}
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}),
+(@pxref{String Functions, ,String Manipulation Functions}),
this is awkward and inefficient for a large number of fields.
+@cindex fatal errors
+@cindex @command{w} utility
The splitting of an input record into fixed-width fields is specified by
assigning a string containing space-separated numbers to the built-in
-variable @code{FIELDWIDTHS}. Each number specifies the width of the field
+variable @code{FIELDWIDTHS}. Each number specifies the width of the field,
@emph{including} columns between fields. If you want to ignore the columns
between fields, you can specify the width as a separate field that is
subsequently ignored.
-
-The following data is the output of the Unix @code{w} utility. It is useful
-to illustrate the use of @code{FIELDWIDTHS}.
+It is a fatal error to supply a field width that is not a positive number.
+The following data is the output of the Unix @command{w} utility. It is useful
+to illustrate the use of @code{FIELDWIDTHS}:
@example
@group
10:06pm up 21 days, 14:04, 23 users
User tty login@ idle JCPU PCPU what
-hzuo ttyV0 8:58pm 9 5 vi p24.tex
-hzang ttyV3 6:37pm 50 -csh
-eklye ttyV5 9:53pm 7 1 em thes.tex
-dportein ttyV6 8:17pm 1:47 -csh
-gierd ttyD3 10:00pm 1 elm
-dave ttyD4 9:47pm 4 4 w
-brent ttyp0 26Jun91 4:46 26:46 4:41 bash
+hzuo ttyV0 8:58pm 9 5 vi p24.tex
+hzang ttyV3 6:37pm 50 -csh
+eklye ttyV5 9:53pm 7 1 em thes.tex
+dportein ttyV6 8:17pm 1:47 -csh
+gierd ttyD3 10:00pm 1 elm
+dave ttyD4 9:47pm 4 4 w
+brent ttyp0 26Jun91 4:46 26:46 4:41 bash
dave ttyq4 26Jun9115days 46 46 wnewmail
-@end group
+@end group
@end example
The following program takes the above input, converts the idle time to
-number of seconds and prints out the first two fields and the calculated
-idle time. (This program uses a number of @code{awk} features that
-haven't been introduced yet.)
+number of seconds, and prints out the first two fields and the calculated
+idle time.
+
+@strong{Note:}
+This program uses a number of @command{awk} features that
+haven't been introduced yet.
@example
BEGIN @{ FIELDWIDTHS = "9 6 10 6 7 7 35" @}
@@ -3930,22 +4724,18 @@ NR > 2 @{
sub(/^ */, "", idle) # strip leading spaces
if (idle == "")
idle = 0
-@group
if (idle ~ /:/) @{
split(idle, t, ":")
idle = t[1] * 60 + t[2]
@}
-@end group
-@group
if (idle ~ /days/)
idle *= 24 * 60 * 60
-
+
print $1, $2, idle
@}
-@end group
@end example
-Here is the result of running the program on the data:
+Running the program on the data produces the following results:
@example
hzuo ttyV0 0
@@ -3959,26 +4749,40 @@ dave ttyq4 1296000
@end example
Another (possibly more practical) example of fixed-width input data
-would be the input from a deck of balloting cards. In some parts of
+is the input from a deck of balloting cards. In some parts of
the United States, voters mark their choices by punching holes in computer
cards. These cards are then processed to count the votes for any particular
-candidate or on any particular issue. Since a voter may choose not to
-vote on some issue, any column on the card may be empty. An @code{awk}
+candidate or on any particular issue. Because a voter may choose not to
+vote on some issue, any column on the card may be empty. An @command{awk}
program for processing such data could use the @code{FIELDWIDTHS} feature
-to simplify reading the data. (Of course, getting @code{gawk} to run on
+to simplify reading the data. (Of course, getting @command{gawk} to run on
a system with card readers is another story!)
@ignore
Exercise: Write a ballot card reading program
@end ignore
-Assigning a value to @code{FS} causes @code{gawk} to return to using
+Assigning a value to @code{FS} causes @command{gawk} to return to using
@code{FS} for field splitting. Use @samp{FS = FS} to make this happen,
without having to know the current value of @code{FS}.
+In order to tell which kind of field splitting is in effect,
+use @code{PROCINFO["FS"]}
+(@pxref{Auto-set, ,Built-in Variables That Convey Information}).
+The value is @code{"FS"} if regular field splitting is being used,
+or it is @code{"FIELDWIDTHS"} if fixed-width field splitting is being used:
-This feature is still experimental, and may evolve over time.
-Note that in particular, @code{gawk} does not attempt to verify
-the sanity of the values used in the value of @code{FIELDWIDTHS}.
+@example
+if (PROCINFO["FS"] == "FS")
+ @var{regular field splitting} @dots{}
+else
+ @var{fixed-width field splitting} @dots{}
+@end example
+
+This information is useful when writing a function
+that needs to temporarily change @code{FS} or @code{FIELDWIDTHS},
+read some records, and then restore the original settings
+(@pxref{Passwd Functions, ,Reading the User Database},
+for an example of such a function).
@node Multiple Line, Getline, Constant Size, Reading Files
@section Multiple-Line Records
@@ -3987,17 +4791,13 @@ the sanity of the values used in the value of @code{FIELDWIDTHS}.
@cindex input, multiple line records
@cindex reading files, multiple line records
@cindex records, multiple line
-In some data bases, a single line cannot conveniently hold all the
-information in one entry. In such cases, you can use multi-line
-records.
-
-The first step in doing this is to choose your data format: when records
-are not defined as single lines, how do you want to define them?
-What should separate records?
+In some databases, a single line cannot conveniently hold all the
+information in one entry. In such cases, you can use multiline
+records. The first step in doing this is to choose your data format.
One technique is to use an unusual character or string to separate
records. For example, you could use the formfeed character (written
-@samp{\f} in @code{awk}, as in C) to separate them, making each record
+@samp{\f} in @command{awk}, as in C) to separate them, making each record
a page of the file. To do this, just set the variable @code{RS} to
@code{"\f"} (a string containing the formfeed character). Any
other character could equally well be used, as long as it won't be part
@@ -4005,57 +4805,57 @@ of the data in a record.
Another technique is to have blank lines separate records. By a special
dispensation, an empty string as the value of @code{RS} indicates that
-records are separated by one or more blank lines. If you set @code{RS}
-to the empty string, a record always ends at the first blank line
-encountered. And the next record doesn't start until the first non-blank
-line that follows---no matter how many blank lines appear in a row, they
-are considered one record-separator.
+records are separated by one or more blank lines. When @code{RS} is set
+to the empty string, each record always ends at the first blank line
+encountered. The next record doesn't start until the first non-blank
+line that follows. No matter how many blank lines appear in a row, they
+all act as one record separator.
+(Blank lines must be completely empty; lines that contain only
+whitespace do not count.)
@cindex leftmost longest match
@cindex matching, leftmost longest
You can achieve the same effect as @samp{RS = ""} by assigning the
string @code{"\n\n+"} to @code{RS}. This regexp matches the newline
-at the end of the record, and one or more blank lines after the record.
+at the end of the record and one or more blank lines after the record.
In addition, a regular expression always matches the longest possible
sequence when there is a choice
(@pxref{Leftmost Longest, ,How Much Text Matches?}).
So the next record doesn't start until
the first non-blank line that follows---no matter how many blank lines
-appear in a row, they are considered one record-separator.
+appear in a row, they are considered one record separator.
@cindex dark corner
There is an important difference between @samp{RS = ""} and
@samp{RS = "\n\n+"}. In the first case, leading newlines in the input
-data file are ignored, and if a file ends without extra blank lines
+@value{DF} are ignored, and if a file ends without extra blank lines
after the last record, the final newline is removed from the record.
-In the second case, this special processing is not done (d.c.).
+In the second case, this special processing is not done.
+@value{DARKCORNER}
Now that the input is separated into records, the second step is to
separate the fields in the record. One way to do this is to divide each
of the lines into fields in the normal manner. This happens by default
-as the result of a special feature: when @code{RS} is set to the empty
+as the result of a special feature. When @code{RS} is set to the empty
string, the newline character @emph{always} acts as a field separator.
This is in addition to whatever field separations result from @code{FS}.
The original motivation for this special exception was probably to provide
-useful behavior in the default case (i.e.@: @code{FS} is equal
+useful behavior in the default case (i.e., @code{FS} is equal
to @w{@code{" "}}). This feature can be a problem if you really don't
-want the newline character to separate fields, since there is no way to
+want the newline character to separate fields, because there is no way to
prevent it. However, you can work around this by using the @code{split}
function to break up the record manually
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
Another way to separate fields is to
put each field on a separate line: to do this, just set the
variable @code{FS} to the string @code{"\n"}. (This simple regular
expression matches a single newline.)
-
-A practical example of a data file organized this way might be a mailing
-list, where each entry is separated by blank lines. If we have a mailing
+A practical example of a @value{DF} organized this way might be a mailing
+list, where each entry is separated by blank lines. Consider a mailing
list in a file named @file{addresses}, that looks like this:
-@c NEEDED
-@page
@example
Jane Doe
123 Main Street
@@ -4068,10 +4868,9 @@ Smallville, MW 98765-4321
@end example
@noindent
-A simple program to process this file would look like this:
+A simple program to process this file is as follows:
@example
-@group
# addrs.awk --- simple mailing list program
# Records are separated by blank lines.
@@ -4084,39 +4883,41 @@ BEGIN @{ RS = "" ; FS = "\n" @}
print "City and State are:", $3
print ""
@}
-@end group
@end example
Running the program produces the following output:
@example
-@group
$ awk -f addrs.awk addresses
@print{} Name is: Jane Doe
@print{} Address is: 123 Main Street
@print{} City and State are: Anywhere, SE 12345-6789
@print{}
-@end group
-@group
@print{} Name is: John Smith
@print{} Address is: 456 Tree-lined Avenue
@print{} City and State are: Smallville, MW 98765-4321
@print{}
@dots{}
-@end group
@end example
@xref{Labels Program, ,Printing Mailing Labels}, for a more realistic
program that deals with address lists.
+The following
+table
+summarizes how records are split, based on the
+value of
+@ifinfo
+@code{RS}.
+(@samp{==} means ``is equal to.'')
+@end ifinfo
+@ifnotinfo
+@code{RS}:
+@end ifnotinfo
-The following table summarizes how records are split, based on the
-value of @code{RS}. (@samp{==} means ``is equal to.'')
-
-@c @cartouche
@table @code
@item RS == "\n"
Records are separated by the newline character (@samp{\n}). In effect,
-every line in the data file is a separate record, including blank lines.
+every line in the @value{DF} is a separate record, including blank lines.
This is the default.
@item RS == @var{any single character}
@@ -4131,78 +4932,78 @@ always serves as a field separator, in addition to whatever value
@item RS == @var{regexp}
Records are separated by occurrences of characters that match @var{regexp}.
Leading and trailing matches of @var{regexp} delimit empty records.
+(This is a @command{gawk} extension, it is not specified by the
+POSIX standard.)
@end table
-@c @end cartouche
-@vindex RT
-In all cases, @code{gawk} sets @code{RT} to the input text that matched the
+@cindex @code{RT} variable
+In all cases, @command{gawk} sets @code{RT} to the input text that matched the
value specified by @code{RS}.
@node Getline, , Multiple Line, Reading Files
@section Explicit Input with @code{getline}
-@findex getline
+@cindex @code{getline} built-in function
@cindex input, explicit
@cindex explicit input
@cindex input, @code{getline} command
@cindex reading files, @code{getline} command
-So far we have been getting our input data from @code{awk}'s main
+So far we have been getting our input data from @command{awk}'s main
input stream---either the standard input (usually your terminal, sometimes
the output from another program) or from the
-files specified on the command line. The @code{awk} language has a
+files specified on the command line. The @command{awk} language has a
special built-in command called @code{getline} that
can be used to read input under your explicit control.
-@menu
-* Getline Intro:: Introduction to the @code{getline} function.
-* Plain Getline:: Using @code{getline} with no arguments.
-* Getline/Variable:: Using @code{getline} into a variable.
-* Getline/File:: Using @code{getline} from a file.
-* Getline/Variable/File:: Using @code{getline} into a variable from a
- file.
-* Getline/Pipe:: Using @code{getline} from a pipe.
-* Getline/Variable/Pipe:: Using @code{getline} into a variable from a
- pipe.
-* Getline Summary:: Summary Of @code{getline} Variants.
-@end menu
-
-@node Getline Intro, Plain Getline, Getline, Getline
-@subsection Introduction to @code{getline}
-
-This command is used in several different ways, and should @emph{not} be
-used by beginners. It is covered here because this is the chapter on input.
+The @code{getline} command is used in several different ways and should
+@emph{not} be used by beginners.
The examples that follow the explanation of the @code{getline} command
include material that has not been covered yet. Therefore, come back
and study the @code{getline} command @emph{after} you have reviewed the
-rest of this @value{DOCUMENT} and have a good knowledge of how @code{awk} works.
+rest of this @value{DOCUMENT} and have a good knowledge of how @command{awk} works.
-@vindex ERRNO
-@cindex differences between @code{gawk} and @code{awk}
+@cindex @code{ERRNO} variable
+@cindex differences between @command{gawk} and @command{awk}
@cindex @code{getline}, return values
-@code{getline} returns one if it finds a record, and zero if the end of the
-file is encountered. If there is some error in getting a record, such
-as a file that cannot be opened, then @code{getline} returns @minus{}1.
-In this case, @code{gawk} sets the variable @code{ERRNO} to a string
-describing the error that occurred.
+The @code{getline} command returns one if it finds a record and zero if
+the end of the file is encountered. If there is some error in getting
+a record, such as a file that cannot be opened, then @code{getline}
+returns @minus{}1. In this case, @command{gawk} sets the variable
+@code{ERRNO} to a string describing the error that occurred.
In the following examples, @var{command} stands for a string value that
represents a shell command.
-@node Plain Getline, Getline/Variable, Getline Intro, Getline
+@menu
+* Plain Getline:: Using @code{getline} with no arguments.
+* Getline/Variable:: Using @code{getline} into a variable.
+* Getline/File:: Using @code{getline} from a file.
+* Getline/Variable/File:: Using @code{getline} into a variable from a
+ file.
+* Getline/Pipe:: Using @code{getline} from a pipe.
+* Getline/Variable/Pipe:: Using @code{getline} into a variable from a
+ pipe.
+* Getline/Coprocess:: Using @code{getline} from a coprocess.
+* Getline/Variable/Coprocess:: Using @code{getline} into a variable from a
+ coprocess.
+* Getline Notes:: Important things to know about @code{getline}.
+* Getline Summary:: Summary of @code{getline} Variants.
+@end menu
+
+@node Plain Getline, Getline/Variable, Getline, Getline
@subsection Using @code{getline} with No Arguments
The @code{getline} command can be used without arguments to read input
from the current input file. All it does in this case is read the next
input record and split it up into fields. This is useful if you've
-finished processing the current record, but you want to do some special
+finished processing the current record, but want to do some special
processing @emph{right now} on the next record. Here's an
example:
@example
-@group
-awk '@{
+@{
if ((t = index($0, "/*")) != 0) @{
- # value will be "" if t is 1
+ # value of `tmp' will be "" if t is 1
tmp = substr($0, 1, t - 1)
u = index(substr($0, t + 2), "*/")
while (u == 0) @{
@@ -4215,58 +5016,63 @@ awk '@{
t = -1
u = index($0, "*/")
@}
-@end group
-@group
# substr expression will be "" if */
# occurred at end of line
- $0 = tmp substr($0, t + u + 3)
+ $0 = tmp substr($0, u + 2)
@}
print $0
-@}'
-@end group
+@}
@end example
-This @code{awk} program deletes all C-style comments, @samp{/* @dots{}
-*/}, from the input. By replacing the @samp{print $0} with other
+This @command{awk} program deletes all C-style comments (@samp{/* @dots{}
+*/}) from the input. By replacing the @samp{print $0} with other
statements, you could perform more complicated processing on the
-decommented input, like searching for matches of a regular
-expression. This program has a subtle problem---it does not work if one
-comment ends and another begins on the same line.
+decommented input, such as searching for matches of a regular
+expression. (This program has a subtle problem---it does not work if one
+comment ends and another begins on the same line.)
@ignore
Exercise,
write a program that does handle multiple comments on the line.
@end ignore
-This form of the @code{getline} command sets @code{NF} (the number of
-fields; @pxref{Fields, ,Examining Fields}), @code{NR} (the number of
-records read so far; @pxref{Records, ,How Input is Split into Records}),
-@code{FNR} (the number of records read from this input file), and the
-value of @code{$0}.
+This form of the @code{getline} command sets @code{NF},
+@code{NR}, @code{FNR}, and the value of @code{$0}.
-@cindex dark corner
-@strong{Note:} the new value of @code{$0} is used in testing
+@strong{Note:} The new value of @code{$0} is used to test
the patterns of any subsequent rules. The original value
-of @code{$0} that triggered the rule which executed @code{getline}
-is lost (d.c.).
+of @code{$0} that triggered the rule that executed @code{getline}
+is lost.
By contrast, the @code{next} statement reads a new record
but immediately begins processing it normally, starting with the first
rule in the program. @xref{Next Statement, ,The @code{next} Statement}.
@node Getline/Variable, Getline/File, Plain Getline, Getline
-@subsection Using @code{getline} Into a Variable
+@subsection Using @code{getline} into a Variable
You can use @samp{getline @var{var}} to read the next record from
-@code{awk}'s input into the variable @var{var}. No other processing is
+@command{awk}'s input into the variable @var{var}. No other processing is
done.
-
-For example, suppose the next line is a comment, or a special string,
-and you want to read it, without triggering
+For example, suppose the next line is a comment or a special string,
+and you want to read it without triggering
any rules. This form of @code{getline} allows you to read that line
and store it in a variable so that the main
-read-a-line-and-check-each-rule loop of @code{awk} never sees it.
+read-a-line-and-check-each-rule loop of @command{awk} never sees it.
+The following example swaps every two lines of input.
+The program is as follows:
+
+@example
+@{
+ if ((getline tmp) > 0) @{
+ print tmp
+ print $0
+ @} else
+ print $0
+@}
+@end example
-The following example swaps every two lines of input. For example, given:
+@noindent
+It takes the following list:
@example
wan
@@ -4276,7 +5082,7 @@ phore
@end example
@noindent
-it outputs:
+and produces these results:
@example
tew
@@ -4285,21 +5091,6 @@ phore
free
@end example
-@noindent
-Here's the program:
-
-@example
-@group
-awk '@{
- if ((getline tmp) > 0) @{
- print tmp
- print $0
- @} else
- print $0
-@}'
-@end group
-@end example
-
The @code{getline} command used in this way sets only the variables
@code{NR} and @code{FNR} (and of course, @var{var}). The record is not
split into fields, so the values of the fields (including @code{$0}) and
@@ -4310,80 +5101,66 @@ the value of @code{NF} do not change.
@cindex input redirection
@cindex redirection of input
-Use @samp{getline < @var{file}} to read
-the next record from the file
-@var{file}. Here @var{file} is a string-valued expression that
-specifies the file name. @samp{< @var{file}} is called a @dfn{redirection}
-since it directs input to come from a different place.
-
+@cindex @code{<} I/O operator
+Use @samp{getline < @var{file}} to read the next record from @var{file}.
+Here @var{file} is a string-valued expression that
+specifies the @value{FN}. @samp{< @var{file}} is called a @dfn{redirection}
+because it directs input to come from a different place.
For example, the following
program reads its input record from the file @file{secondary.input} when it
encounters a first field with a value equal to 10 in the current input
-file.
+file:
@example
-@group
-awk '@{
+@{
if ($1 == 10) @{
getline < "secondary.input"
print
@} else
print
-@}'
-@end group
+@}
@end example
-Since the main input stream is not used, the values of @code{NR} and
-@code{FNR} are not changed. But the record read is split into fields in
-the normal manner, so the values of @code{$0} and other fields are
-changed. So is the value of @code{NF}.
+Because the main input stream is not used, the values of @code{NR} and
+@code{FNR} are not changed. However, the record it reads is split into fields in
+the normal manner, so the values of @code{$0} and the other fields are
+changed, resulting in a new value of @code{NF}.
@c Thanks to Paul Eggert for initial wording here
According to POSIX, @samp{getline < @var{expression}} is ambiguous if
@var{expression} contains unparenthesized operators other than
@samp{$}; for example, @samp{getline < dir "/" file} is ambiguous
-because the concatenation operator is not parenthesized, and you should
+because the concatenation operator is not parenthesized. You should
write it as @samp{getline < (dir "/" file)} if you want your program
-to be portable to other @code{awk} implementations.
+to be portable to other @command{awk} implementations.
+(It happens that @command{gawk} gets it right, but you should not
+rely on this. Parentheses make it easier to read.)
@node Getline/Variable/File, Getline/Pipe, Getline/File, Getline
-@subsection Using @code{getline} Into a Variable from a File
+@subsection Using @code{getline} into a Variable from a File
Use @samp{getline @var{var} < @var{file}} to read input
-the file
-@var{file} and put it in the variable @var{var}. As above, @var{file}
+from the file
+@var{file}, and put it in the variable @var{var}. As above, @var{file}
is a string-valued expression that specifies the file from which to read.
In this version of @code{getline}, none of the built-in variables are
-changed, and the record is not split into fields. The only variable
+changed and the record is not split into fields. The only variable
changed is @var{var}.
-
-@ifinfo
-@c Thanks to Paul Eggert for initial wording here
-According to POSIX, @samp{getline @var{var} < @var{expression}} is ambiguous if
-@var{expression} contains unparenthesized operators other than
-@samp{$}; for example, @samp{getline < dir "/" file} is ambiguous
-because the concatenation operator is not parenthesized, and you should
-write it as @samp{getline < (dir "/" file)} if you want your program
-to be portable to other @code{awk} implementations.
-@end ifinfo
-
For example, the following program copies all the input files to the
output, except for records that say @w{@samp{@@include @var{filename}}}.
Such a record is replaced by the contents of the file
-@var{filename}.
+@var{filename}:
@example
-@group
-awk '@{
+@{
if (NF == 2 && $1 == "@@include") @{
while ((getline line < $2) > 0)
print line
close($2)
@} else
print
-@}'
-@end group
+@}
@end example
Note here how the name of the extra input file is not built into
@@ -4393,11 +5170,11 @@ the @samp{@@include} line.
The @code{close} function is called to ensure that if two identical
@samp{@@include} lines appear in the input, the entire specified file is
included twice.
-@xref{Close Files And Pipes, ,Closing Input and Output Files and Pipes}.
+@xref{Close Files And Pipes, ,Closing Input and Output Redirections}.
One deficiency of this program is that it does not process nested
@samp{@@include} statements
-(@samp{@@include} statements in included files)
+(i.e., @samp{@@include} statements in included files)
the way a true macro preprocessor would.
@xref{Igawk Program, ,An Easy Way to Use Library Functions}, for a program
that does handle nested @samp{@@include} statements.
@@ -4405,21 +5182,20 @@ that does handle nested @samp{@@include} statements.
@node Getline/Pipe, Getline/Variable/Pipe, Getline/Variable/File, Getline
@subsection Using @code{getline} from a Pipe
+@cindex @code{|} I/O operator
@cindex input pipeline
@cindex pipeline, input
-You can pipe the output of a command into @code{getline}, using
+The output of a command can also be piped into @code{getline}, using
@samp{@var{command} | getline}. In
this case, the string @var{command} is run as a shell command and its output
-is piped into @code{awk} to be used as input. This form of @code{getline}
+is piped into @command{awk} to be used as input. This form of @code{getline}
reads one record at a time from the pipe.
-
For example, the following program copies its input to its output, except for
lines that begin with @samp{@@execute}, which are replaced by the output
produced by running the rest of the line as a shell command:
@example
-@group
-awk '@{
+@{
if ($1 == "@@execute") @{
tmp = substr($0, 10)
while ((tmp | getline) > 0)
@@ -4427,35 +5203,35 @@ awk '@{
close(tmp)
@} else
print
-@}'
-@end group
+@}
@end example
@noindent
The @code{close} function is called to ensure that if two identical
@samp{@@execute} lines appear in the input, the command is run for
each one.
-@xref{Close Files And Pipes, ,Closing Input and Output Files and Pipes}.
+@ifnottex
+@xref{Close Files And Pipes, ,Closing Input and Output Redirections}.
+@end ifnottex
@c Exercise!!
@c This example is unrealistic, since you could just use system
-
Given the input:
@example
-@group
foo
bar
baz
@@execute who
bletch
-@end group
@end example
@noindent
the program might produce:
+@cindex Robbins, Bill
+@cindex Robbins, Miriam
+@cindex Robbins, Arnold
@example
-@group
foo
bar
baz
@@ -4463,13 +5239,12 @@ arnold ttyv0 Jul 13 14:22
miriam ttyp0 Jul 13 14:23 (murphy:0)
bill ttyp1 Jul 13 14:23 (murphy:0)
bletch
-@end group
@end example
@noindent
-Notice that this program ran the command @code{who} and printed the result.
+Notice that this program ran the command @command{who} and printed the result.
(If you try this program yourself, you will of course get different results,
-showing you who is logged in on your system.)
+depending upon who is logged in on your system.)
This variation of @code{getline} splits the record into fields, sets the
value of @code{NF} and recomputes the value of @code{$0}. The values of
@@ -4478,112 +5253,190 @@ value of @code{NF} and recomputes the value of @code{$0}. The values of
@c Thanks to Paul Eggert for initial wording here
According to POSIX, @samp{@var{expression} | getline} is ambiguous if
@var{expression} contains unparenthesized operators other than
-@samp{$}; for example, @samp{"echo " "date" | getline} is ambiguous
-because the concatenation operator is not parenthesized, and you should
-write it as @samp{("echo " "date") | getline} if you want your program
-to be portable to other @code{awk} implementations.
-(It happens that @code{gawk} gets it right, but you should not
-rely on this. Parentheses make it easier to read, anyway.)
+@samp{$}---for example, @samp{@w{"echo "} "date" | getline} is ambiguous
+because the concatenation operator is not parenthesized. You should
+write it as @samp{(@w{"echo "} "date") | getline} if you want your program
+to be portable to other @command{awk} implementations.
+@ifinfo
+(It happens that @command{gawk} gets it right, but you should not
+rely on this. Parentheses make it easier to read, anyway.)
+@end ifinfo
-@node Getline/Variable/Pipe, Getline Summary, Getline/Pipe, Getline
-@subsection Using @code{getline} Into a Variable from a Pipe
+@node Getline/Variable/Pipe, Getline/Coprocess, Getline/Pipe, Getline
+@subsection Using @code{getline} into a Variable from a Pipe
When you use @samp{@var{command} | getline @var{var}}, the
-output of the command @var{command} is sent through a pipe to
+output of @var{command} is sent through a pipe to
@code{getline} and into the variable @var{var}. For example, the
following program reads the current date and time into the variable
-@code{current_time}, using the @code{date} utility, and then
-prints it.
+@code{current_time}, using the @command{date} utility, and then
+prints it:
@example
-@group
-awk 'BEGIN @{
+BEGIN @{
"date" | getline current_time
close("date")
print "Report printed on " current_time
-@}'
-@end group
+@}
@end example
In this version of @code{getline}, none of the built-in variables are
-changed, and the record is not split into fields.
+changed and the record is not split into fields.
@ifinfo
@c Thanks to Paul Eggert for initial wording here
According to POSIX, @samp{@var{expression} | getline @var{var}} is ambiguous if
@var{expression} contains unparenthesized operators other than
-@samp{$}; for example, @samp{"echo " "date" | getline @var{var}} is ambiguous
-because the concatenation operator is not parenthesized, and you should
-write it as @samp{("echo " "date") | getline @var{var}} if you want your
-program to be portable to other @code{awk} implementations.
-(It happens that @code{gawk} gets it right, but you should not
-rely on this. Parentheses make it easier to read, anyway.)
+@samp{$}; for example, @samp{@w{"echo "} "date" | getline @var{var}} is ambiguous
+because the concatenation operator is not parenthesized. You should
+write it as @samp{(@w{"echo "} "date") | getline @var{var}} if you want your
+program to be portable to other @command{awk} implementations.
+(It happens that @command{gawk} gets it right, but you should not
+rely on this. Parentheses make it easier to read, anyway.)
@end ifinfo
-@node Getline Summary, , Getline/Variable/Pipe, Getline
-@subsection Summary of @code{getline} Variants
+@node Getline/Coprocess, Getline/Variable/Coprocess, Getline/Variable/Pipe, Getline
+@subsection Using @code{getline} from a Coprocess
+@cindex coprocess
+@cindex @code{|&} I/O operator
+@cindex differences between @command{gawk} and @command{awk}
+
+Input into @code{getline} from a pipe is a one-way operation.
+The command that is started with @samp{@var{command} | getline} only
+sends data @emph{to} your @command{awk} program.
-With all the forms of @code{getline}, even though @code{$0} and @code{NF},
-may be updated, the record will not be tested against all the patterns
-in the @code{awk} program, in the way that would happen if the record
-were read normally by the main processing loop of @code{awk}. However
-the new record is tested against any subsequent rules.
+On occasion, you might want to send data to another program
+for processing and then read the results back.
+@command{gawk} allows you start a @dfn{coprocess}, with which two-way
+communications are possible. This is done with the @samp{|&}
+operator.
+Typically, you write data to the coprocess first, and then
+read results back, as shown in the following:
-@cindex differences between @code{gawk} and @code{awk}
+@example
+print "@var{some query}" |& "db_server"
+"db_server" |& getline
+@end example
+
+@noindent
+which sends a query to @command{db_server} and then reads the results.
+
+The values of @code{NR} and
+@code{FNR} are not changed,
+because the main input stream is not used.
+However, the record is split into fields in
+the normal manner, thus changing the values of @code{$0}, the other fields,
+and of @code{NF}.
+
+Coprocesses are an advanced feature. They are discussed here only because
+this is the @value{SECTION} on @code{getline}.
+@xref{Two-way I/O, ,Two-Way Communications with Another Process},
+where coprocesses are discussed in more detail.
+
+@node Getline/Variable/Coprocess, Getline Notes, Getline/Coprocess, Getline
+@subsection Using @code{getline} into a Variable from a Coprocess
+
+When you use @samp{@var{command} |& getline @var{var}}, the output from
+the coprocess @var{command} is sent through a two-way pipe to @code{getline}
+and into the variable @var{var}.
+
+In this version of @code{getline}, none of the built-in variables are
+changed and the record is not split into fields. The only variable
+changed is @var{var}.
+
+@ifinfo
+Coprocesses are an advanced feature. They are discussed here only because
+this is the @value{SECTION} on @code{getline}.
+@xref{Two-way I/O, ,Two-Way Communications with Another Process},
+where coprocesses are discussed in more detail.
+@end ifinfo
+
+@node Getline Notes, Getline Summary, Getline/Variable/Coprocess, Getline
+@subsection Points About @code{getline} to Remember
+Here are some miscellaneous points about @code{getline} that
+you should bear in mind:
+
+@itemize @bullet
+@item
+When @code{getline} changes the value of @code{$0} and @code{NF},
+@command{awk} does @emph{not} automatically jump to the start of the
+program and start testing the new record against every pattern.
+However, the new record is tested against any subsequent rules.
+
+@cindex differences between @command{gawk} and @command{awk}
@cindex limitations
@cindex implementation limits
-Many @code{awk} implementations limit the number of pipelines an @code{awk}
-program may have open to just one! In @code{gawk}, there is no such limit.
-You can open as many pipelines as the underlying operating system will
-permit.
+@item
+Many @command{awk} implementations limit the number of pipelines that an @command{awk}
+program may have open to just one. In @command{gawk}, there is no such limit.
+You can open as many pipelines (and coprocesses) as the underlying operating
+system permits.
-@vindex FILENAME
+@cindex side effects
+@cindex @code{FILENAME} variable
@cindex dark corner
@cindex @code{getline}, setting @code{FILENAME}
@cindex @code{FILENAME}, being set by @code{getline}
-An interesting side-effect occurs if you use @code{getline} (without a
-redirection) inside a @code{BEGIN} rule. Since an unredirected @code{getline}
-reads from the command line data files, the first @code{getline} command
-causes @code{awk} to set the value of @code{FILENAME}. Normally,
-@code{FILENAME} does not have a value inside @code{BEGIN} rules, since you
-have not yet started to process the command line data files (d.c.).
+@item
+An interesting side effect occurs if you use @code{getline} without a
+redirection inside a @code{BEGIN} rule. Because an unredirected @code{getline}
+reads from the command-line @value{DF}s, the first @code{getline} command
+causes @command{awk} to set the value of @code{FILENAME}. Normally,
+@code{FILENAME} does not have a value inside @code{BEGIN} rules, because you
+have not yet started to process the command-line @value{DF}s.
+@value{DARKCORNER}
(@xref{BEGIN/END, , The @code{BEGIN} and @code{END} Special Patterns},
-also @pxref{Auto-set, , Built-in Variables that Convey Information}.)
+also @pxref{Auto-set, ,Built-in Variables That Convey Information}.)
+@end itemize
-The following table summarizes the six variants of @code{getline},
+@node Getline Summary, , Getline Notes, Getline
+@subsection Summary of @code{getline} Variants
+
+The following table summarizes the eight variants of @code{getline},
listing which built-in variables are set by each one.
-@c @cartouche
-@table @code
-@item getline
-sets @code{$0}, @code{NF}, @code{FNR}, and @code{NR}.
+@multitable {@var{command} @code{|& getline} @var{var}} {1234567890123456789012345678901234567890}
+@item @code{getline} @tab Sets @code{$0}, @code{NF}, @code{FNR} and @code{NR}
-@item getline @var{var}
-sets @var{var}, @code{FNR}, and @code{NR}.
+@item @code{getline} @var{var} @tab Sets @var{var}, @code{FNR} and @code{NR}
-@item getline < @var{file}
-sets @code{$0}, and @code{NF}.
+@item @code{getline <} @var{file} @tab Sets @code{$0} and @code{NF}
-@item getline @var{var} < @var{file}
-sets @var{var}.
+@item @code{getline @var{var} < @var{file}} @tab Sets @var{var}
-@item @var{command} | getline
-sets @code{$0}, and @code{NF}.
+@item @var{command} @code{| getline} @tab Sets @code{$0} and @code{NF}
-@item @var{command} | getline @var{var}
-sets @var{var}.
-@end table
-@c @end cartouche
+@item @var{command} @code{| getline} @var{var} @tab Sets @var{var}
+
+@item @var{command} @code{|& getline} @tab Sets @code{$0} and @code{NF}
+(this is a @command{gawk} extension)
+
+@item @var{command} @code{|& getline} @var{var} @tab Sets @var{var}
+(this is a @command{gawk} extension)
+@end multitable
@node Printing, Expressions, Reading Files, Top
@chapter Printing Output
@cindex printing
@cindex output
-One of the most common actions is to @dfn{print}, or output,
-some or all of the input. You use the @code{print} statement
-for simple output. You use the @code{printf} statement
-for fancier formatting. Both are described in this chapter.
+One of the most common programming actions is to @dfn{print} or output,
+some or all of the input. Use the @code{print} statement
+for simple output, and the @code{printf} statement
+for fancier formatting.
+The @code{print} statement is not limited when
+computing @emph{which} values to print. However, with two exceptions,
+you cannot specify @emph{how} to print them---how many
+columns, whether to use exponential notation or not, and so on.
+(For the exceptions, @pxref{Output Separators}, and
+@ref{OFMT, ,Controlling Numeric Output with @code{print}}.)
+For that, you need the @code{printf} statement
+(@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing}).
+
+Besides basic and formatted printing, this @value{CHAPTER}
+also covers I/O redirections to files and pipes, introduces
+the special @value{FN}s that @command{gawk} processes internally,
+and discusses the @code{close} built-in function.
@menu
* Print:: The @code{print} statement.
@@ -4593,8 +5446,8 @@ for fancier formatting. Both are described in this chapter.
* Printf:: The @code{printf} statement.
* Redirection:: How to redirect output to multiple files and
pipes.
-* Special Files:: File name interpretation in @code{gawk}.
- @code{gawk} allows access to inherited file
+* Special Files:: File name interpretation in @command{gawk}.
+ @command{gawk} allows access to inherited file
descriptors.
* Close Files And Pipes:: Closing Input and Output Files and Pipes.
@end menu
@@ -4603,8 +5456,8 @@ for fancier formatting. Both are described in this chapter.
@section The @code{print} Statement
@cindex @code{print} statement
-The @code{print} statement does output with simple, standardized
-formatting. You specify only the strings or numbers to be printed, in a
+The @code{print} statement is used to produce output with simple, standardized
+formatting. Specify only the strings or numbers to print, in a
list separated by commas. They are output, separated by single spaces,
followed by a newline. The statement looks like this:
@@ -4613,67 +5466,53 @@ print @var{item1}, @var{item2}, @dots{}
@end example
@noindent
-The entire list of items may optionally be enclosed in parentheses. The
+The entire list of items may be optionally enclosed in parentheses. The
parentheses are necessary if any of the item expressions uses the @samp{>}
relational operator; otherwise it could be confused with a redirection
(@pxref{Redirection, ,Redirecting Output of @code{print} and @code{printf}}).
-The items to be printed can be constant strings or numbers, fields of the
-current record (such as @code{$1}), variables, or any @code{awk}
-expressions.
-Numeric values are converted to strings, and then printed.
-
-The @code{print} statement is completely general for
-computing @emph{what} values to print. However, with two exceptions,
-you cannot specify @emph{how} to print them---how many
-columns, whether to use exponential notation or not, and so on.
-(For the exceptions, @pxref{Output Separators}, and
-@ref{OFMT, ,Controlling Numeric Output with @code{print}}.)
-For that, you need the @code{printf} statement
-(@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing}).
+The items to print can be constant strings or numbers, fields of the
+current record (such as @code{$1}), variables, or any @command{awk}
+expression. Numeric values are converted to strings and then printed.
The simple statement @samp{print} with no items is equivalent to
@samp{print $0}: it prints the entire current record. To print a blank
line, use @samp{print ""}, where @code{""} is the empty string.
-
-To print a fixed piece of text, use a string constant such as
-@w{@code{"Don't Panic"}} as one item. If you forget to use the
-double-quote characters, your text will be taken as an @code{awk}
-expression, and you will probably get an error. Keep in mind that a
+To print a fixed piece of text, use a string constant, such as
+@w{@code{"Don't Panic"}}, as one item. If you forget to use the
+double quote characters, your text is taken as an @command{awk}
+expression and you will probably get an error. Keep in mind that a
space is printed between any two items.
-Each @code{print} statement makes at least one line of output. But it
-isn't limited to one line. If an item value is a string that contains a
-newline, the newline is output along with the rest of the string. A
-single @code{print} can make any number of lines this way.
-
@node Print Examples, Output Separators, Print, Printing
@section Examples of @code{print} Statements
-Here is an example of printing a string that contains embedded newlines
+Each @code{print} statement makes at least one line of output. However, it
+isn't limited to only one line. If an item value is a string that contains a
+newline, the newline is output along with the rest of the string. A
+single @code{print} statement can make any number of lines this way.
+
+The following is an example of printing a string that contains embedded newlines
(the @samp{\n} is an escape sequence, used to represent the newline
character; @pxref{Escape Sequences}):
@example
-@group
$ awk 'BEGIN @{ print "line one\nline two\nline three" @}'
@print{} line one
@print{} line two
@print{} line three
-@end group
@end example
-Here is an example that prints the first two fields of each input record,
-with a space between them:
+The next example, which is run on the @file{inventory-shipped} file,
+prints the first two fields of each input record, with a space between
+them:
@example
-@group
$ awk '@{ print $1, $2 @}' inventory-shipped
@print{} Jan 13
@print{} Feb 15
@print{} Mar 15
@dots{}
-@end group
@end example
@cindex common mistakes
@@ -4682,26 +5521,24 @@ $ awk '@{ print $1, $2 @}' inventory-shipped
A common mistake in using the @code{print} statement is to omit the comma
between two items. This often has the effect of making the items run
together in the output, with no space. The reason for this is that
-juxtaposing two string expressions in @code{awk} means to concatenate
+juxtaposing two string expressions in @command{awk} means to concatenate
them. Here is the same program, without the comma:
@example
-@group
$ awk '@{ print $1 $2 @}' inventory-shipped
@print{} Jan13
@print{} Feb15
@print{} Mar15
@dots{}
-@end group
@end example
-To someone unfamiliar with the file @file{inventory-shipped}, neither
+To someone unfamiliar with the @file{inventory-shipped} file, neither
example's output makes much sense. A heading line at the beginning
would make it clearer. Let's add some headings to our table of months
(@code{$1}) and green crates shipped (@code{$2}). We do this using the
@code{BEGIN} pattern
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns})
-to force the headings to be printed only once:
+so that the headings are only printed once:
@example
awk 'BEGIN @{ print "Month Crates"
@@ -4710,77 +5547,79 @@ awk 'BEGIN @{ print "Month Crates"
@end example
@noindent
-Did you already guess what happens? When run, the program prints
-the following:
+When run, the program prints the following:
@example
-@group
Month Crates
----- ------
Jan 13
Feb 15
Mar 15
@dots{}
-@end group
@end example
@noindent
-The headings and the table data don't line up! We can fix this by printing
-some spaces between the two fields:
+The only problem, however, is that the headings and the table data
+don't line up! We can fix this by printing some spaces between the
+two fields:
@example
+@group
awk 'BEGIN @{ print "Month Crates"
print "----- ------" @}
@{ print $1, " ", $2 @}' inventory-shipped
+@end group
@end example
-You can imagine that this way of lining up columns can get pretty
-complicated when you have many columns to fix. Counting spaces for two
-or three columns can be simple, but more than this and you can get
-lost quite easily. This is why the @code{printf} statement was
+Lining up columns this way can get pretty
+complicated when there are many columns to fix. Counting spaces for two
+or three columns is simple, but any more than this can take up
+a lot of time. This is why the @code{printf} statement was
created (@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing});
one of its specialties is lining up columns of data.
@cindex line continuation
-As a side point,
-you can continue either a @code{print} or @code{printf} statement simply
-by putting a newline after any comma
-(@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}).
+@strong{Note:} You can continue either a @code{print} or
+@code{printf} statement simply by putting a newline after any comma
+(@pxref{Statements/Lines, ,@command{awk} Statements Versus Lines}).
@node Output Separators, OFMT, Print Examples, Printing
@section Output Separators
@cindex output field separator, @code{OFS}
@cindex output record separator, @code{ORS}
-@vindex OFS
-@vindex ORS
+@cindex @code{OFS} variable
+@cindex @code{ORS} variable
As mentioned previously, a @code{print} statement contains a list
-of items, separated by commas. In the output, the items are normally
-separated by single spaces. This need not be the case; a
-single space is only the default. You can specify any string of
-characters to use as the @dfn{output field separator} by setting the
+of items separated by commas. In the output, the items are normally
+separated by single spaces. However, this doesn't need to be the case;
+a single space is only the default. Any string of
+characters may be used as the @dfn{output field separator} by setting the
built-in variable @code{OFS}. The initial value of this variable
-is the string @w{@code{" "}}, that is, a single space.
+is the string @w{@code{" "}}---that is, a single space.
The output from an entire @code{print} statement is called an
@dfn{output record}. Each @code{print} statement outputs one output
-record and then outputs a string called the @dfn{output record separator}.
-The built-in variable @code{ORS} specifies this string. The initial
-value of @code{ORS} is the string @code{"\n"}, i.e.@: a newline
-character; thus, normally each @code{print} statement makes a separate line.
+record, and then outputs a string called the @dfn{output record separator}
+(or @code{ORS}). The initial
+value of @code{ORS} is the string @code{"\n"}; i.e., a newline
+character. Thus, each @code{print} statement normally makes a separate line.
-You can change how output fields and records are separated by assigning
-new values to the variables @code{OFS} and/or @code{ORS}. The usual
+In order to change how output fields and records are separated, assign
+new values to the variables @code{OFS} and @code{ORS}. The usual
place to do this is in the @code{BEGIN} rule
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}), so
-that it happens before any input is processed. You may also do this
-with assignments on the command line, before the names of your input
-files, or using the @samp{-v} command line option
-(@pxref{Options, ,Command Line Options}).
+that it happens before any input is processed. It can also be done
+with assignments on the command line, before the names of the input
+files, or using the @option{-v} command-line option
+(@pxref{Options, ,Command-Line Options}).
+The following example prints the first and second fields of each input
+record, separated by a semicolon, with a blank line added after each
+newline:
@ignore
Exercise,
-Rewrite the
+Rewrite the
@example
awk 'BEGIN @{ print "Month Crates"
print "----- ------" @}
@@ -4789,12 +5628,7 @@ awk 'BEGIN @{ print "Month Crates"
program by using a new value of @code{OFS}.
@end ignore
-The following example prints the first and second fields of each input
-record separated by a semicolon, with a blank line added after each
-line:
-
@example
-@group
$ awk 'BEGIN @{ OFS = ";"; ORS = "\n\n" @}
> @{ print $1, $2 @}' BBS-list
@print{} aardvark;555-5553
@@ -4803,24 +5637,22 @@ $ awk 'BEGIN @{ OFS = ";"; ORS = "\n\n" @}
@print{}
@print{} barfly;555-7685
@dots{}
-@end group
@end example
-If the value of @code{ORS} does not contain a newline, all your output
-will be run together on a single line, unless you output newlines some
-other way.
+If the value of @code{ORS} does not contain a newline, the program's output
+is run together on a single line.
@node OFMT, Printf, Output Separators, Printing
@section Controlling Numeric Output with @code{print}
-@vindex OFMT
+@cindex @code{OFMT} variable
@cindex numeric output format
@cindex format, numeric output
@cindex output format specifier, @code{OFMT}
-When you use the @code{print} statement to print numeric values,
-@code{awk} internally converts the number to a string of characters,
-and prints that string. @code{awk} uses the @code{sprintf} function
+When the @code{print} statement is used to print numeric values,
+@command{awk} internally converts the number to a string of characters
+and prints that string. @command{awk} uses the @code{sprintf} function
to do this conversion
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
For now, it suffices to say that the @code{sprintf}
function accepts a @dfn{format specification} that tells it how to format
numbers (or strings), and that there are a number of different ways in which
@@ -4832,39 +5664,39 @@ The built-in variable @code{OFMT} contains the default format specification
that @code{print} uses with @code{sprintf} when it wants to convert a
number to a string for printing.
The default value of @code{OFMT} is @code{"%.6g"}.
-By supplying different format specifications
-as the value of @code{OFMT}, you can change how @code{print} will print
-your numbers. As a brief example:
+The way @code{print} prints numbers can be changed
+by supplying different format specifications
+as the value of @code{OFMT}, as shown in the following example:
@example
-@group
$ awk 'BEGIN @{
> OFMT = "%.0f" # print numbers as integers (rounds)
-> print 17.23 @}'
-@print{} 17
-@end group
+> print 17.23, 17.54 @}'
+@print{} 17 18
@end example
@noindent
@cindex dark corner
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-According to the POSIX standard, @code{awk}'s behavior will be undefined
-if @code{OFMT} contains anything but a floating point conversion specification
-(d.c.).
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+According to the POSIX standard, @command{awk}'s behavior is undefined
+if @code{OFMT} contains anything but a floating-point conversion specification.
+@value{DARKCORNER}
@node Printf, Redirection, OFMT, Printing
@section Using @code{printf} Statements for Fancier Printing
@cindex formatted output
@cindex output, formatted
+@cindex @code{printf} statement
-If you want more precise control over the output format than
-@code{print} gives you, use @code{printf}. With @code{printf} you can
-specify the width to use for each item, and you can specify various
-formatting choices for numbers (such as what radix to use, whether to
+For more precise control over the output format than what is
+normally provided by @code{print}, use @code{printf}.
+@code{printf} can be used to
+specify the width to use for each item, as well as various
+formatting choices for numbers (such as what output base to use, whether to
print an exponent, whether to print a sign, and how many digits to print
-after the decimal point). You do this by supplying a string, called
-the @dfn{format string}, which controls how and where to print the other
+after the decimal point). This is done by supplying a string, called
+the @dfn{format string}, that controls how and where to print the other
arguments.
@menu
@@ -4878,7 +5710,7 @@ arguments.
@subsection Introduction to the @code{printf} Statement
@cindex @code{printf} statement, syntax of
-The @code{printf} statement looks like this:
+A simple @code{printf} statement looks like this:
@example
printf @var{format}, @var{item1}, @var{item2}, @dots{}
@@ -4887,130 +5719,125 @@ printf @var{format}, @var{item1}, @var{item2}, @dots{}
@noindent
The entire list of arguments may optionally be enclosed in parentheses. The
parentheses are necessary if any of the item expressions use the @samp{>}
-relational operator; otherwise it could be confused with a redirection
+relational operator; otherwise it can be confused with a redirection
(@pxref{Redirection, ,Redirecting Output of @code{print} and @code{printf}}).
@cindex format string
The difference between @code{printf} and @code{print} is the @var{format}
argument. This is an expression whose value is taken as a string; it
-specifies how to output each of the other arguments. It is called
-the @dfn{format string}.
+specifies how to output each of the other arguments. It is called the
+@dfn{format string}.
-The format string is very similar to that in the ANSI C library function
-@code{printf}. Most of @var{format} is text to be output verbatim.
-Scattered among this text are @dfn{format specifiers}, one per item.
-Each format specifier says to output the next item in the argument list
+The format string is very similar to that in the ISO C library function
+@code{printf}. Most of @var{format} is text to output verbatim.
+Scattered among this text are @dfn{format specifiers}---one per item.
+Each format specifier says to output the next item in the argument list
at that place in the format.
-The @code{printf} statement does not automatically append a newline to its
-output. It outputs only what the format string specifies. So if you want
-a newline, you must include one in the format string. The output separator
-variables @code{OFS} and @code{ORS} have no effect on @code{printf}
-statements. For example:
+The @code{printf} statement does not automatically append a newline
+to its output. It outputs only what the format string specifies.
+So if a newline is needed, you must include one in the format string.
+The output separator variables @code{OFS} and @code{ORS} have no effect
+on @code{printf} statements. For example:
@example
-@group
-BEGIN @{
- ORS = "\nOUCH!\n"; OFS = "!"
- msg = "Don't Panic!"; printf "%s\n", msg
-@}
-@end group
+$ awk 'BEGIN @{
+> ORS = "\nOUCH!\n"; OFS = "+"
+> msg = "Dont Panic!"
+> printf "%s\n", msg
+> @}'
+@print{} Dont Panic!
@end example
-This program still prints the familiar @samp{Don't Panic!} message.
+@noindent
+Here, neither the @samp{+} nor the @samp{OUCH} appear when
+the message is printed.
@node Control Letters, Format Modifiers, Basic Printf, Printf
@subsection Format-Control Letters
@cindex @code{printf}, format-control characters
-@cindex format specifier
-
-A format specifier starts with the character @samp{%} and ends with a
-@dfn{format-control letter}; it tells the @code{printf} statement how
-to output one item. (If you actually want to output a @samp{%}, write
-@samp{%%}.) The format-control letter specifies what kind of value to
-print. The rest of the format specifier is made up of optional
-@dfn{modifiers} which are parameters to use, such as the field width.
+@cindex format specifier, @code{printf}
-Here is a list of the format-control letters:
+A format specifier starts with the character @samp{%} and ends with
+a @dfn{format-control letter}---it tells the @code{printf} statement
+how to output one item. The format-control letter specifies what @emph{kind}
+of value to print. The rest of the format specifier is made up of
+optional @dfn{modifiers} that control @emph{how} to print the value, such as
+the field width. Here is a list of the format-control letters:
@table @code
-@item c
-This prints a number as an ASCII character. Thus, @samp{printf "%c",
-65} outputs the letter @samp{A}. The output for a string value is
-the first character of the string.
+@item %c
+This prints a number as an ASCII character; thus, @samp{printf "%c",
+65} outputs the letter @samp{A}. (The output for a string value is
+the first character of the string.)
-@item d
-@itemx i
-These are equivalent. They both print a decimal integer.
-The @samp{%i} specification is for compatibility with ANSI C.
+@item %d@r{,} %i
+These are equivalent; they both print a decimal integer.
+(The @samp{%i} specification is for compatibility with ISO C.)
-@item e
-@itemx E
-This prints a number in scientific (exponential) notation.
-For example,
+@item %e@r{,} %E
+These print a number in scientific (exponential) notation;
+for example:
@example
printf "%4.3e\n", 1950
@end example
@noindent
-prints @samp{1.950e+03}, with a total of four significant figures of
-which three follow the decimal point. The @samp{4.3} are modifiers,
-discussed below. @samp{%E} uses @samp{E} instead of @samp{e} in the output.
+prints @samp{1.950e+03}, with a total of four significant figures, three of
+which follow the decimal point.
+(The @samp{4.3} represents two modifiers,
+discussed in the next @value{SUBSECTION}.)
+@samp{%E} uses @samp{E} instead of @samp{e} in the output.
-@item f
-This prints a number in floating point notation.
-For example,
+@item %f
+This prints a number in floating-point notation.
+For example:
@example
printf "%4.3f", 1950
@end example
@noindent
-prints @samp{1950.000}, with a total of four significant figures of
-which three follow the decimal point. The @samp{4.3} are modifiers,
-discussed below.
-
-@item g
-@itemx G
-This prints a number in either scientific notation or floating point
-notation, whichever uses fewer characters. If the result is printed in
+prints @samp{1950.000}, with a total of four significant figures, three of
+which follow the decimal point.
+(The @samp{4.3} represents two modifiers,
+discussed in the next @value{SUBSECTION}.)
+
+@item %g@r{,} %G
+These print a number in either scientific notation or in floating-point
+notation, whichever uses fewer characters; if the result is printed in
scientific notation, @samp{%G} uses @samp{E} instead of @samp{e}.
-@item o
+@item %o
This prints an unsigned octal integer.
-(In octal, or base-eight notation, the digits run from @samp{0} to @samp{7};
-the decimal number eight is represented as @samp{10} in octal.)
-@item s
+@item %s
This prints a string.
-@item u
-This prints an unsigned decimal number.
-(This format is of marginal use, since all numbers in @code{awk}
-are floating point. It is provided primarily for compatibility
-with C.)
-
-@item x
-@itemx X
-This prints an unsigned hexadecimal integer.
-(In hexadecimal, or base-16 notation, the digits are @samp{0} through @samp{9}
-and @samp{a} through @samp{f}. The hexadecimal digit @samp{f} represents
-the decimal number 15.) @samp{%X} uses the letters @samp{A} through @samp{F}
+@item %u
+This prints an unsigned decimal integer.
+(This format is of marginal use, because all numbers in @command{awk}
+are floating-point; it is provided primarily for compatibility with C.)
+
+@item %x@r{,} %X
+These print an unsigned hexadecimal integer;
+@samp{%X} uses the letters @samp{A} through @samp{F}
instead of @samp{a} through @samp{f}.
-@item %
-This isn't really a format-control letter, but it does have a meaning
-when used after a @samp{%}: the sequence @samp{%%} outputs one
-@samp{%}. It does not consume an argument, and it ignores any
-modifiers.
+@item %%
+This isn't a format-control letter but it does have meaning---the
+sequence @samp{%%} outputs one @samp{%}; it does not consume an
+argument and it ignores any modifiers.
@end table
@cindex dark corner
+@strong{Note:}
When using the integer format-control letters for values that are outside
-the range of a C @code{long} integer, @code{gawk} will switch to the
-@samp{%g} format specifier. Other versions of @code{awk} may print
-invalid values, or do something else entirely (d.c.).
+the range of a C @code{long} integer, @command{gawk} switches to the
+@samp{%g} format specifier. Other versions of @command{awk} may print
+invalid values or do something else entirely.
+@value{DARKCORNER}
@node Format Modifiers, Printf Examples, Control Letters, Printf
@subsection Modifiers for @code{printf} Formats
@@ -5018,18 +5845,46 @@ invalid values, or do something else entirely (d.c.).
@cindex @code{printf}, modifiers
@cindex modifiers (in format specifiers)
A format specification can also include @dfn{modifiers} that can control
-how much of the item's value is printed and how much space it gets. The
-modifiers come between the @samp{%} and the format-control letter.
-In the examples below, we use the bullet symbol ``@bullet{}'' to represent
+how much of the item's value is printed, as well as how much space it gets.
+The modifiers come between the @samp{%} and the format-control letter.
+We will use the bullet symbol ``@bullet{}'' in the following examples to
+represent
spaces in the output. Here are the possible modifiers, in the order in
which they may appear:
@table @code
+@cindex differences between @command{gawk} and @command{awk}
+@cindex @code{printf}, positional specifier
+@cindex positional specifier, @code{printf}
+@item @var{N}$
+An integer constant followed by a @samp{$} is a @dfn{positional specifier}.
+Normally, format specifications are applied to arguments in the order
+given in the format string. With a positional specifier, the format
+specification is applied to a specific argument, instead of what
+would be the next argument in the list. Positional specifiers begin
+counting with one:
+
+@example
+printf "%s %s\n", "don't", "panic"
+printf "%2$s %1$s\n", "panic", "don't"
+@end example
+
+@noindent
+prints the famous friendly message twice.
+
+At first glance, this feature doesn't seem to be of much use.
+It is in fact a @command{gawk} extension, intended for use in translating
+messages at runtime.
+@xref{Printf Ordering, , Rearranging @code{printf} Arguments},
+which describes how and why to use positional specifiers.
+For now, we will not use them.
+
@item -
-The minus sign, used before the width modifier (see below),
+The minus sign, used before the width modifier (see further on in
+this table),
says to left-justify
-the argument within its specified width. Normally the argument
-is printed right-justified in the specified width. Thus,
+the argument within its specified width. Normally, the argument
+is printed right-justified in the specified width. Thus:
@example
printf "%-4s", "foo"
@@ -5039,36 +5894,38 @@ printf "%-4s", "foo"
prints @samp{foo@bullet{}}.
@item @var{space}
-For numeric conversions, prefix positive values with a space, and
+For numeric conversions, prefix positive values with a space and
negative values with a minus sign.
@item +
-The plus sign, used before the width modifier (see below),
+The plus sign, used before the width modifier (see further on in
+this table),
says to always supply a sign for numeric conversions, even if the data
-to be formatted is positive. The @samp{+} overrides the space modifier.
+to format is positive. The @samp{+} overrides the space modifier.
@item #
Use an ``alternate form'' for certain control letters.
For @samp{%o}, supply a leading zero.
-For @samp{%x}, and @samp{%X}, supply a leading @samp{0x} or @samp{0X} for
-a non-zero result.
-For @samp{%e}, @samp{%E}, and @samp{%f}, the result will always contain a
+For @samp{%x} and @samp{%X}, supply a leading @samp{0x} or @samp{0X} for
+a nonzero result.
+For @samp{%e}, @samp{%E}, and @samp{%f}, the result always contains a
decimal point.
-For @samp{%g}, and @samp{%G}, trailing zeros are not removed from the result.
+For @samp{%g} and @samp{%G}, trailing zeros are not removed from the result.
@cindex dark corner
@item 0
-A leading @samp{0} (zero) acts as a flag, that indicates output should be
+A leading @samp{0} (zero) acts as a flag that indicates that output should be
padded with zeros instead of spaces.
-This applies even to non-numeric output formats (d.c.).
+This applies even to non-numeric output formats.
+@value{DARKCORNER}
This flag only has an effect when the field width is wider than the
-value to be printed.
+value to print.
@item @var{width}
This is a number specifying the desired minimum width of a field. Inserting any
-number between the @samp{%} sign and the format control character forces the
-field to be expanded to this width. The default way to do this is to
-pad with spaces on the left. For example,
+number between the @samp{%} sign and the format-control character forces the
+field to expand to this width. The default way to do this is to
+pad with spaces on the left. For example:
@example
printf "%4s", "foo"
@@ -5079,7 +5936,7 @@ prints @samp{@bullet{}foo}.
The value of @var{width} is a minimum width, not a maximum. If the item
value requires more than @var{width} characters, it can be as wide as
-necessary. Thus,
+necessary. Thus, the following:
@example
printf "%4s", "foobar"
@@ -5092,14 +5949,25 @@ Preceding the @var{width} with a minus sign causes the output to be
padded with spaces on the right, instead of on the left.
@item .@var{prec}
-This is a number that specifies the precision to use when printing.
-For the @samp{e}, @samp{E}, and @samp{f} formats, this specifies the
-number of digits you want printed to the right of the decimal point.
-For the @samp{g}, and @samp{G} formats, it specifies the maximum number
-of significant digits. For the @samp{d}, @samp{o}, @samp{i}, @samp{u},
-@samp{x}, and @samp{X} formats, it specifies the minimum number of
-digits to print. For a string, it specifies the maximum number of
-characters from the string that should be printed. Thus,
+A period followed by an integer constant
+specifies the precision to use when printing.
+The meaning of the precision varies by control letter:
+
+@table @asis
+@item @code{%e}, @code{%E}, @code{%f}
+Number of digits to the right of the decimal point.
+
+@item @code{%g}, @code{%G}
+Maximum number of significant digits.
+
+@item @code{%d}, @code{%i}, @code{%o}, @code{%u}, @code{%x}, @code{%X}
+Minimum number of digits to print.
+
+@item @code{%s}
+Maximum number of characters from the string that should print.
+@end table
+
+Thus, the following:
@example
printf "%.4s", "foobar"
@@ -5112,7 +5980,7 @@ prints @samp{foob}.
The C library @code{printf}'s dynamic @var{width} and @var{prec}
capability (for example, @code{"%*.*s"}) is supported. Instead of
supplying explicit @var{width} and/or @var{prec} values in the format
-string, you pass them in the argument list. For example:
+string, they are passed in the argument list. For example:
@example
w = 5
@@ -5122,7 +5990,7 @@ printf "%*.*s\n", w, p, s
@end example
@noindent
-is exactly equivalent to
+is exactly equivalent to:
@example
s = "abcdefg"
@@ -5131,8 +5999,7 @@ printf "%5.3s\n", s
@noindent
Both programs output @samp{@w{@bullet{}@bullet{}abc}}.
-
-Earlier versions of @code{awk} did not support this capability.
+Earlier versions of @command{awk} did not support this capability.
If you must use such a version, you may simulate this feature by using
concatenation to build up the format string, like so:
@@ -5144,35 +6011,40 @@ printf "%" w "." p "s\n", s
@end example
@noindent
-This is not particularly easy to read, but it does work.
-
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-C programmers may be used to supplying additional @samp{l} and @samp{h}
-flags in @code{printf} format strings. These are not valid in @code{awk}.
-Most @code{awk} implementations silently ignore these flags.
-If @samp{--lint} is provided on the command line
-(@pxref{Options, ,Command Line Options}),
-@code{gawk} will warn about their use. If @samp{--posix} is supplied,
+This is not particularly easy to read but it does work.
+
+@cindex fatal errors
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@cindex lint checks
+C programmers may be used to supplying additional
+@samp{l}, @samp{L}, and @samp{h}
+modifiers in @code{printf} format strings. These are not valid in @command{awk}.
+Most @command{awk} implementations silently ignore these modifiers.
+If @option{--lint} is provided on the command line
+(@pxref{Options, ,Command-Line Options}),
+@command{gawk} warns about their use. If @option{--posix} is supplied,
their use is a fatal error.
-@node Printf Examples, , Format Modifiers, Printf
+@node Printf Examples, , Format Modifiers, Printf
@subsection Examples Using @code{printf}
-Here is how to use @code{printf} to make an aligned table:
+The following is a simple example of
+how to use @code{printf} to make an aligned table:
@example
awk '@{ printf "%-10s %s\n", $1, $2 @}' BBS-list
@end example
@noindent
-prints the names of bulletin boards (@code{$1}) of the file
-@file{BBS-list} as a string of 10 characters, left justified. It also
-prints the phone numbers (@code{$2}) afterward on the line. This
-produces an aligned two-column table of names and phone numbers:
+This command
+prints the names of the bulletin boards (@code{$1}) in the file
+@file{BBS-list} as a string of 10 characters that are left-justified. It also
+prints the phone numbers (@code{$2}) next on the line. This
+produces an aligned two-column table of names and phone numbers,
+as shown here:
@example
-@group
$ awk '@{ printf "%-10s %s\n", $1, $2 @}' BBS-list
@print{} aardvark 555-5553
@print{} alpo-net 555-3412
@@ -5185,66 +6057,59 @@ $ awk '@{ printf "%-10s %s\n", $1, $2 @}' BBS-list
@print{} macfoo 555-6480
@print{} sdace 555-3430
@print{} sabafoo 555-2127
-@end group
@end example
-Did you notice that we did not specify that the phone numbers be printed
-as numbers? They had to be printed as strings because the numbers are
-separated by a dash.
-If we had tried to print the phone numbers as numbers, all we would have
-gotten would have been the first three digits, @samp{555}.
+In this case, the phone numbers had to be printed as strings because
+the numbers are separated by a dash. Printing the phone numbers as
+numbers would have produced just the first three digits: @samp{555}.
This would have been pretty confusing.
-We did not specify a width for the phone numbers because they are the
-last things on their lines. We don't need to put spaces after them.
+It wasn't necessary to specify a width for the phone numbers because
+they are last on their lines. They don't need to have spaces
+after them.
-We could make our table look even nicer by adding headings to the tops
-of the columns. To do this, we use the @code{BEGIN} pattern
+The table could be made to look even nicer by adding headings to the
+tops of the columns. This is done using the @code{BEGIN} pattern
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns})
-to force the header to be printed only once, at the beginning of
-the @code{awk} program:
+so that the headers are only printed once, at the beginning of
+the @command{awk} program:
@example
-@group
awk 'BEGIN @{ print "Name Number"
print "---- ------" @}
@{ printf "%-10s %s\n", $1, $2 @}' BBS-list
-@end group
@end example
-Did you notice that we mixed @code{print} and @code{printf} statements in
-the above example? We could have used just @code{printf} statements to get
-the same results:
+The above example mixed @code{print} and @code{printf} statements in
+the same program. Using just @code{printf} statements can produce the
+same results:
@example
-@group
awk 'BEGIN @{ printf "%-10s %s\n", "Name", "Number"
printf "%-10s %s\n", "----", "------" @}
@{ printf "%-10s %s\n", $1, $2 @}' BBS-list
-@end group
@end example
@noindent
-By printing each column heading with the same format specification
-used for the elements of the column, we have made sure that the headings
+Printing each column heading with the same format specification
+used for the column elements ensures that the headings
are aligned just like the columns.
The fact that the same format specification is used three times can be
emphasized by storing it in a variable, like this:
@example
-@group
awk 'BEGIN @{ format = "%-10s %s\n"
printf format, "Name", "Number"
printf format, "----", "------" @}
@{ printf format, $1, $2 @}' BBS-list
-@end group
@end example
@c !!! exercise
-See if you can use the @code{printf} statement to line up the headings and
-table data for our @file{inventory-shipped} example covered earlier in the
-section on the @code{print} statement
+At this point, it would be a worthwhile exercise to use the
+@code{printf} statement to line up the headings and table data for the
+@file{inventory-shipped} example that was covered earlier in the @value{SECTION}
+on the @code{print} statement
(@pxref{Print, ,The @code{print} Statement}).
@node Redirection, Special Files, Printf, Printing
@@ -5252,82 +6117,84 @@ section on the @code{print} statement
@cindex output redirection
@cindex redirection of output
-So far we have been dealing only with output that prints to the standard
-output, usually your terminal. Both @code{print} and @code{printf} can
+So far, the output from @code{print} and @code{printf} has gone
+to the standard
+output, usually the terminal. Both @code{print} and @code{printf} can
also send their output to other places.
This is called @dfn{redirection}.
A redirection appears after the @code{print} or @code{printf} statement.
-Redirections in @code{awk} are written just like redirections in shell
-commands, except that they are written inside the @code{awk} program.
+Redirections in @command{awk} are written just like redirections in shell
+commands, except that they are written inside the @command{awk} program.
-There are three forms of output redirection: output to a file,
-output appended to a file, and output through a pipe to another
-command.
-They are all shown for
-the @code{print} statement, but they work identically for @code{printf}
-also.
+There are four forms of output redirection: output to a file, output
+appended to a file, output through a pipe to another command, and output
+to a coprocess. They are all shown for the @code{print} statement,
+but they work identically for @code{printf}:
@table @code
+@cindex @code{>} I/O operator
@item print @var{items} > @var{output-file}
-This type of redirection prints the items into the output file
-@var{output-file}. The file name @var{output-file} can be any
+This type of redirection prints the items into the output file named
+@var{output-file}. The @value{FN} @var{output-file} can be any
expression. Its value is changed to a string and then used as a
-file name (@pxref{Expressions}).
+@value{FN} (@pxref{Expressions}).
When this type of redirection is used, the @var{output-file} is erased
-before the first output is written to it. Subsequent writes
-to the same @var{output-file} do not
-erase @var{output-file}, but append to it. If @var{output-file} does
-not exist, then it is created.
-
-For example, here is how an @code{awk} program can write a list of
-BBS names to a file @file{name-list} and a list of phone numbers to a
-file @file{phone-list}. Each output file contains one name or number
-per line.
+before the first output is written to it. Subsequent writes to the same
+@var{output-file} do not erase @var{output-file}, but append to it.
+(This is different from how you use redirections in shell scripts.)
+If @var{output-file} does not exist, it is created. For example, here
+is how an @command{awk} program can write a list of BBS names to one
+file named @file{name-list}, and a list of phone numbers to another file
+named @file{phone-list}:
@example
-@group
$ awk '@{ print $2 > "phone-list"
> print $1 > "name-list" @}' BBS-list
-@end group
-@group
$ cat phone-list
@print{} 555-5553
@print{} 555-3412
@dots{}
-@end group
-@group
$ cat name-list
@print{} aardvark
@print{} alpo-net
@dots{}
-@end group
@end example
+@noindent
+Each output file contains one name or number per line.
+
+@cindex @code{>>} I/O operator
@item print @var{items} >> @var{output-file}
This type of redirection prints the items into the pre-existing output file
-@var{output-file}. The difference between this and the
+named @var{output-file}. The difference between this and the
single-@samp{>} redirection is that the old contents (if any) of
-@var{output-file} are not erased. Instead, the @code{awk} output is
+@var{output-file} are not erased. Instead, the @command{awk} output is
appended to the file.
If @var{output-file} does not exist, then it is created.
+@cindex @code{|} I/O operator
@cindex pipes for output
@cindex output, piping
@item print @var{items} | @var{command}
It is also possible to send output to another program through a pipe
-instead of into a
-file. This type of redirection opens a pipe to @var{command} and writes
-the values of @var{items} through this pipe, to another process created
-to execute @var{command}.
+instead of into a file. This type of redirection opens a pipe to
+@var{command}, and writes the values of @var{items} through this pipe
+to another process created to execute @var{command}.
-The redirection argument @var{command} is actually an @code{awk}
-expression. Its value is converted to a string, whose contents give the
-shell command to be run.
+The redirection argument @var{command} is actually an @command{awk}
+expression. Its value is converted to a string whose contents give
+the shell command to be run. For example, the following produces two
+files, one unsorted list of BBS names, and one list sorted in reverse
+alphabetical order:
-For example, this produces two files, one unsorted list of BBS names
-and one list sorted in reverse alphabetical order:
+@ignore
+10/2000:
+This isn't the best style, since COMMAND is assigned for each
+record. It's done to avoid overfull hboxes in TeX. Leave it
+alone for now and let's hope no-one notices.
+@end ignore
@example
awk '@{ print $1 > "names.unsorted"
@@ -5335,12 +6202,12 @@ awk '@{ print $1 > "names.unsorted"
print $1 | command @}' BBS-list
@end example
-Here the unsorted list is written with an ordinary redirection while
-the sorted list is written by piping through the @code{sort} utility.
+The unsorted list is written with an ordinary redirection, while
+the sorted list is written by piping through the @command{sort} utility.
-This example uses redirection to mail a message to a mailing
+The next example uses redirection to mail a message to the mailing
list @samp{bug-system}. This might be useful when trouble is encountered
-in an @code{awk} script run periodically for system maintenance.
+in an @command{awk} script run periodically for system maintenance:
@example
report = "mail bug-system"
@@ -5351,42 +6218,121 @@ close(report)
@end example
The message is built using string concatenation and saved in the variable
-@code{m}. It is then sent down the pipeline to the @code{mail} program.
+@code{m}. It is then sent down the pipeline to the @command{mail} program.
+(The parentheses group the items to concatenate---see
+@ref{Concatenation, ,String Concatenation}.)
-We call the @code{close} function here because it's a good idea to close
+The @code{close} function is called here because it's a good idea to close
the pipe as soon as all the intended output has been sent to it.
-@xref{Close Files And Pipes, ,Closing Input and Output Files and Pipes},
-for more information
-on this. This example also illustrates the use of a variable to represent
-a @var{file} or @var{command}: it is not necessary to always
+@xref{Close Files And Pipes, ,Closing Input and Output Redirections},
+for more information on this.
+
+This example also illustrates the use of a variable to represent
+a @var{file} or @var{command}---it is not necessary to always
use a string constant. Using a variable is generally a good idea,
-since @code{awk} requires you to spell the string value identically
+because @command{awk} requires that the string value be spelled identically
every time.
+
+@cindex coprocess
+@cindex @code{|&} I/O operator
+@cindex differences between @command{gawk} and @command{awk}
+@item print @var{items} |& @var{command}
+This type of redirection prints the items to the input of @var{command}.
+The difference between this and the
+single-@samp{|} redirection is that the output from @var{command}
+can be read with @code{getline}.
+Thus @var{command} is a @dfn{coprocess}, that works together with,
+but subsidiary to, the @command{awk} program.
+
+This feature is a @command{gawk} extension, and is not available in
+POSIX @command{awk}.
+@xref{Two-way I/O, ,Two-Way Communications with Another Process},
+for a more complete discussion.
@end table
-Redirecting output using @samp{>}, @samp{>>}, or @samp{|} asks the system
-to open a file or pipe only if the particular @var{file} or @var{command}
-you've specified has not already been written to by your program, or if
-it has been closed since it was last written to.
+Redirecting output using @samp{>}, @samp{>>}, @samp{|}, or @samp{|&}
+asks the system to open a file, pipe, or coprocess, only if the particular
+@var{file} or @var{command} you specify has not already been written
+to by your program or if it has been closed since it was last written to.
+
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+It is a common error to use @samp{>} redirection for the first @code{print}
+to a file, and then to use @samp{>>} for subsequent output:
-@cindex differences between @code{gawk} and @code{awk}
+@example
+# clear the file
+print "Don't panic" > "guide.txt"
+@dots{}
+# append
+print "Avoid improbability generators" >> "guide.txt"
+@end example
+
+@noindent
+This is indeed how redirections must be used from the shell. But in
+@command{awk}, it isn't necessary. In this kind of case, a program should
+use @samp{>} for all the @code{print} statements, since the output file
+is only opened once.
+
+@cindex differences between @command{gawk} and @command{awk}
@cindex limitations
@cindex implementation limits
-@iftex
+@ifnotinfo
As mentioned earlier
-(@pxref{Getline Summary, , Summary of @code{getline} Variants}),
+(@pxref{Getline Notes, ,Points About @code{getline} to Remember}),
many
-@end iftex
-@ifinfo
+@end ifnotinfo
+@ifnottex
Many
-@end ifinfo
-@code{awk} implementations limit the number of pipelines an @code{awk}
-program may have open to just one! In @code{gawk}, there is no such limit.
-You can open as many pipelines as the underlying operating system will
-permit.
+@end ifnottex
+@command{awk} implementations limit the number of pipelines that an @command{awk}
+program may have open to just one! In @command{gawk}, there is no such limit.
+@command{gawk} allows a program to
+open as many pipelines as the underlying operating system permits.
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Piping into @command{sh}
+@cindex advanced notes
+@cindex shell, piping commands into
+@cindex piping commands into the shell
+
+A particularly powerful way to use redirection is to build command lines,
+and pipe them into the shell, @command{sh}. For example, suppose you
+have a list of files brought over from a system where all the @value{FN}s
+are stored in uppercase, and you wish to rename them to have names in
+all lowercase. The following program is both simple and efficient:
-@node Special Files, Close Files And Pipes , Redirection, Printing
-@section Special File Names in @code{gawk}
+@cindex @command{mv} utility
+@example
+@{ printf("mv %s %s\n", $0, tolower($0)) | "sh" @}
+
+END @{ close("sh") @}
+@end example
+
+The @code{tolower} function returns its argument string with all
+uppercase characters converted to lowercase
+(@pxref{String Functions, ,String Manipulation Functions}).
+The program builds up a list of command lines,
+using the @command{mv} utility to rename the files.
+It then sends the list to the shell for execution.
+
+@node Special Files, Close Files And Pipes, Redirection, Printing
+@section Special @value{FFN}s in @command{gawk}
+
+@command{gawk} provides a number of special @value{FN}s that it interprets
+internally. These @value{FN}s provide access to standard file descriptors,
+process-related information, and TCP/IP networking.
+
+@menu
+* Special FD:: Special files for I/O.
+* Special Process:: Special files for process information.
+* Special Network:: Special files for network communications.
+* Special Caveats:: Things to watch out for.
+@end menu
+
+@node Special FD, Special Process, Special Files, Special Files
+@subsection Special Files for Standard Descriptors
@cindex standard input
@cindex standard output
@cindex standard error output
@@ -5397,50 +6343,49 @@ already available to them for reading and writing. These are known as
the @dfn{standard input}, @dfn{standard output}, and @dfn{standard error
output}. These streams are, by default, connected to your terminal, but
they are often redirected with the shell, via the @samp{<}, @samp{<<},
-@samp{>}, @samp{>>}, @samp{>&} and @samp{|} operators. Standard error
-is typically used for writing error messages; the reason we have two separate
-streams, standard output and standard error, is so that they can be
+@samp{>}, @samp{>>}, @samp{>&}, and @samp{|} operators. Standard error
+is typically used for writing error messages; the reason there are two separate
+streams, standard output, and standard error, is so that they can be
redirected separately.
-@cindex differences between @code{gawk} and @code{awk}
-In other implementations of @code{awk}, the only way to write an error
-message to standard error in an @code{awk} program is as follows:
+@cindex differences between @command{gawk} and @command{awk}
+In other implementations of @command{awk}, the only way to write an error
+message to standard error in an @command{awk} program is as follows:
@example
print "Serious error detected!" | "cat 1>&2"
@end example
@noindent
-This works by opening a pipeline to a shell command which can access the
-standard error stream which it inherits from the @code{awk} process.
-This is far from elegant, and is also inefficient, since it requires a
-separate process. So people writing @code{awk} programs often
-neglect to do this. Instead, they send the error messages to the
+This works by opening a pipeline to a shell command that can access the
+standard error stream that it inherits from the @command{awk} process.
+This is far from elegant, and it is also inefficient, because it requires a
+separate process. So people writing @command{awk} programs often
+don't do this. Instead, they send the error messages to the
terminal, like this:
@example
-@group
print "Serious error detected!" > "/dev/tty"
-@end group
@end example
@noindent
-This usually has the same effect, but not always: although the
-standard error stream is usually the terminal, it can be redirected, and
-when that happens, writing to the terminal is not correct. In fact, if
-@code{awk} is run from a background job, it may not have a terminal at all.
-Then opening @file{/dev/tty} will fail.
-
-@code{gawk} provides special file names for accessing the three standard
-streams. When you redirect input or output in @code{gawk}, if the file name
-matches one of these special names, then @code{gawk} directly uses the
-stream it stands for.
-
-@cindex @file{/dev/stdin}
-@cindex @file{/dev/stdout}
-@cindex @file{/dev/stderr}
-@cindex @file{/dev/fd}
-@c @cartouche
+This usually has the same effect but not always: although the
+standard error stream is usually the terminal, it can be redirected; when
+that happens, writing to the terminal is not correct. In fact, if
+@command{awk} is run from a background job, it may not have a terminal at all.
+Then opening @file{/dev/tty} fails.
+
+@command{gawk} provides special @value{FN}s for accessing the three standard
+streams, as well as any other inherited open files. If the @value{FN} matches
+one of these special names when @command{gawk} redirects input or output,
+then it directly uses the stream that the @value{FN} stands for.
+(These special @value{FN}s work for all operating systems that @command{gawk}
+has been ported to, not just those that are POSIX-compliant.):
+
+@cindex @file{/dev/stdin} special file
+@cindex @file{/dev/stdout} special file
+@cindex @file{/dev/stderr} special file
+@cindex @file{/dev/fd} special files
@table @file
@item /dev/stdin
The standard input (file descriptor 0).
@@ -5452,49 +6397,58 @@ The standard output (file descriptor 1).
The standard error output (file descriptor 2).
@item /dev/fd/@var{N}
-The file associated with file descriptor @var{N}. Such a file must have
-been opened by the program initiating the @code{awk} execution (typically
-the shell). Unless you take special pains in the shell from which
-you invoke @code{gawk}, only descriptors 0, 1 and 2 are available.
+The file associated with file descriptor @var{N}. Such a file must
+be opened by the program initiating the @command{awk} execution (typically
+the shell). Unless special pains are taken in the shell from which
+@command{gawk} is invoked, only descriptors 0, 1, and 2 are available.
@end table
-@c @end cartouche
-The file names @file{/dev/stdin}, @file{/dev/stdout}, and @file{/dev/stderr}
+The @value{FN}s @file{/dev/stdin}, @file{/dev/stdout}, and @file{/dev/stderr}
are aliases for @file{/dev/fd/0}, @file{/dev/fd/1}, and @file{/dev/fd/2},
-respectively, but they are more self-explanatory.
-
-The proper way to write an error message in a @code{gawk} program
+respectively. However, they are more self-explanatory.
+The proper way to write an error message in a @command{gawk} program
is to use @file{/dev/stderr}, like this:
@example
print "Serious error detected!" > "/dev/stderr"
@end example
-@code{gawk} also provides special file names that give access to information
-about the running @code{gawk} process. Each of these ``files'' provides
-a single record of information. To read them more than once, you must
-first close them with the @code{close} function
-(@pxref{Close Files And Pipes, ,Closing Input and Output Files and Pipes}).
-The filenames are:
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+Note the use of quotes around the @value{FN}.
+Like any other redirection, the value must be a string.
+It is a common error to omit the quotes, which leads
+to confusing results.
+@c Exercise: What does it do? :-)
+
+@node Special Process, Special Network, Special FD, Special Files
+@subsection Special Files for Process-Related Information
+
+@command{gawk} also provides special @value{FN}s that give access to information
+about the running @command{gawk} process. Each of these ``files'' provides
+a single record of information. To read them more than once, they must
+first be closed with the @code{close} function
+(@pxref{Close Files And Pipes, ,Closing Input and Output Redirections}).
+The @value{FN}s are:
@cindex process information
-@cindex @file{/dev/pid}
-@cindex @file{/dev/pgrpid}
-@cindex @file{/dev/ppid}
-@cindex @file{/dev/user}
-@c @cartouche
+@cindex @file{/dev/pid} special file
+@cindex @file{/dev/pgrpid} special file
+@cindex @file{/dev/ppid} special file
+@cindex @file{/dev/user} special file
@table @file
@item /dev/pid
Reading this file returns the process ID of the current process,
-in decimal, terminated with a newline.
+in decimal form, terminated with a newline.
-@item /dev/ppid
+@item /dev/ppid
Reading this file returns the parent process ID of the current process,
-in decimal, terminated with a newline.
+in decimal form, terminated with a newline.
-@item /dev/pgrpid
+@item /dev/pgrpid
Reading this file returns the process group ID of the current process,
-in decimal, terminated with a newline.
+in decimal form, terminated with a newline.
@item /dev/user
Reading this file returns a single record terminated with a newline.
@@ -5520,64 +6474,126 @@ The return value of the @code{getegid} system call
@end table
If there are any additional fields, they are the group IDs returned by
-@code{getgroups} system call.
+the @code{getgroups} system call.
(Multiple groups may not be supported on all systems.)
@end table
-@c @end cartouche
-These special file names may be used on the command line as data
-files, as well as for I/O redirections within an @code{awk} program.
-They may not be used as source files with the @samp{-f} option.
+These special @value{FN}s may be used on the command line as @value{DF}s,
+as well as for I/O redirections within an @command{awk} program.
+They may not be used as source files with the @option{-f} option.
+
+@cindex automatic warnings
+@cindex warnings, automatic
+@strong{Note:}
+The special files that provide process-related information are now considered
+obsolete and will disappear entirely
+in the next release of @command{gawk}.
+@command{gawk} prints a warning message every time you use one of
+these files.
+To obtain process-related information, use the @code{PROCINFO} array.
+@xref{Auto-set, ,Built-in Variables That Convey Information}.
+
+@node Special Network, Special Caveats, Special Process, Special Files
+@subsection Special Files for Network Communications
+
+Starting with @value{PVERSION} 3.1 of @command{gawk}, @command{awk} programs
+can open a two-way
+TCP/IP connection, acting as either a client or server.
+This is done using a special @value{FN} of the form:
-Recognition of these special file names is disabled if @code{gawk} is in
-compatibility mode (@pxref{Options, ,Command Line Options}).
+@example
+@file{/inet/@var{protocol}/@var{local-port}/@var{remote-host}/@var{remote-port}}
+@end example
+
+The @var{protocol} is one of @samp{tcp}, @samp{udp}, or @samp{raw},
+and the other fields represent the other essential pieces of information
+for making a networking connection.
+These @value{FN}s are used with the @samp{|&} operator for communicating
+with a coprocess
+(@pxref{Two-way I/O, ,Two-Way Communications with Another Process}).
+This is an advanced feature, mentioned here only for completeness.
+Full discussion is delayed until
+@ref{TCP/IP Networking, ,Using @command{gawk} for Network Programming}.
+
+@node Special Caveats, , Special Network, Special Files
+@subsection Special @value{FFN} Caveats
+
+Here is a list of things to bear in mind when using the
+special @value{FN}s that @command{gawk} provides.
-@strong{Caution}: Unless your system actually has a @file{/dev/fd} directory
-(or any of the other above listed special files),
-the interpretation of these file names is done by @code{gawk} itself.
-For example, using @samp{/dev/fd/4} for output will actually write on
-file descriptor 4, and not on a new file descriptor that was @code{dup}'ed
-from file descriptor 4. Most of the time this does not matter; however, it
-is important to @emph{not} close any of the files related to file descriptors
-0, 1, and 2. If you do close one of these files, unpredictable behavior
-will result.
+@itemize @bullet
+@item
+Recognition of these special @value{FN}s is disabled if @command{gawk} is in
+compatibility mode (@pxref{Options, ,Command-Line Options}).
-The special files that provide process-related information will disappear
-in a future version of @code{gawk}.
-@xref{Future Extensions, ,Probable Future Extensions}.
+@cindex automatic warnings
+@cindex warnings, automatic
+@item
+@ifnottex
+The
+@end ifnottex
+@ifnotinfo
+As mentioned earlier, the
+@end ifnotinfo
+special files that provide process-related information are now considered
+obsolete and will disappear entirely
+in the next release of @command{gawk}.
+@command{gawk} prints a warning message every time you use one of
+these files.
+@ifnottex
+To obtain process-related information, use the @code{PROCINFO} array.
+@xref{Built-in Variables}.
+@end ifnottex
+
+@item
+Starting with @value{PVERSION} 3.1, @command{gawk} @emph{always}
+interprets these special @value{FN}s.@footnote{Older versions of
+@command{gawk} would only interpret these names internally if the system
+did not actually have a a @file{/dev/fd} directory or any of the other
+above listed special files. Usually this didn't make a difference,
+but sometimes it did; thus, it was decided to make @command{gawk}'s
+behavior consistent on all systems and to have it always interpret
+the special @value{FN}s itself.}
+For example, using @samp{/dev/fd/4}
+for output actually writes on file descriptor 4, and not on a new
+file descriptor that is @code{dup}'ed from file descriptor 4. Most of
+the time this does not matter; however, it is important to @emph{not}
+close any of the files related to file descriptors 0, 1, and 2.
+Doing so results in unpredictable behavior.
+@end itemize
@node Close Files And Pipes, , Special Files, Printing
-@section Closing Input and Output Files and Pipes
+@section Closing Input and Output Redirections
@cindex closing input files and pipes
@cindex closing output files and pipes
-@findex close
-
-If the same file name or the same shell command is used with
-@code{getline}
-(@pxref{Getline, ,Explicit Input with @code{getline}})
-more than once during the execution of an @code{awk}
-program, the file is opened (or the command is executed) only the first time.
+@cindex closing coprocesses
+@cindex coprocess
+@cindex @code{close} built-in function
+
+If the same @value{FN} or the same shell command is used with @code{getline}
+more than once during the execution of an @command{awk} program
+(@pxref{Getline, ,Explicit Input with @code{getline}}),
+the file is opened (or the command is executed) the first time only.
At that time, the first record of input is read from that file or command.
-The next time the same file or command is used in @code{getline}, another
-record is read from it, and so on.
+The next time the same file or command is used with @code{getline},
+another record is read from it, and so on.
-Similarly, when a file or pipe is opened for output, the file name or command
-associated with
-it is remembered by @code{awk} and subsequent writes to the same file or
-command are appended to the previous writes. The file or pipe stays
-open until @code{awk} exits.
+Similarly, when a file or pipe is opened for output, the @value{FN} or
+command associated with it is remembered by @command{awk}, and subsequent
+writes to the same file or command are appended to the previous writes.
+The file or pipe stays open until @command{awk} exits.
-This implies that if you want to start reading the same file again from
-the beginning, or if you want to rerun a shell command (rather than
-reading more output from the command), you must take special steps.
-What you must do is use the @code{close} function, as follows:
+This implies that special steps are necessary in order to read the same
+file again from the beginning, or to rerun a shell command (rather than
+reading more output from the same command). The @code{close} function
+makes these things possible:
@example
close(@var{filename})
@end example
@noindent
-or
+or:
@example
close(@var{command})
@@ -5601,12 +6617,11 @@ close("sort -r names")
Once this function call is executed, the next @code{getline} from that
file or command, or the next @code{print} or @code{printf} to that
-file or command, will reopen the file or rerun the command.
-
+file or command, reopens the file or reruns the command.
Because the expression that you use to close a file or pipeline must
exactly match the expression used to open the file or run the command,
-it is good practice to use a variable to store the file name or command.
-The previous example would become
+it is good practice to use a variable to store the @value{FN} or command.
+The previous example becomes the following:
@example
sortcom = "sort -r names"
@@ -5616,77 +6631,170 @@ close(sortcom)
@end example
@noindent
-This helps avoid hard-to-find typographical errors in your @code{awk}
-programs.
-
-Here are some reasons why you might need to close an output file:
+This helps avoid hard-to-find typographical errors in your @command{awk}
+programs. Here are some of the reasons for closing an output file:
@itemize @bullet
@item
-To write a file and read it back later on in the same @code{awk}
-program. Close the file when you are finished writing it; then
-you can start reading it with @code{getline}.
+To write a file and read it back later on in the same @command{awk}
+program. Close the file after writing it, then
+begin reading it with @code{getline}.
@item
-To write numerous files, successively, in the same @code{awk}
-program. If you don't close the files, eventually you may exceed a
-system limit on the number of open files in one process. So close
-each one when you are finished writing it.
+To write numerous files, successively, in the same @command{awk}
+program. If the files aren't closed, eventually @command{awk} may exceed a
+system limit on the number of open files in one process. It is best to
+close each one when the program has finished writing it.
@item
-To make a command finish. When you redirect output through a pipe,
+To make a command finish. When output is redirected through a pipe,
the command reading the pipe normally continues to try to read input
as long as the pipe is open. Often this means the command cannot
-really do its work until the pipe is closed. For example, if you
-redirect output to the @code{mail} program, the message is not
+really do its work until the pipe is closed. For example, if
+output is redirected to the @command{mail} program, the message is not
actually sent until the pipe is closed.
-@c NEEDED
-@page
@item
To run the same program a second time, with the same arguments.
This is not the same thing as giving more input to the first run!
-For example, suppose you pipe output to the @code{mail} program. If you
-output several lines redirected to this pipe without closing it, they make
-a single message of several lines. By contrast, if you close the pipe
-after each line of output, then each line makes a separate message.
+For example, suppose a program pipes output to the @command{mail} program.
+If it outputs several lines redirected to this pipe without closing
+it, they make a single message of several lines. By contrast, if the
+program closes the pipe after each line of output, then each line makes
+a separate message.
@end itemize
-@vindex ERRNO
-@cindex differences between @code{gawk} and @code{awk}
-@code{close} returns a value of zero if the close succeeded.
-Otherwise, the value will be non-zero.
-In this case, @code{gawk} sets the variable @code{ERRNO} to a string
-describing the error that occurred.
-
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
@cindex portability issues
If you use more files than the system allows you to have open,
-@code{gawk} will attempt to multiplex the available open files among
-your data files. @code{gawk}'s ability to do this depends upon the
-facilities of your operating system: it may not always work. It is
+@command{gawk} attempts to multiplex the available open files among
+your @value{DF}s. @command{gawk}'s ability to do this depends upon the
+facilities of your operating system, so it may not always work. It is
therefore both good practice and good portability advice to always
use @code{close} on your files when you are done with them.
+In fact, if you are using a lot of pipes, it is essential that
+you close commands when done. For example, consider something like this:
+
+@example
+@{
+ @dots{}
+ command = ("grep " $1 " /some/file | my_prog -q " $3)
+ while ((command | getline) > 0) @{
+ @var{process output of} command
+ @}
+ # need close(command) here
+@}
+@end example
+
+This example creates a new pipeline based on data in @emph{each} record.
+Without the call to @code{close} indicated in the comment, @command{awk}
+creates child processes to run the commands, until it eventually
+runs out of file descriptors for more pipelines.
+
+Even though each command has finished (as indicated by the end-of-file
+return status from @code{getline}), the child process is not
+terminated;@footnote{The technical terminology is rather morbid.
+The finished child is called a ``zombie,'' and cleaning up after
+it is referred to as ``reaping.''}
+@c Good old UNIX: give the marketing guys fits, that's the ticket
+more importantly, the file descriptor for the pipe
+is not closed and released until @code{close} is called or
+@command{awk} exits.
+
+@code{close} will silently do nothing if given an argument that
+does not represent a file, pipe or coprocess that was opened with
+a redirection.
+
+When using the @samp{|&} operator to communicate with a coprocess,
+it is occasionally useful to be able to close one end of the two-way
+pipe without closing the other.
+This is done by supplying a second argument to @code{close}.
+As in any other call to @code{close},
+the first argument is the name of the command or special file used
+to start the coprocess.
+The second argument should be a string, with either of the values
+@code{"to"} or @code{"from"}. Case does not matter.
+As this is an advanced feature, a more complete discussion is
+delayed until
+@ref{Two-way I/O, ,Two-Way Communications with Another Process},
+which discusses it in more detail and gives an example.
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Using @code{close}'s Return Value
+@cindex advanced notes
+@cindex dark corner
+@cindex differences between @command{gawk} and @command{awk}
+@cindex @code{close}, return value
+@cindex return value from @code{close}
+
+In many versions of Unix @command{awk}, the @code{close} function
+is actually a statement. It is a syntax error to try and use the return
+value from @code{close}:
+@value{DARKCORNER}
+
+@example
+command = "@dots{}"
+command | getline info
+retval = close(command) # syntax error in most Unix awks
+@end example
+
+@command{gawk} treats @code{close} as a function.
+The return value is @minus{}1 if the argument names something
+that was never opened with a redirection, or if there is
+a system problem closing the file or process.
+In these cases, @command{gawk} sets the built-in variable
+@code{ERRNO} to a string describing the problem.
+
+In @command{gawk},
+when closing a pipe or coprocess,
+the return value is the exit status of the command.
+Otherwise, it is the return value from the system's @code{close} or
+@code{fclose} C functions when closing input or output
+files, respectively.
+This value is zero if the close succeeds, or @minus{}1 if
+it fails.
+
+The return value for closing a pipeline is particularly useful.
+It allows you to get the output from a command as well as its
+exit status.
+
+For POSIX-compliant systems,
+if the exit status is a number above 128, then the program
+was terminated by a signal. Subtract 128 to get the signal number:
+
+@example
+exit_val = close(command)
+if (exit_val > 128)
+ print command, "died with signal", exit_val - 128
+else
+ print command, "exited with code", exit_val
+@end example
+
+Currently, in @command{gawk}, this only works for commands
+piping into @code{getline}. For commands piped into
+from @code{print} or @code{printf}, the
+return value from @code{close} is that of the library's
+@code{pclose} function.
@node Expressions, Patterns and Actions, Printing, Top
@chapter Expressions
@cindex expression
-Expressions are the basic building blocks of @code{awk} patterns
-and actions. An expression evaluates to a value, which you can print, test,
-store in a variable or pass to a function. Additionally, an expression
-can assign a new value to a variable or a field, with an assignment operator.
+Expressions are the basic building blocks of @command{awk} patterns
+and actions. An expression evaluates to a value that you can print, test,
+or pass to a function. Additionally, an expression
+can assign a new value to a variable or a field by using an assignment operator.
An expression can serve as a pattern or action statement on its own.
Most other kinds of
-statements contain one or more expressions which specify data on which to
-operate. As in other languages, expressions in @code{awk} include
+statements contain one or more expressions that specify the data on which to
+operate. As in other languages, expressions in @command{awk} include
variables, array references, constants, and function calls, as well as
combinations of these with various operators.
@menu
-* Constants:: String, numeric, and regexp constants.
+* Constants:: String, numeric and regexp constants.
* Using Constant Regexps:: When and how to use a regexp constant.
* Variables:: Variables give names to values for later use.
* Conversion:: The conversion of strings to numbers and vice
@@ -5697,7 +6805,7 @@ combinations of these with various operators.
* Assignment Ops:: Changing the value of a variable or a field.
* Increment Ops:: Incrementing the numeric value of a variable.
* Truth Values:: What is ``true'' and what is ``false''.
-* Typing and Comparison:: How variables acquire types, and how this
+* Typing and Comparison:: How variables acquire types and how this
affects comparison of numbers and strings with
@samp{<}, etc.
* Boolean Ops:: Combining comparison expressions using boolean
@@ -5713,27 +6821,33 @@ combinations of these with various operators.
@node Constants, Using Constant Regexps, Expressions, Expressions
@section Constant Expressions
@cindex constants, types of
-@cindex string constants
The simplest type of expression is the @dfn{constant}, which always has
-the same value. There are three types of constants: numeric constants,
-string constants, and regular expression constants.
+the same value. There are three types of constants: numeric,
+string, and regular expression.
+
+Each is used in the appropriate context when you need a data
+value that isn't going to change. Numeric constants can
+have different forms, but are stored identically internally.
@menu
* Scalar Constants:: Numeric and string constants.
+* Non-decimal-numbers:: What are octal and hex numbers.
* Regexp Constants:: Regular Expression constants.
@end menu
-@node Scalar Constants, Regexp Constants, Constants, Constants
+@node Scalar Constants, Non-decimal-numbers, Constants, Constants
@subsection Numeric and String Constants
@cindex numeric constant
@cindex numeric value
A @dfn{numeric constant} stands for a number. This number can be an
integer, a decimal fraction, or a number in scientific (exponential)
-notation.@footnote{The internal representation uses double-precision
-floating point numbers. If you don't know what that means, then don't
-worry about it.} Here are some examples of numeric constants, which all
+notation.@footnote{The internal representation of all numbers,
+including integers, uses double-precision
+floating-point numbers.
+On most modern systems, these are in IEEE 754 standard format.}
+Here are some examples of numeric constants that all
have the same value:
@example
@@ -5742,46 +6856,143 @@ have the same value:
1050e-1
@end example
+@cindex string constants
A string constant consists of a sequence of characters enclosed in
-double-quote marks. For example:
+double quote marks. For example:
@example
"parrot"
@end example
@noindent
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
represents the string whose contents are @samp{parrot}. Strings in
-@code{gawk} can be of any length and they can contain any of the possible
-eight-bit ASCII characters including ASCII NUL (character code zero).
-Other @code{awk}
+@command{gawk} can be of any length, and they can contain any of the possible
+eight-bit ASCII characters including ASCII @sc{nul} (character code zero).
+Other @command{awk}
implementations may have difficulty with some character codes.
-@node Regexp Constants, , Scalar Constants, Constants
+@node Non-decimal-numbers, Regexp Constants, Scalar Constants, Constants
+@subsection Octal and Hexadecimal Numbers
+@cindex octal numbers
+@cindex hexadecimal numbers
+@cindex numbers, octal
+@cindex numbers, hexadecimal
+
+In @command{awk}, all numbers are in decimal; i.e., base 10. Many other
+programming languages allow you to specify numbers in other bases, often
+octal (base 8) and hexadecimal (base 16).
+In octal, the numbers go 0, 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, etc..
+Just as @samp{11} in decimal is 1 times 10 plus 1, so
+@samp{11} in octal is 1 times 8, plus 1. This equals nine in decimal.
+In hexadecimal, there are 16 digits. Since the everyday decimal
+number system only has ten digits (@samp{0}---@samp{9}), the letters
+@samp{a} through @samp{f} are used to represent the rest.
+(Case in the letters is usually irrelevant; hexadecimal @samp{a} and @samp{A}
+have the same value.)
+Thus, @samp{11} in
+hexadecimal is 1 times 16 plus 1, which equals 17 in decimal.
+
+Just by looking at plain @samp{11}, you can't tell what base it's in.
+So, in C, C++, and other languages derived from C,
+@c such as PERL, but we won't mention that....
+there is a special notation to help signify the base.
+Octal numbers start with a leading @samp{0},
+and hexadecimal numbers start with a leading @samp{0x} or @samp{0X}:
+
+@table @code
+@item 11
+Decimal 11.
+
+@item 011
+Octal 11, decimal value 9.
+
+@item 0x11
+Hexadecimal 11, decimal value 17.
+@end table
+
+This example shows the difference:
+
+@example
+$ gawk 'BEGIN @{ printf "%d, %d, %d\n", 011, 11, 0x11 @}'
+@print{} 9, 11, 17
+@end example
+
+Being able to use octal and hexadecimal constants in your programs is most
+useful when working with data that cannot be represented conveniently as
+characters or as regular numbers, such as binary data of various sorts.
+
+@command{gawk} allows the use of octal and hexadecimal
+constants in your program text. However, such numbers in the input data
+are not treated differently; doing so by default would break old
+programs.
+(If you really need to do this, use the @option{--non-decimal-data}
+command-line option,
+@pxref{Non-decimal Data, ,Allowing Non-Decimal Input Data}.)
+If you have octal or hexadecimal data,
+you can use the @code{strtonum} function
+(@pxref{String Functions, ,String Manipulation Functions})
+to convert the data into a number.
+Most of the time, you will want to use octal or hexadecimal constants
+when working with the built-in bit manipulation functions;
+see @ref{Bitwise Functions, ,Using @command{gawk}'s Bit Manipulation Functions},
+for more information.
+
+Unlike some early C implementations, @samp{8} and @samp{9} are not valid
+in octal constants; e.g., @command{gawk} treats @samp{018} as decimal 18.
+
+@example
+$ gawk 'BEGIN @{ print "021 is", 021 ; print 018 @}'
+@print{} 021 is 17
+@print{} 18
+@end example
+
+Octal and hexadecimal source code constants are a @command{gawk} extension.
+If @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+they are not available.
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: A Constant's Base Does Not Affect Its Value
+@cindex advanced notes
+
+Once a numeric constant has
+been converted internally into a number,
+@command{gawk} no longer remembers
+what the original form of the constant was; the internal value is
+always used. This has particular consequences for conversion of
+numbers to strings:
+
+@example
+$ gawk 'BEGIN @{ printf "0x11 is <%s>\n", 0x11 @}'
+@print{} 0x11 is <17>
+@end example
+
+@node Regexp Constants, , Non-decimal-numbers, Constants
@subsection Regular Expression Constants
@cindex @code{~} operator
@cindex @code{!~} operator
A regexp constant is a regular expression description enclosed in
slashes, such as @code{@w{/^beginning and end$/}}. Most regexps used in
-@code{awk} programs are constant, but the @samp{~} and @samp{!~}
+@command{awk} programs are constant, but the @samp{~} and @samp{!~}
matching operators can also match computed or ``dynamic'' regexps
(which are just ordinary strings or variables that contain a regexp).
@node Using Constant Regexps, Variables, Constants, Expressions
@section Using Regular Expression Constants
-When used on the right hand side of the @samp{~} or @samp{!~}
+@cindex dark corner
+When used on the righthand side of the @samp{~} or @samp{!~}
operators, a regexp constant merely stands for the regexp that is to be
matched.
-
-@cindex dark corner
-Regexp constants (such as @code{/foo/}) may be used like simple expressions.
+However, regexp constants (such as @code{/foo/}) may be used like simple expressions.
When a
regexp constant appears by itself, it has the same meaning as if it appeared
-in a pattern, i.e.@: @samp{($0 ~ /foo/)} (d.c.)
-(@pxref{Expression Patterns, ,Expressions as Patterns}).
-This means that the two code segments,
+in a pattern, i.e.; @samp{($0 ~ /foo/)}
+@value{DARKCORNER}
+@xref{Expression Patterns, ,Expressions as Patterns}.
+This means that the following two code segments:
@example
if ($0 ~ /barfly/ || $0 ~ /camelot/)
@@ -5789,7 +7000,7 @@ if ($0 ~ /barfly/ || $0 ~ /camelot/)
@end example
@noindent
-and
+and:
@example
if (/barfly/ || /camelot/)
@@ -5798,9 +7009,8 @@ if (/barfly/ || /camelot/)
@noindent
are exactly equivalent.
-
One rather bizarre consequence of this rule is that the following
-boolean expression is valid, but does not do what the user probably
+Boolean expression is valid, but does not do what the user probably
intended:
@example
@@ -5808,48 +7018,46 @@ intended:
if (/foo/ ~ $1) print "found foo"
@end example
+@cindex automatic warnings
+@cindex warnings, automatic
@noindent
This code is ``obviously'' testing @code{$1} for a match against the regexp
@code{/foo/}. But in fact, the expression @samp{/foo/ ~ $1} actually means
@samp{($0 ~ /foo/) ~ $1}. In other words, first match the input record
-against the regexp @code{/foo/}. The result will be either zero or one,
-depending upon the success or failure of the match. Then match that result
-against the first field in the record.
-
-Since it is unlikely that you would ever really wish to make this kind of
-test, @code{gawk} will issue a warning when it sees this construct in
+against the regexp @code{/foo/}. The result is either zero or one,
+depending upon the success or failure of the match. That result
+is then matched against the first field in the record.
+Because it is unlikely that you would ever really want to make this kind of
+test, @command{gawk} issues a warning when it sees this construct in
a program.
-
-Another consequence of this rule is that the assignment statement
+Another consequence of this rule is that the assignment statement:
@example
matches = /foo/
@end example
@noindent
-will assign either zero or one to the variable @code{matches}, depending
+assigns either zero or one to the variable @code{matches}, depending
upon the contents of the current input record.
-
-This feature of the language was never well documented until the
+This feature of the language has never been well documented until the
POSIX specification.
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
@cindex dark corner
Constant regular expressions are also used as the first argument for
-the @code{gensub}, @code{sub} and @code{gsub} functions, and as the
+the @code{gensub}, @code{sub}, and @code{gsub} functions, and as the
second argument of the @code{match} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
-Modern implementations of @code{awk}, including @code{gawk}, allow
-the third argument of @code{split} to be a regexp constant, while some
-older implementations do not (d.c.).
-
+(@pxref{String Functions, ,String Manipulation Functions}).
+Modern implementations of @command{awk}, including @command{gawk}, allow
+the third argument of @code{split} to be a regexp constant, but some
+older implementations do not.
+@value{DARKCORNER}
This can lead to confusion when attempting to use regexp constants
as arguments to user defined functions
-(@pxref{User-defined, , User-defined Functions}).
+(@pxref{User-defined, ,User-Defined Functions}).
For example:
@example
-@group
function mysub(pat, repl, str, global)
@{
if (global)
@@ -5858,40 +7066,38 @@ function mysub(pat, repl, str, global)
sub(pat, repl, str)
return str
@}
-@end group
-@group
@{
@dots{}
text = "hi! hi yourself!"
mysub(/hi/, "howdy", text, 1)
@dots{}
@}
-@end group
@end example
-In this example, the programmer wishes to pass a regexp constant to the
-user-defined function @code{mysub}, which will in turn pass it on to
+@cindex automatic warnings
+@cindex warnings, automatic
+In this example, the programmer wants to pass a regexp constant to the
+user-defined function @code{mysub}, which in turn passes it on to
either @code{sub} or @code{gsub}. However, what really happens is that
-the @code{pat} parameter will be either one or zero, depending upon whether
+the @code{pat} parameter is either one or zero, depending upon whether
or not @code{$0} matches @code{/hi/}.
-
-As it is unlikely that you would ever really wish to pass a truth value
-in this way, @code{gawk} will issue a warning when it sees a regexp
-constant used as a parameter to a user-defined function.
+@command{gawk} issues a warning when it sees a regexp constant used as
+a parameter to a user-defined function, since passing a truth value in
+this way is probably not what was intended.
@node Variables, Conversion, Using Constant Regexps, Expressions
@section Variables
Variables are ways of storing values at one point in your program for
-use later in another part of your program. You can manipulate them
-entirely within your program text, and you can also assign values to
-them on the @code{awk} command line.
+use later in another part of your program. They can be manipulated
+entirely within the program text, and they can also be assigned values
+on the @command{awk} command line.
@menu
* Using Variables:: Using variables in your programs.
-* Assignment Options:: Setting variables on the command line and a
- summary of command line syntax. This is an
+* Assignment Options:: Setting variables on the command-line and a
+ summary of command-line syntax. This is an
advanced method of input.
@end menu
@@ -5900,62 +7106,63 @@ them on the @code{awk} command line.
@cindex variables, user-defined
@cindex user-defined variables
-Variables let you give names to values and refer to them later. You have
-already seen variables in many of the examples. The name of a variable
-must be a sequence of letters, digits and underscores, but it may not begin
+Variables let you give names to values and refer to them later. Variables
+have already been used in many of the examples. The name of a variable
+must be a sequence of letters, digits, or underscores, and it may not begin
with a digit. Case is significant in variable names; @code{a} and @code{A}
are distinct variables.
A variable name is a valid expression by itself; it represents the
variable's current value. Variables are given new values with
-@dfn{assignment operators}, @dfn{increment operators} and
+@dfn{assignment operators}, @dfn{increment operators}, and
@dfn{decrement operators}.
@xref{Assignment Ops, ,Assignment Expressions}.
+@c NEXT ED: Can also be changed by sub, gsub, split
-A few variables have special built-in meanings, such as @code{FS}, the
-field separator, and @code{NF}, the number of fields in the current
-input record. @xref{Built-in Variables}, for a list of them. These
-built-in variables can be used and assigned just like all other
+A few variables have special built-in meanings, such as @code{FS} (the
+field separator), and @code{NF} (the number of fields in the current input
+record). @xref{Built-in Variables}, for a list of the built-in variables.
+These built-in variables can be used and assigned just like all other
variables, but their values are also used or changed automatically by
-@code{awk}. All built-in variables names are entirely upper-case.
+@command{awk}. All built-in variables' names are entirely uppercase.
-Variables in @code{awk} can be assigned either numeric or string
-values. By default, variables are initialized to the empty string, which
+Variables in @command{awk} can be assigned either numeric or string values.
+The kind of value a variable holds can change over the life of a program.
+By default, variables are initialized to the empty string, which
is zero if converted to a number. There is no need to
-``initialize'' each variable explicitly in @code{awk},
-the way you would in C and in most other traditional languages.
+``initialize'' each variable explicitly in @command{awk},
+which is what you would do in C and in most other traditional languages.
-@node Assignment Options, , Using Variables, Variables
+@node Assignment Options, , Using Variables, Variables
@subsection Assigning Variables on the Command Line
-You can set any @code{awk} variable by including a @dfn{variable assignment}
-among the arguments on the command line when you invoke @code{awk}
-(@pxref{Other Arguments, ,Other Command Line Arguments}). Such an assignment has
-this form:
+Any @command{awk} variable can be set by including a @dfn{variable assignment}
+among the arguments on the command line when @command{awk} is invoked
+(@pxref{Other Arguments, ,Other Command-Line Arguments}).
+Such an assignment has the following form:
@example
@var{variable}=@var{text}
@end example
@noindent
-With it, you can set a variable either at the beginning of the
-@code{awk} run or in between input files.
-
-If you precede the assignment with the @samp{-v} option, like this:
+With it, a variable is set either at the beginning of the
+@command{awk} run or in between input files.
+When the assignment is preceded with the @option{-v} option,
+as in the following:
@example
-v @var{variable}=@var{text}
@end example
@noindent
-then the variable is set at the very beginning, before even the
-@code{BEGIN} rules are run. The @samp{-v} option and its assignment
-must precede all the file name arguments, as well as the program text.
-(@xref{Options, ,Command Line Options}, for more information about
-the @samp{-v} option.)
-
+the variable is set at the very beginning, even before the
+@code{BEGIN} rules are run. The @option{-v} option and its assignment
+must precede all the @value{FN} arguments, as well as the program text.
+(@xref{Options, ,Command-Line Options}, for more information about
+the @option{-v} option.)
Otherwise, the variable assignment is performed at a time determined by
-its position among the input file arguments: after the processing of the
+its position among the input file arguments---after the processing of the
preceding input file argument. For example:
@example
@@ -5968,10 +7175,9 @@ the first file is read, the command line sets the variable @code{n}
equal to four. This causes the fourth field to be printed in lines from
the file @file{inventory-shipped}. After the first file has finished,
but before the second file is started, @code{n} is set to two, so that the
-second field is printed in lines from @file{BBS-list}.
+second field is printed in lines from @file{BBS-list}:
@example
-@group
$ awk '@{ print $n @}' n=4 inventory-shipped n=2 BBS-list
@print{} 15
@print{} 24
@@ -5979,27 +7185,27 @@ $ awk '@{ print $n @}' n=4 inventory-shipped n=2 BBS-list
@print{} 555-5553
@print{} 555-3412
@dots{}
-@end group
@end example
-Command line arguments are made available for explicit examination by
-the @code{awk} program in an array named @code{ARGV}
-(@pxref{ARGC and ARGV, ,Using @code{ARGC} and @code{ARGV}}).
-
@cindex dark corner
-@code{awk} processes the values of command line assignments for escape
-sequences (d.c.) (@pxref{Escape Sequences}).
+Command-line arguments are made available for explicit examination by
+the @command{awk} program in an array named @code{ARGV}
+(@pxref{ARGC and ARGV, ,Using @code{ARGC} and @code{ARGV}}).
+@command{awk} processes the values of command-line assignments for escape
+sequences
+@value{DARKCORNER}
+(@pxref{Escape Sequences}).
@node Conversion, Arithmetic Ops, Variables, Expressions
@section Conversion of Strings and Numbers
@cindex conversion of strings and numbers
-Strings are converted to numbers, and numbers to strings, if the context
-of the @code{awk} program demands it. For example, if the value of
+Strings are converted to numbers and numbers are converted to strings, if the context
+of the @command{awk} program demands it. For example, if the value of
either @code{foo} or @code{bar} in the expression @samp{foo + bar}
happens to be a string, it is converted to a number before the addition
is performed. If numeric values appear in string concatenation, they
-are converted to strings. Consider this:
+are converted to strings. Consider the following:
@example
two = 2; three = 3
@@ -6009,7 +7215,7 @@ print (two three) + 4
@noindent
This prints the (numeric) value 27. The numeric values of
the variables @code{two} and @code{three} are converted to strings and
-concatenated together, and the resulting string is converted back to the
+concatenated together. The resulting string is converted back to the
number 23, to which four is then added.
@cindex null string
@@ -6018,33 +7224,34 @@ number 23, to which four is then added.
If, for some reason, you need to force a number to be converted to a
string, concatenate the empty string, @code{""}, with that number.
To force a string to be converted to a number, add zero to that string.
-
A string is converted to a number by interpreting any numeric prefix
of the string as numerals:
@code{"2.5"} converts to 2.5, @code{"1e3"} converts to 1000, and @code{"25fix"}
has a numeric value of 25.
-Strings that can't be interpreted as valid numbers are converted to
-zero.
+Strings that can't be interpreted as valid numbers convert to zero.
-@vindex CONVFMT
+@cindex @code{CONVFMT} variable
The exact manner in which numbers are converted into strings is controlled
-by the @code{awk} built-in variable @code{CONVFMT} (@pxref{Built-in Variables}).
+by the @command{awk} built-in variable @code{CONVFMT} (@pxref{Built-in Variables}).
Numbers are converted using the @code{sprintf} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation})
with @code{CONVFMT} as the format
-specifier.
+specifier
+(@pxref{String Functions, ,String Manipulation Functions}).
@code{CONVFMT}'s default value is @code{"%.6g"}, which prints a value with
-at least six significant digits. For some applications you will want to
-change it to specify more precision. On most modern machines, you must
-print 17 digits to capture a floating point number's value exactly.
-
-Strange results can happen if you set @code{CONVFMT} to a string that doesn't
-tell @code{sprintf} how to format floating point numbers in a useful way.
-For example, if you forget the @samp{%} in the format, all numbers will be
-converted to the same constant string.
+at least six significant digits. For some applications, you might want to
+change it to specify more precision.
+On most modern machines,
+17 digits is enough to capture a floating-point number's
+value exactly,
+most of the time.@footnote{Pathological cases can require up to
+752 digits (!), but we doubt that you need to worry about this.}
@cindex dark corner
+Strange results can occur if you set @code{CONVFMT} to a string that doesn't
+tell @code{sprintf} how to format floating-point numbers in a useful way.
+For example, if you forget the @samp{%} in the format, @command{awk} converts
+all numbers to the same constant string.
As a special case, if a number is an integer, then the result of converting
it to a string is @emph{always} an integer, no matter what the value of
@code{CONVFMT} may be. Given the following code fragment:
@@ -6056,21 +7263,23 @@ b = a ""
@end example
@noindent
-@code{b} has the value @code{"12"}, not @code{"12.00"} (d.c.).
-
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-@vindex OFMT
-Prior to the POSIX standard, @code{awk} specified that the value
-of @code{OFMT} was used for converting numbers to strings. @code{OFMT}
+@code{b} has the value @code{"12"}, not @code{"12.00"}.
+@value{DARKCORNER}
+
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@cindex @code{OFMT} variable
+Prior to the POSIX standard, @command{awk} used the value
+of @code{OFMT} for converting numbers to strings. @code{OFMT}
specifies the output format to use when printing numbers with @code{print}.
@code{CONVFMT} was introduced in order to separate the semantics of
conversion from the semantics of printing. Both @code{CONVFMT} and
@code{OFMT} have the same default value: @code{"%.6g"}. In the vast majority
-of cases, old @code{awk} programs will not change their behavior.
-However, this use of @code{OFMT} is something to keep in mind if you must
-port your program to other implementations of @code{awk}; we recommend
-that instead of changing your programs, you just port @code{gawk} itself!
+of cases, old @command{awk} programs do not change their behavior.
+However, these semantics for @code{OFMT} are something to keep in mind if you must
+port your new style program to older implementations of @command{awk}.
+We recommend
+that instead of changing your programs, just port @command{gawk} itself.
@xref{Print, ,The @code{print} Statement},
for more information on the @code{print} statement.
@@ -6086,17 +7295,13 @@ for more information on the @code{print} statement.
@cindex quotient
@cindex exponentiation
-The @code{awk} language uses the common arithmetic operators when
+The @command{awk} language uses the common arithmetic operators when
evaluating expressions. All of these arithmetic operators follow normal
-precedence rules, and work as you would expect them to. Arithmetic
-operations are evaluated using double precision floating point, which
-has the usual problems of inexactness and exceptions.@footnote{David
-Goldberg, @uref{http://www.validgh.com/goldberg/paper.ps, @cite{What Every
-Computer Scientist Should Know About Floating-point Arithmetic}},
-@cite{ACM Computing Surveys} @strong{23}, 1 (1991-03), 5-48.}
+precedence rules and work as you would expect them to.
-Here is a file @file{grades} containing a list of student names and
-three test scores per student (it's a small class):
+The following example uses a file named @file{grades}, which contains
+a list of student names as well as three test scores per student (it's
+a small class):
@example
Pat 100 97 58
@@ -6105,8 +7310,8 @@ Chris 72 92 89
@end example
@noindent
-This programs takes the file @file{grades}, and prints the average
-of the scores.
+This programs takes the file @file{grades} and prints the average
+of the scores:
@example
$ awk '@{ sum = $2 + $3 + $4 ; avg = sum / 3
@@ -6116,39 +7321,58 @@ $ awk '@{ sum = $2 + $3 + $4 ; avg = sum / 3
@print{} Chris 84.3333
@end example
-This table lists the arithmetic operators in @code{awk}, in order from
-highest precedence to lowest:
+The following list provides the arithmetic operators in @command{awk}, in order from
+the highest precedence to the lowest:
-@c @cartouche
@table @code
@item - @var{x}
Negation.
@item + @var{x}
-Unary plus. The expression is converted to a number.
+Unary plus; the expression is converted to a number.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@item @var{x} ^ @var{y}
@itemx @var{x} ** @var{y}
-Exponentiation: @var{x} raised to the @var{y} power. @samp{2 ^ 3} has
-the value eight. The character sequence @samp{**} is equivalent to
-@samp{^}. (The POSIX standard only specifies the use of @samp{^}
-for exponentiation.)
+Exponentiation; @var{x} raised to the @var{y} power. @samp{2 ^ 3} has
+the value eight; the character sequence @samp{**} is equivalent to
+@samp{^}.
@item @var{x} * @var{y}
Multiplication.
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
@item @var{x} / @var{y}
-Division. Since all numbers in @code{awk} are
-floating point numbers, the result is not rounded to an integer: @samp{3 / 4}
-has the value 0.75.
+Division; because all numbers in @command{awk} are floating-point
+numbers, the result is @emph{not} rounded to an integer---@samp{3 / 4} has
+the value 0.75. (It is a common mistake, especially for C programmers,
+to forget that @emph{all} numbers in @command{awk} are floating-point,
+and that division of integer-looking constants produces a real number,
+not an integer.)
@item @var{x} % @var{y}
-@cindex differences between @code{gawk} and @code{awk}
-Remainder. The quotient is rounded toward zero to an integer,
-multiplied by @var{y} and this result is subtracted from @var{x}.
-This operation is sometimes known as ``trunc-mod.'' The following
+Remainder; further discussion is provided in the text, just
+after this list.
+
+@item @var{x} + @var{y}
+Addition.
+
+@item @var{x} - @var{y}
+Subtraction.
+@end table
+
+Unary plus and minus have the same precedence,
+the multiplication operators all have the same precedence, and
+addition and subtraction have the same precedence.
+
+@cindex differences between @command{gawk} and @command{awk}
+When computing the remainder of @code{@var{x} % @var{y}},
+the quotient is rounded toward zero to an integer and
+multiplied by @var{y}. This result is subtracted from @var{x};
+this operation is sometimes known as ``trunc-mod.'' The following
relation always holds:
@example
@@ -6156,38 +7380,29 @@ b * int(a / b) + (a % b) == a
@end example
One possibly undesirable effect of this definition of remainder is that
-@code{@var{x} % @var{y}} is negative if @var{x} is negative. Thus,
+@code{@var{x} % @var{y}} is negative if @var{x} is negative. Thus:
@example
-17 % 8 = -1
@end example
-In other @code{awk} implementations, the signedness of the remainder
+In other @command{awk} implementations, the signedness of the remainder
may be machine dependent.
@c !!! what does posix say?
-@item @var{x} + @var{y}
-Addition.
-
-@item @var{x} - @var{y}
-Subtraction.
-@end table
-@c @end cartouche
-
+@cindex portability issues
+@strong{Note:}
+The POSIX standard only specifies the use of @samp{^}
+for exponentiation.
For maximum portability, do not use the @samp{**} operator.
-Unary plus and minus have the same precedence,
-the multiplication operators all have the same precedence, and
-addition and subtraction have the same precedence.
-
@node Concatenation, Assignment Ops, Arithmetic Ops, Expressions
@section String Concatenation
@cindex Kernighan, Brian
-@display
-@i{It seemed like a good idea at the time.}
+@quotation
+@i{It seemed like a good idea at the time.}@*
Brian Kernighan
-@end display
-@sp 1
+@end quotation
@cindex string operators
@cindex operators, string
@@ -6197,39 +7412,35 @@ specific operator to represent it. Instead, concatenation is performed by
writing expressions next to one another, with no operator. For example:
@example
-@group
$ awk '@{ print "Field number one: " $1 @}' BBS-list
@print{} Field number one: aardvark
@print{} Field number one: alpo-net
@dots{}
-@end group
@end example
Without the space in the string constant after the @samp{:}, the line
-would run together. For example:
+runs together. For example:
@example
-@group
$ awk '@{ print "Field number one:" $1 @}' BBS-list
@print{} Field number one:aardvark
@print{} Field number one:alpo-net
@dots{}
-@end group
@end example
-Since string concatenation does not have an explicit operator, it is
-often necessary to insure that it happens where you want it to by
-using parentheses to enclose
-the items to be concatenated. For example, the
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+Because string concatenation does not have an explicit operator, it is
+often necessary to insure that it happens at the right time by using
+parentheses to enclose the items to concatenate. For example, the
following code fragment does not concatenate @code{file} and @code{name}
as you might expect:
@example
-@group
file = "file"
name = "name"
print "something meaningful" > file name
-@end group
@end example
@noindent
@@ -6239,8 +7450,84 @@ It is necessary to use the following:
print "something meaningful" > (file name)
@end example
-We recommend that you use parentheses around concatenation in all but the
-most common contexts (such as on the right-hand side of @samp{=}).
+@cindex order of evaluation, concatenation
+@cindex concatenation evaluation order
+@cindex evaluation, order of
+@cindex side effects
+Parentheses should be used around concatenation in all but the
+most common contexts, such as on the righthand side of @samp{=}.
+Be careful about the kinds of expressions used in string concatenation.
+In particular, the order of evaluation of expressions used for concatenation
+is undefined in the @command{awk} language. Consider this example:
+
+@example
+BEGIN @{
+ a = "don't"
+ print (a " " (a = "panic"))
+@}
+@end example
+
+@noindent
+It is not defined whether the assignment to @code{a} happens
+before or after the value of @code{a} is retrieved for producing the
+concatenated value. The result could be either @samp{don't panic},
+or @samp{panic panic}.
+@c see test/nasty.awk for a worse example
+The precedence of concatenation, when mixed with other operators, is often
+counter-intuitive. Consider this example:
+
+@ignore
+> To: bug-gnu-utils@@gnu.org
+> CC: arnold@gnu.org
+> Subject: gawk 3.0.4 bug with {print -12 " " -24}
+> From: Russell Schulz <Russell_Schulz@locutus.ofB.ORG>
+> Date: Tue, 8 Feb 2000 19:56:08 -0700
+>
+> gawk 3.0.4 on NT gives me:
+>
+> prompt> cat bad.awk
+> BEGIN { print -12 " " -24; }
+>
+> prompt> gawk -f bad.awk
+> -12-24
+>
+> when I would expect
+>
+> -12 -24
+>
+> I have not investigated the source, or other implementations. The
+> bug is there on my NT and DOS versions 2.15.6 .
+@end ignore
+
+@example
+$ awk 'BEGIN @{ print -12 " " -24 @}'
+@print{} -12-24
+@end example
+
+This ``obviously'' is concatenating @minus{}12, a space, and @minus{}24.
+But where did the space disappear to?
+The answer lies in the combination of operator precedences and
+@command{awk}'s automatic conversion rules. To get the desired result,
+write the program in the following manner:
+
+@example
+$ awk 'BEGIN @{ print -12 " " (-24) @}'
+@print{} -12 -24
+@end example
+
+This forces @command{awk} to treat the @samp{-} on the @samp{-24} as unary.
+Otherwise, it's parsed as follows:
+
+@display
+ @minus{}12 (@code{"@ "} @minus{} 24)
+@result{} @minus{}12 (0 @minus{} 24)
+@result{} @minus{}12 (@minus{}24)
+@result{} @minus{}12@minus{}24
+@end display
+
+As mentioned earlier,
+when doing concatenation, @emph{parenthesize}. Otherwise,
+you're never quite sure what you'll get.
@node Assignment Ops, Increment Ops, Concatenation, Expressions
@section Assignment Expressions
@@ -6248,8 +7535,9 @@ most common contexts (such as on the right-hand side of @samp{=}).
@cindex operators, assignment
@cindex expression, assignment
-An @dfn{assignment} is an expression that stores a new value into a
-variable. For example, let's assign the value one to the variable
+@cindex @code{=} operator
+An @dfn{assignment} is an expression that stores a (usually different)
+value into a variable. For example, let's assign the value one to the variable
@code{z}:
@example
@@ -6259,7 +7547,8 @@ z = 1
After this expression is executed, the variable @code{z} has the value one.
Whatever old value @code{z} had before the assignment is forgotten.
-Assignments can store string values also. For example, this would store
+Assignments can also store string values. For example, the
+following stores
the value @code{"this food is good"} in the variable @code{message}:
@example
@@ -6269,45 +7558,41 @@ message = "this " thing " is " predicate
@end example
@noindent
-(This also illustrates string concatenation.)
-
+@cindex side effects
+This also illustrates string concatenation.
The @samp{=} sign is called an @dfn{assignment operator}. It is the
-simplest assignment operator because the value of the right-hand
+simplest assignment operator because the value of the righthand
operand is stored unchanged.
-
-@cindex side effect
Most operators (addition, concatenation, and so on) have no effect
-except to compute a value. If you ignore the value, you might as well
-not use the operator. An assignment operator is different; it does
-produce a value, but even if you ignore the value, the assignment still
+except to compute a value. If the value isn't used, there's no reason to
+use the operator. An assignment operator is different; it does
+produce a value, but even if you ignore it, the assignment still
makes itself felt through the alteration of the variable. We call this
a @dfn{side effect}.
@cindex lvalue
@cindex rvalue
-The left-hand operand of an assignment need not be a variable
+The lefthand operand of an assignment need not be a variable
(@pxref{Variables}); it can also be a field
(@pxref{Changing Fields, ,Changing the Contents of a Field}) or
-an array element (@pxref{Arrays, ,Arrays in @code{awk}}).
+an array element (@pxref{Arrays, ,Arrays in @command{awk}}).
These are all called @dfn{lvalues},
-which means they can appear on the left-hand side of an assignment operator.
-The right-hand operand may be any expression; it produces the new value
-which the assignment stores in the specified variable, field or array
+which means they can appear on the lefthand side of an assignment operator.
+The righthand operand may be any expression; it produces the new value
+that the assignment stores in the specified variable, field, or array
element. (Such values are called @dfn{rvalues}).
@cindex types of variables
It is important to note that variables do @emph{not} have permanent types.
-The type of a variable is simply the type of whatever value it happens
+A variable's type is simply the type of whatever value it happens
to hold at the moment. In the following program fragment, the variable
@code{foo} has a numeric value at first, and a string value later on:
@example
-@group
foo = 1
print foo
foo = "bar"
print foo
-@end group
@end example
@noindent
@@ -6315,7 +7600,7 @@ When the second assignment gives @code{foo} a string value, the fact that
it previously had a numeric value is forgotten.
String values that do not begin with a digit have a numeric value of
-zero. After executing this code, the value of @code{foo} is five:
+zero. After executing the following code, the value of @code{foo} is five:
@example
foo = "a string"
@@ -6323,32 +7608,36 @@ foo = foo + 5
@end example
@noindent
-(Note that using a variable as a number and then later as a string can
-be confusing and is poor programming style. The above examples illustrate how
-@code{awk} works, @emph{not} how you should write your own programs!)
+@strong{Note:} Using a variable as a number and then later as a string
+can be confusing and is poor programming style. The previous two examples
+illustrate how @command{awk} works, @emph{not} how you should write your
+own programs!
-An assignment is an expression, so it has a value: the same value that
-is assigned. Thus, @samp{z = 1} as an expression has the value one.
-One consequence of this is that you can write multiple assignments together:
+An assignment is an expression, so it has a value---the same value that
+is assigned. Thus, @samp{z = 1} is an expression with the value one.
+One consequence of this is that you can write multiple assignments together,
+such as:
@example
-x = y = z = 0
+x = y = z = 5
@end example
@noindent
-stores the value zero in all three variables. It does this because the
-value of @samp{z = 0}, which is zero, is stored into @code{y}, and then
-the value of @samp{y = z = 0}, which is zero, is stored into @code{x}.
-
-You can use an assignment anywhere an expression is called for. For
-example, it is valid to write @samp{x != (y = 1)} to set @code{y} to one
+This example stores the value five in all three variables
+(@code{x}, @code{y}, and @code{z}).
+It does so because the
+value of @samp{z = 5}, which is five, is stored into @code{y} and then
+the value of @samp{y = z = 5}, which is five, is stored into @code{x}.
+
+Assignments may be used anywhere an expression is called for. For
+example, it is valid to write @samp{x != (y = 1)} to set @code{y} to one,
and then test whether @code{x} equals one. But this style tends to make
-programs hard to read; except in a one-shot program, you should
-not use such nesting of assignments.
+programs hard to read; such nesting of assignments should be avoided,
+except perhaps in a one-shot program.
Aside from @samp{=}, there are several other assignment operators that
do arithmetic with the old value of the variable. For example, the
-operator @samp{+=} computes a new value by adding the right-hand value
+operator @samp{+=} computes a new value by adding the righthand value
to the old value of the variable. Thus, the following assignment adds
five to the value of @code{foo}:
@@ -6364,15 +7653,14 @@ foo = foo + 5
@end example
@noindent
-Use whichever one makes the meaning of your program clearer.
+Use whichever makes the meaning of your program clearer.
There are situations where using @samp{+=} (or any assignment operator)
-is @emph{not} the same as simply repeating the left-hand operand in the
-right-hand expression. For example:
+is @emph{not} the same as simply repeating the lefthand operand in the
+righthand expression. For example:
@cindex Rankin, Pat
@example
-@group
# Thanks to Pat Rankin for this example
BEGIN @{
foo[rand()] += 5
@@ -6383,20 +7671,18 @@ BEGIN @{
for (x in bar)
print x, bar[x]
@}
-@end group
@end example
@noindent
-The indices of @code{bar} are guaranteed to be different, because
-@code{rand} will return different values each time it is called.
+The indices of @code{bar} are practically guaranteed to be different, because
+@code{rand} returns different values each time it is called.
(Arrays and the @code{rand} function haven't been covered yet.
-@xref{Arrays, ,Arrays in @code{awk}},
-and see @ref{Numeric Functions, ,Numeric Built-in Functions}, for more information).
-This example illustrates an important fact about the assignment
-operators: the left-hand expression is only evaluated @emph{once}.
-
-It is also up to the implementation as to which expression is evaluated
-first, the left-hand one or the right-hand one.
+@xref{Arrays, ,Arrays in @command{awk}},
+and see @ref{Numeric Functions}, for more information).
+This example illustrates an important fact about assignment
+operators: the lefthand expression is only evaluated @emph{once}.
+It is up to the implementation as to which expression is evaluated
+first, the lefthand or the righthand.
Consider this example:
@example
@@ -6408,14 +7694,13 @@ a[i += 2] = i + 1
The value of @code{a[3]} could be either two or four.
Here is a table of the arithmetic assignment operators. In each
-case, the right-hand operand is an expression whose value is converted
+case, the righthand operand is an expression whose value is converted
to a number.
-@c @cartouche
+@ignore
@table @code
@item @var{lvalue} += @var{increment}
-Adds @var{increment} to the value of @var{lvalue} to make the new value
-of @var{lvalue}.
+Adds @var{increment} to the value of @var{lvalue}.
@item @var{lvalue} -= @var{decrement}
Subtracts @var{decrement} from the value of @var{lvalue}.
@@ -6429,102 +7714,212 @@ Divides the value of @var{lvalue} by @var{divisor}.
@item @var{lvalue} %= @var{modulus}
Sets @var{lvalue} to its remainder by @var{modulus}.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@item @var{lvalue} ^= @var{power}
@itemx @var{lvalue} **= @var{power}
Raises @var{lvalue} to the power @var{power}.
(Only the @samp{^=} operator is specified by POSIX.)
@end table
-@c @end cartouche
+@end ignore
+
+@cindex @code{+=} operator
+@cindex @code{-=} operator
+@cindex @code{*=} operator
+@cindex @code{/=} operator
+@cindex @code{%=} operator
+@cindex @code{^=} operator
+@cindex @code{**=} operator
+@multitable {@var{lvalue} *= @var{coefficient}} {Subtracts @var{decrement} from the value of @var{lvalue}.}
+@item @var{lvalue} @code{+=} @var{increment} @tab Adds @var{increment} to the value of @var{lvalue}.
+
+@item @var{lvalue} @code{-=} @var{decrement} @tab Subtracts @var{decrement} from the value of @var{lvalue}.
+
+@item @var{lvalue} @code{*=} @var{coefficient} @tab Multiplies the value of @var{lvalue} by @var{coefficient}.
+@item @var{lvalue} @code{/=} @var{divisor} @tab Divides the value of @var{lvalue} by @var{divisor}.
+
+@item @var{lvalue} @code{%=} @var{modulus} @tab Sets @var{lvalue} to its remainder by @var{modulus}.
+
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@item @var{lvalue} @code{^=} @var{power} @tab
+@item @var{lvalue} @code{**=} @var{power} @tab Raises @var{lvalue} to the power @var{power}.
+@end multitable
+
+@cindex portability issues
+@strong{Note:}
+Only the @samp{^=} operator is specified by POSIX.
For maximum portability, do not use the @samp{**=} operator.
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Syntactic Ambiguities Between @samp{/=} and Regular Expressions
+@cindex advanced notes
+
+@c derived from email from "Nelson H. F. Beebe" <beebe@math.utah.edu>
+@c Date: Mon, 1 Sep 1997 13:38:35 -0600 (MDT)
+
+@cindex dark corner
+@cindex ambiguity, syntactic: @code{/=} operator vs. @code{/=@dots{}/} regexp constant
+@cindex syntactic ambiguity: @code{/=} operator vs. @code{/=@dots{}/} regexp constant
+@cindex @code{/=} operator vs. @code{/=@dots{}/} regexp constant
+There is a syntactic ambiguity between the @samp{/=} assignment
+operator and regexp constants whose first character is an @samp{=}.
+@value{DARKCORNER}
+This is most notable in commercial @command{awk} versions.
+For example:
+
+@example
+$ awk /==/ /dev/null
+@error{} awk: syntax error at source line 1
+@error{} context is
+@error{} >>> /= <<<
+@error{} awk: bailing out at source line 1
+@end example
+
+@noindent
+A workaround is:
+
+@example
+awk '/[=]=/' /dev/null
+@end example
+
+@command{gawk} does not have this problem,
+nor do the other
+freely-available versions described in
+@ref{Other Versions, , Other Freely Available @command{awk} Implementations}.
+
@node Increment Ops, Truth Values, Assignment Ops, Expressions
@section Increment and Decrement Operators
@cindex increment operators
@cindex operators, increment
@dfn{Increment} and @dfn{decrement operators} increase or decrease the value of
-a variable by one. You could do the same thing with an assignment operator, so
-the increment operators add no power to the @code{awk} language; but they
+a variable by one. An assignment operator can do the same thing, so
+the increment operators add no power to the @command{awk} language; however they
are convenient abbreviations for very common operations.
-The operator to add one is written @samp{++}. It can be used to increment
+@cindex side effects
+The operator used for adding one is written @samp{++}. It can be used to increment
a variable either before or after taking its value.
-
-To pre-increment a variable @var{v}, write @samp{++@var{v}}. This adds
-one to the value of @var{v} and that new value is also the value of this
-expression. The assignment expression @samp{@var{v} += 1} is completely
-equivalent.
-
+To pre-increment a variable @code{v}, write @samp{++v}. This adds
+one to the value of @code{v}---that new value is also the value of the
+expression. (The assignment expression @samp{v += 1} is completely
+equivalent.)
Writing the @samp{++} after the variable specifies post-increment. This
increments the variable value just the same; the difference is that the
value of the increment expression itself is the variable's @emph{old}
value. Thus, if @code{foo} has the value four, then the expression @samp{foo++}
has the value four, but it changes the value of @code{foo} to five.
+In other words, the operator returns the old value of the variable,
+but with the side effect of incrementing it.
-The post-increment @samp{foo++} is nearly equivalent to writing @samp{(foo
+The post-increment @samp{foo++} is nearly the same as writing @samp{(foo
+= 1) - 1}. It is not perfectly equivalent because all numbers in
-@code{awk} are floating point: in floating point, @samp{foo + 1 - 1} does
+@command{awk} are floating-point---in floating-point, @samp{foo + 1 - 1} does
not necessarily equal @code{foo}. But the difference is minute as
long as you stick to numbers that are fairly small (less than 10e12).
-Any lvalue can be incremented. Fields and array elements are incremented
-just like variables. (Use @samp{$(i++)} when you wish to do a field reference
+Fields and array elements are incremented
+just like variables. (Use @samp{$(i++)} when you want to do a field reference
and a variable increment at the same time. The parentheses are necessary
-because of the precedence of the field reference operator, @samp{$}.)
+because of the precedence of the field reference operator @samp{$}.)
@cindex decrement operators
@cindex operators, decrement
-The decrement operator @samp{--} works just like @samp{++} except that
-it subtracts one instead of adding. Like @samp{++}, it can be used before
+The decrement operator @samp{--} works just like @samp{++}, except that
+it subtracts one instead of adding it. As with @samp{++}, it can be used before
the lvalue to pre-decrement or after it to post-decrement.
+Following is a summary of increment and decrement expressions:
-Here is a summary of increment and decrement expressions.
-
-@c @cartouche
@table @code
+@cindex @code{++} operator
@item ++@var{lvalue}
-This expression increments @var{lvalue} and the new value becomes the
+This expression increments @var{lvalue}, and the new value becomes the
value of the expression.
@item @var{lvalue}++
This expression increments @var{lvalue}, but
the value of the expression is the @emph{old} value of @var{lvalue}.
+@cindex @code{--} operator
@item --@var{lvalue}
-Like @samp{++@var{lvalue}}, but instead of adding, it subtracts. It
-decrements @var{lvalue} and delivers the value that results.
+This expression is
+like @samp{++@var{lvalue}}, but instead of adding, it subtracts. It
+decrements @var{lvalue} and delivers the value that is the result.
@item @var{lvalue}--
-Like @samp{@var{lvalue}++}, but instead of adding, it subtracts. It
+This expression is
+like @samp{@var{lvalue}++}, but instead of adding, it subtracts. It
decrements @var{lvalue}. The value of the expression is the @emph{old}
value of @var{lvalue}.
@end table
-@c @end cartouche
+
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Operator Evaluation Order
+@cindex advanced notes
+@cindex precedence
+@cindex operator precedence
+@cindex portability issues
+@cindex evaluation, order of
+@cindex Marx, Groucho
+@quotation
+@i{Doctor, doctor! It hurts when I do this!@*
+So don't do that!}@*
+Groucho Marx
+@end quotation
+
+@noindent
+What happens for something like the following?
+
+@example
+b = 6
+print b += b++
+@end example
+
+@noindent
+Or something even stranger?
+
+@example
+b = 6
+b += ++b + b++
+print b
+@end example
+
+@cindex side effects
+In other words, when do the various side effects prescribed by the
+postfix operators (@samp{b++}) take effect?
+When side effects happen is @dfn{implementation defined}.
+In other words, it is up to the particular version of @command{awk}.
+The result for the first example may be 12 or 13, and for the second, it
+may be 22 or 23.
+
+In short, doing things like this is not recommended and definitely
+not anything that you can rely upon for portability.
+You should avoid such things in your own programs.
+@c You'll sleep better at night and be able to look at yourself
+@c in the mirror in the morning.
@node Truth Values, Typing and Comparison, Increment Ops, Expressions
-@section True and False in @code{awk}
+@section True and False in @command{awk}
@cindex truth values
@cindex logical true
@cindex logical false
+@cindex null string
+@cindex empty string
Many programming languages have a special representation for the concepts
of ``true'' and ``false.'' Such languages usually use the special
-constants @code{true} and @code{false}, or perhaps their upper-case
+constants @code{true} and @code{false}, or perhaps their uppercase
equivalents.
-
-@cindex null string
-@cindex empty string
-@code{awk} is different. It borrows a very simple concept of true and
-false from C. In @code{awk}, any non-zero numeric value, @emph{or} any
+However, @command{awk} is different.
+It borrows a very simple concept of true and
+false from C. In @command{awk}, any nonzero numeric value @emph{or} any
non-empty string value is true. Any other value (zero or the null
-string, @code{""}) is false. The following program will print @samp{A strange
+string @code{""}) is false. The following program prints @samp{A strange
truth value} three times:
@example
-@group
BEGIN @{
if (3.1415927)
print "A strange truth value"
@@ -6533,12 +7928,12 @@ BEGIN @{
if (j = 57)
print "A strange truth value"
@}
-@end group
@end example
@cindex dark corner
-There is a surprising consequence of the ``non-zero or non-null'' rule:
-The string constant @code{"0"} is actually true, since it is non-null (d.c.).
+There is a surprising consequence of the ``nonzero or non-null'' rule:
+the string constant @code{"0"} is actually true, because it is non-null.
+@value{DARKCORNER}
@node Typing and Comparison, Boolean Ops, Truth Values, Expressions
@section Variable Typing and Comparison Expressions
@@ -6547,60 +7942,56 @@ The string constant @code{"0"} is actually true, since it is non-null (d.c.).
@cindex expression, matching
@cindex relational operators
@cindex operators, relational
-@cindex regexp match/non-match operators
+@cindex regexp operators
@cindex variable typing
@cindex types of variables
-@c 2e: consider splitting this section into subsections
-@display
-@i{The Guide is definitive. Reality is frequently inaccurate.}
+@quotation
+@i{The Guide is definitive. Reality is frequently inaccurate.}@*
The Hitchhiker's Guide to the Galaxy
-@end display
-@sp 1
+@end quotation
-Unlike other programming languages, @code{awk} variables do not have a
+Unlike other programming languages, @command{awk} variables do not have a
fixed type. Instead, they can be either a number or a string, depending
upon the value that is assigned to them.
@cindex numeric string
The 1992 POSIX standard introduced
the concept of a @dfn{numeric string}, which is simply a string that looks
-like a number, for example, @code{@w{" +2"}}. This concept is used
+like a number---for example, @code{@w{" +2"}}. This concept is used
for determining the type of a variable.
-
-The type of the variable is important, since the types of two variables
+The type of the variable is important because the types of two variables
determine how they are compared.
+In @command{gawk}, variable typing follows these rules:
-In @code{gawk}, variable typing follows these rules.
-
-@enumerate 1
+@itemize @bullet
@item
-A numeric literal or the result of a numeric operation has the @var{numeric}
+A numeric constant or the result of a numeric operation has the @var{numeric}
attribute.
@item
-A string literal or the result of a string operation has the @var{string}
+A string constant or the result of a string operation has the @var{string}
attribute.
@item
Fields, @code{getline} input, @code{FILENAME}, @code{ARGV} elements,
-@code{ENVIRON} elements and the
+@code{ENVIRON} elements, and the
elements of an array created by @code{split} that are numeric strings
have the @var{strnum} attribute. Otherwise, they have the @var{string}
attribute.
Uninitialized variables also have the @var{strnum} attribute.
@item
-Attributes propagate across assignments, but are not changed by
+Attributes propagate across assignments but are not changed by
any use.
-@c (Although a use may cause the entity to acquire an additional
-@c value such that it has both a numeric and string value -- this leaves the
+@c (Although a use may cause the entity to acquire an additional
+@c value such that it has both a numeric and string value, this leaves the
@c attribute unchanged.)
@c This is important but not relevant
-@end enumerate
+@end itemize
The last rule is particularly important. In the following program,
@code{a} has numeric type, even though it is later used in a string
-operation.
+operation:
@example
BEGIN @{
@@ -6611,8 +8002,8 @@ BEGIN @{
@end example
When two operands are compared, either string comparison or numeric comparison
-may be used, depending on the attributes of the operands, according to the
-following, symmetric, matrix:
+may be used. This depends upon the attributes of the operands, according to the
+following symmetric matrix:
@c thanks to Karl Berry, kb@cs.umb.edu, for major help with TeX tables
@tex
@@ -6657,24 +8048,34 @@ NUMERIC &&string &numeric &numeric\cr
STRNUM &&string &numeric &numeric\cr
}}}
@end tex
-@ifinfo
+@ifnottex
@display
- +----------------------------------------------
- | STRING NUMERIC STRNUM
+ +----------------------------------------------
+ | STRING NUMERIC STRNUM
--------+----------------------------------------------
- |
-STRING | string string string
- |
-NUMERIC | string numeric numeric
- |
-STRNUM | string numeric numeric
+ |
+STRING | string string string
+ |
+NUMERIC | string numeric numeric
+ |
+STRNUM | string numeric numeric
--------+----------------------------------------------
@end display
-@end ifinfo
-
-The basic idea is that user input that looks numeric, and @emph{only}
-user input, should be treated as numeric, even though it is actually
-made of characters, and is therefore also a string.
+@end ifnottex
+
+The basic idea is that user input that looks numeric---and @emph{only}
+user input---should be treated as numeric, even though it is actually
+made of characters and is therefore also a string.
+Thus, for example, the string constant @w{@code{" +3.14"}}
+is a string, even though it looks numeric,
+and is @emph{never} treated as number for comparison
+purposes.
+
+In short, when one operand is a ``pure'' string, such as a string
+constant, then a string comparison is performed. Otherwise, a
+numeric comparison is performed.@footnote{The POSIX standard is under
+revision. The revised standard's rules for typing and comparison are
+the same as just described for @command{gawk}.}
@dfn{Comparison expressions} compare strings or numbers for
relationships such as equality. They are written using @dfn{relational
@@ -6692,7 +8093,6 @@ them:
@cindex @code{~} operator
@cindex @code{!~} operator
@cindex @code{in} operator
-@c @cartouche
@table @code
@item @var{x} < @var{y}
True if @var{x} is less than @var{y}.
@@ -6721,26 +8121,24 @@ True if the string @var{x} does not match the regexp denoted by @var{y}.
@item @var{subscript} in @var{array}
True if the array @var{array} has an element with the subscript @var{subscript}.
@end table
-@c @end cartouche
Comparison expressions have the value one if true and zero if false.
-
When comparing operands of mixed types, numeric operands are converted
to strings using the value of @code{CONVFMT}
(@pxref{Conversion, ,Conversion of Strings and Numbers}).
Strings are compared
by comparing the first character of each, then the second character of each,
-and so on. Thus @code{"10"} is less than @code{"9"}. If there are two
+and so on. Thus, @code{"10"} is less than @code{"9"}. If there are two
strings where one is a prefix of the other, the shorter string is less than
-the longer one. Thus @code{"abc"} is less than @code{"abcd"}.
+the longer one. Thus, @code{"abc"} is less than @code{"abcd"}.
@cindex common mistakes
@cindex mistakes, common
@cindex errors, common
-It is very easy to accidentally mistype the @samp{==} operator, and
-leave off one of the @samp{=}s. The result is still valid @code{awk}
-code, but the program will not do what you mean:
+It is very easy to accidentally mistype the @samp{==} operator and
+leave off one of the @samp{=} characters. The result is still valid @command{awk}
+code, but the program does not do what is intended:
@example
if (a = b) # oops! should be a == b
@@ -6751,12 +8149,12 @@ else
@noindent
Unless @code{b} happens to be zero or the null string, the @code{if}
-part of the test will always succeed. Because the operators are
+part of the test always succeeds. Because the operators are
so similar, this kind of error is very difficult to spot when
scanning the source code.
-Here are some sample expressions, how @code{gawk} compares them, and what
-the result of the comparison is.
+The following table of expressions illustrates the kind of comparison
+@command{gawk} performs, as well as what the result of the comparison is:
@table @code
@item 1.5 <= 2.0
@@ -6776,41 +8174,37 @@ string comparison (true)
string comparison (true)
@item a = 2; b = " +2"
-@itemx a == b
+@item a == b
string comparison (false)
@end table
-In this example,
+In the next example:
@example
-@group
$ echo 1e2 3 | awk '@{ print ($1 < $2) ? "true" : "false" @}'
@print{} false
-@end group
@end example
+@cindex comparisons, string vs. regexp
+@cindex string comparison vs. regexp comparison
+@cindex regexp comparison vs. string comparison
@noindent
-the result is @samp{false} since both @code{$1} and @code{$2} are numeric
-strings and thus both have the @var{strnum} attribute,
-dictating a numeric comparison.
-
+the result is @samp{false} because both @code{$1} and @code{$2}
+are user input. They are numeric strings---therefore both have
+the @var{strnum} attribute, dictating a numeric comparison.
The purpose of the comparison rules and the use of numeric strings is
to attempt to produce the behavior that is ``least surprising,'' while
still ``doing the right thing.''
-
-@cindex comparisons, string vs. regexp
-@cindex string comparison vs. regexp comparison
-@cindex regexp comparison vs. string comparison
String comparisons and regular expression comparisons are very different.
-For example,
+For example:
@example
x == "foo"
@end example
@noindent
-has the value of one, or is true, if the variable @code{x}
-is precisely @samp{foo}. By contrast,
+has the value one, or is true if the variable @code{x}
+is precisely @samp{foo}. By contrast:
@example
x ~ /foo/
@@ -6820,97 +8214,86 @@ x ~ /foo/
has the value one if @code{x} contains @samp{foo}, such as
@code{"Oh, what a fool am I!"}.
-The right hand operand of the @samp{~} and @samp{!~} operators may be
-either a regexp constant (@code{/@dots{}/}), or an ordinary
-expression, in which case the value of the expression as a string is used as a
+The righthand operand of the @samp{~} and @samp{!~} operators may be
+either a regexp constant (@code{/@dots{}/}) or an ordinary
+expression. In the latter case, the value of the expression as a string is used as a
dynamic regexp (@pxref{Regexp Usage, ,How to Use Regular Expressions}; also
@pxref{Computed Regexps, ,Using Dynamic Regexps}).
@cindex regexp as expression
-In recent implementations of @code{awk}, a constant regular
+In modern implementations of @command{awk}, a constant regular
expression in slashes by itself is also an expression. The regexp
-@code{/@var{regexp}/} is an abbreviation for this comparison expression:
+@code{/@var{regexp}/} is an abbreviation for the following comparison expression:
@example
$0 ~ /@var{regexp}/
@end example
One special place where @code{/foo/} is @emph{not} an abbreviation for
-@samp{$0 ~ /foo/} is when it is the right-hand operand of @samp{~} or
-@samp{!~}!
+@samp{$0 ~ /foo/} is when it is the righthand operand of @samp{~} or
+@samp{!~}.
@xref{Using Constant Regexps, ,Using Regular Expression Constants},
where this is discussed in more detail.
-@c This paragraph has been here since day 1, and has always bothered
-@c me, especially since the expression doesn't really make a lot of
-@c sense. So, just take it out.
-@ignore
-In some contexts it may be necessary to write parentheses around the
-regexp to avoid confusing the @code{gawk} parser. For example,
-@samp{(/x/ - /y/) > threshold} is not allowed, but @samp{((/x/) - (/y/))
-> threshold} parses properly.
-@end ignore
-
@node Boolean Ops, Conditional Exp, Typing and Comparison, Expressions
@section Boolean Expressions
@cindex expression, boolean
@cindex boolean expressions
@cindex operators, boolean
@cindex boolean operators
-@cindex logical operations
-@cindex operations, logical
+@cindex logical operators
+@cindex operators, logical
@cindex short-circuit operators
@cindex operators, short-circuit
-@cindex and operator
-@cindex or operator
-@cindex not operator
+@cindex AND logical operator
+@cindex OR logical operator
+@cindex NOT logical operator
@cindex @code{&&} operator
@cindex @code{||} operator
@cindex @code{!} operator
-A @dfn{boolean expression} is a combination of comparison expressions or
-matching expressions, using the boolean operators ``or''
+A @dfn{Boolean expression} is a combination of comparison expressions or
+matching expressions, using the Boolean operators ``or''
(@samp{||}), ``and'' (@samp{&&}), and ``not'' (@samp{!}), along with
-parentheses to control nesting. The truth value of the boolean expression is
+parentheses to control nesting. The truth value of the Boolean expression is
computed by combining the truth values of the component expressions.
Boolean expressions are also referred to as @dfn{logical expressions}.
The terms are equivalent.
Boolean expressions can be used wherever comparison and matching
expressions can be used. They can be used in @code{if}, @code{while},
-@code{do} and @code{for} statements
+@code{do}, and @code{for} statements
(@pxref{Statements, ,Control Statements in Actions}).
-They have numeric values (one if true, zero if false), which come into play
-if the result of the boolean expression is stored in a variable, or
+They have numeric values (one if true, zero if false), that come into play
+if the result of the Boolean expression is stored in a variable or
used in arithmetic.
-In addition, every boolean expression is also a valid pattern, so
+In addition, every Boolean expression is also a valid pattern, so
you can use one as a pattern to control the execution of rules.
+The Boolean operators are:
-Here are descriptions of the three boolean operators, with examples.
-
-@c @cartouche
@table @code
@item @var{boolean1} && @var{boolean2}
True if both @var{boolean1} and @var{boolean2} are true. For example,
the following statement prints the current input record if it contains
-both @samp{2400} and @samp{foo}.
+both @samp{2400} and @samp{foo}:
@example
if ($0 ~ /2400/ && $0 ~ /foo/) print
@end example
+@cindex side effects
The subexpression @var{boolean2} is evaluated only if @var{boolean1}
is true. This can make a difference when @var{boolean2} contains
-expressions that have side effects: in the case of @samp{$0 ~ /foo/ &&
+expressions that have side effects. In the case of @samp{$0 ~ /foo/ &&
($2 == bar++)}, the variable @code{bar} is not incremented if there is
-no @samp{foo} in the record.
+no substring @samp{foo} in the record.
@item @var{boolean1} || @var{boolean2}
True if at least one of @var{boolean1} or @var{boolean2} is true.
For example, the following statement prints all records in the input
that contain @emph{either} @samp{2400} or
-@samp{foo}, or both.
+@samp{foo} or both:
@example
if ($0 ~ /2400/ || $0 ~ /foo/) print
@@ -6921,17 +8304,19 @@ is false. This can make a difference when @var{boolean2} contains
expressions that have side effects.
@item ! @var{boolean}
-True if @var{boolean} is false. For example, the following program prints
-all records in the input file @file{BBS-list} that do @emph{not} contain the
-string @samp{foo}.
+True if @var{boolean} is false. For example,
+the following program prints @samp{no home!} in
+the unusual event that the @env{HOME} environment
+variable is not defined:
-@c A better example would be `if (! (subscript in array)) ...' but we
-@c haven't done anything with arrays or `in' yet. Sigh.
@example
-awk '@{ if (! ($0 ~ /foo/)) print @}' BBS-list
+BEGIN @{ if (! ("HOME" in ENVIRON))
+ print "no home!" @}
@end example
+
+(The @code{in} operator is described in
+@ref{Reference to Elements, ,Referring to an Array Element}.)
@end table
-@c @end cartouche
The @samp{&&} and @samp{||} operators are called @dfn{short-circuit}
operators because of the way they work. Evaluation of the full expression
@@ -6939,48 +8324,56 @@ is ``short-circuited'' if the result can be determined part way through
its evaluation.
@cindex line continuation
-You can continue a statement that uses @samp{&&} or @samp{||} simply
+Statements that use @samp{&&} or @samp{||} can be continued simply
by putting a newline after them. But you cannot put a newline in front
of either of these operators without using backslash continuation
-(@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}).
+(@pxref{Statements/Lines, ,@command{awk} Statements Versus Lines}).
-The actual value of an expression using the @samp{!} operator will be
+@cindex flag variables
+The actual value of an expression using the @samp{!} operator is
either one or zero, depending upon the truth value of the expression it
is applied to.
-
The @samp{!} operator is often useful for changing the sense of a flag
variable from false to true and back again. For example, the following
program is one way to print lines in between special bracketing lines:
@example
-$1 == "START" @{ interested = ! interested @}
+$1 == "START" @{ interested = ! interested; next @}
interested == 1 @{ print @}
-$1 == "END" @{ interested = ! interested @}
+$1 == "END" @{ interested = ! interested; next @}
@end example
@noindent
-The variable @code{interested}, like all @code{awk} variables, starts
+The variable @code{interested}, as with all @command{awk} variables, starts
out initialized to zero, which is also false. When a line is seen whose
first field is @samp{START}, the value of @code{interested} is toggled
to true, using @samp{!}. The next rule prints lines as long as
@code{interested} is true. When a line is seen whose first field is
@samp{END}, @code{interested} is toggled back to false.
+
@ignore
-We should discuss using `next' in the two rules that toggle the
-variable, to avoid printing the bracketing lines, but that's more
-distraction than really needed.
+Scott Deifik points out that this program isn't robust against
+bogus input data, but the point is to illustrate the use of `!',
+so we'll leave well enough alone.
@end ignore
+@strong{Note:} The @code{next} statement is discussed in
+@ref{Next Statement, ,The @code{next} Statement}.
+@code{next} tells @command{awk} to skip the rest of the rules, get the
+next record, and start processing the rules over again at the top.
+The reason it's there is to avoid printing the bracketing
+@samp{START} and @samp{END} lines.
+
@node Conditional Exp, Function Calls, Boolean Ops, Expressions
@section Conditional Expressions
@cindex conditional expression
@cindex expression, conditional
-A @dfn{conditional expression} is a special kind of expression with
+A @dfn{conditional expression} is a special kind of expression that has
three operands. It allows you to use one expression's value to select
one of two other expressions.
-
-The conditional expression is the same as in the C language:
+The conditional expression is the same as in the C language,
+as shown here:
@example
@var{selector} ? @var{if-true-exp} : @var{if-false-exp}
@@ -6988,22 +8381,22 @@ The conditional expression is the same as in the C language:
@noindent
There are three subexpressions. The first, @var{selector}, is always
-computed first. If it is ``true'' (not zero and not null) then
+computed first. If it is ``true'' (not zero or not null), then
@var{if-true-exp} is computed next and its value becomes the value of
the whole expression. Otherwise, @var{if-false-exp} is computed next
and its value becomes the value of the whole expression.
-
-For example, this expression produces the absolute value of @code{x}:
+For example, the following expression produces the absolute value of @code{x}:
@example
-x > 0 ? x : -x
+x >= 0 ? x : -x
@end example
-Each time the conditional expression is computed, exactly one of
+@cindex side effects
+Each time the conditional expression is computed, only one of
@var{if-true-exp} and @var{if-false-exp} is used; the other is ignored.
This is important when the expressions have side effects. For example,
this conditional expression examines element @code{i} of either array
-@code{a} or array @code{b}, and increments @code{i}.
+@code{a} or array @code{b}, and increments @code{i}:
@example
x == y ? a[i++] : b[i++]
@@ -7011,46 +8404,48 @@ x == y ? a[i++] : b[i++]
@noindent
This is guaranteed to increment @code{i} exactly once, because each time
-only one of the two increment expressions is executed,
+only one of the two increment expressions is executed
and the other is not.
-@xref{Arrays, ,Arrays in @code{awk}},
+@xref{Arrays, ,Arrays in @command{awk}},
for more information about arrays.
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
@cindex line continuation
-As a minor @code{gawk} extension,
-you can continue a statement that uses @samp{?:} simply
+As a minor @command{gawk} extension,
+a statement that uses @samp{?:} can be continued simply
by putting a newline after either character.
-However, you cannot put a newline in front
-of either character without using backslash continuation
-(@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}).
-If @samp{--posix} is specified
-(@pxref{Options, , Command Line Options}), then this extension is disabled.
+However, putting a newline in front
+of either character does not work without using backslash continuation
+(@pxref{Statements/Lines, ,@command{awk} Statements Versus Lines}).
+If @option{--posix} is specified
+(@pxref{Options, , Command-Line Options}), then this extension is disabled.
@node Function Calls, Precedence, Conditional Exp, Expressions
@section Function Calls
@cindex function call
@cindex calling a function
-A @dfn{function} is a name for a particular calculation. Because it has
-a name, you can ask for it by name at any point in the program. For
+A @dfn{function} is a name for a particular calculation.
+This enables you to
+ask for it by name at any point in the program. For
example, the function @code{sqrt} computes the square root of a number.
A fixed set of functions are @dfn{built-in}, which means they are
-available in every @code{awk} program. The @code{sqrt} function is one
+available in every @command{awk} program. The @code{sqrt} function is one
of these. @xref{Built-in, ,Built-in Functions}, for a list of built-in
-functions and their descriptions. In addition, you can define your own
+functions and their descriptions. In addition, you can define
functions for use in your program.
-@xref{User-defined, ,User-defined Functions}, for how to do this.
+@xref{User-defined, ,User-Defined Functions},
+for instructions on how to do this.
@cindex arguments in function call
The way to use a function is with a @dfn{function call} expression,
which consists of the function name followed immediately by a list of
-@dfn{arguments} in parentheses. The arguments are expressions which
+@dfn{arguments} in parentheses. The arguments are expressions that
provide the raw materials for the function's calculations.
When there is more than one argument, they are separated by commas. If
-there are no arguments, write just @samp{()} after the function name.
-Here are some examples:
+there are no arguments, just write @samp{()} after the function name.
+The following examples show function calls with and without arguments:
@example
sqrt(x^2 + y^2) @i{one argument}
@@ -7058,40 +8453,41 @@ atan2(y, x) @i{two arguments}
rand() @i{no arguments}
@end example
-@strong{Do not put any space between the function name and the
-open-parenthesis!} A user-defined function name looks just like the name of
-a variable, and space would make the expression look like concatenation
-of a variable with an expression inside parentheses. Space before the
-parenthesis is harmless with built-in functions, but it is best not to get
-into the habit of using space to avoid mistakes with user-defined
-functions.
+@strong{Caution:}
+Do not put any space between the function name and the open-parenthesis!
+A user-defined function name looks just like the name of a
+variable---a space would make the expression look like concatenation of
+a variable with an expression inside parentheses.
-Each function expects a particular number of arguments. For example, the
-@code{sqrt} function must be called with a single argument, the number
-to take the square root of:
+With built-in functions, space before the parenthesis is harmless, but
+it is best not to get into the habit of using space to avoid mistakes
+with user-defined functions. Each function expects a particular number
+of arguments. For example, the @code{sqrt} function must be called with
+a single argument: the number to take the square root of:
@example
sqrt(@var{argument})
@end example
-Some of the built-in functions allow you to omit the final argument.
-If you do so, they use a reasonable default.
+Some of the built-in functions have one or
+more optional arguments.
+If those arguments are not supplied, the functions
+use a reasonable default value.
@xref{Built-in, ,Built-in Functions}, for full details. If arguments
are omitted in calls to user-defined functions, then those arguments are
-treated as local variables, initialized to the empty string
-(@pxref{User-defined, ,User-defined Functions}).
+treated as local variables and initialized to the empty string
+(@pxref{User-defined, ,User-Defined Functions}).
+@cindex side effects
Like every other expression, the function call has a value, which is
computed by the function based on the arguments you give it. In this
example, the value of @samp{sqrt(@var{argument})} is the square root of
@var{argument}. A function can also have side effects, such as assigning
values to certain variables or doing I/O.
-
-Here is a command to read numbers, one number per line, and print the
+The following program reads numbers, one number per line, and prints the
square root of each one:
@example
-@group
$ awk '@{ print "The square root of", $1, "is", sqrt($1) @}'
1
@print{} The square root of 1 is 1
@@ -7099,48 +8495,83 @@ $ awk '@{ print "The square root of", $1, "is", sqrt($1) @}'
@print{} The square root of 3 is 1.73205
5
@print{} The square root of 5 is 2.23607
-@kbd{Control-d}
-@end group
+@kbd{Ctrl-d}
@end example
-@node Precedence, , Function Calls, Expressions
+@node Precedence, , Function Calls, Expressions
@section Operator Precedence (How Operators Nest)
@cindex precedence
@cindex operator precedence
-@dfn{Operator precedence} determines how operators are grouped, when
+@dfn{Operator precedence} determines how operators are grouped when
different operators appear close by in one expression. For example,
@samp{*} has higher precedence than @samp{+}; thus, @samp{a + b * c}
means to multiply @code{b} and @code{c}, and then add @code{a} to the
-product (i.e.@: @samp{a + (b * c)}).
+product (i.e., @samp{a + (b * c)}).
-You can overrule the precedence of the operators by using parentheses.
-You can think of the precedence rules as saying where the
-parentheses are assumed to be if you do not write parentheses yourself. In
-fact, it is wise to always use parentheses whenever you have an unusual
+The normal precedence of the operators can be overruled by using parentheses.
+Think of the precedence rules as saying where the
+parentheses are assumed to be. In
+fact, it is wise to always use parentheses whenever there is an unusual
combination of operators, because other people who read the program may
-not remember what the precedence is in this case. You might forget,
-too; then you could make a mistake. Explicit parentheses will help prevent
-any such mistake.
+not remember what the precedence is in this case.
+Even experienced programmers occasionally forget the exact rules,
+which leads to mistakes.
+Explicit parentheses help prevent
+any such mistakes.
When operators of equal precedence are used together, the leftmost
-operator groups first, except for the assignment, conditional and
+operator groups first, except for the assignment, conditional, and
exponentiation operators, which group in the opposite order.
-Thus, @samp{a - b + c} groups as @samp{(a - b) + c}, and
+Thus, @samp{a - b + c} groups as @samp{(a - b) + c} and
@samp{a = b = c} groups as @samp{a = (b = c)}.
The precedence of prefix unary operators does not matter as long as only
unary operators are involved, because there is only one way to interpret
-them---innermost first. Thus, @samp{$++i} means @samp{$(++i)} and
+them: innermost first. Thus, @samp{$++i} means @samp{$(++i)} and
@samp{++$x} means @samp{++($x)}. However, when another operator follows
the operand, then the precedence of the unary operators can matter.
-Thus, @samp{$x^2} means @samp{($x)^2}, but @samp{-x^2} means
-@samp{-(x^2)}, because @samp{-} has lower precedence than @samp{^}
-while @samp{$} has higher precedence.
-
-Here is a table of @code{awk}'s operators, in order from highest
+@samp{$x^2} means @samp{($x)^2}, but @samp{-x^2} means
+@samp{-(x^2)}, because @samp{-} has lower precedence than @samp{^},
+whereas @samp{$} has higher precedence.
+This table presents @command{awk}'s operators, in order of highest
precedence to lowest:
+@page
+
+@cindex @code{$} field operator
+@cindex @code{+} operator
+@cindex @code{-} operator
+@cindex @code{!} operator
+@cindex @code{*} operator
+@cindex @code{/} operator
+@cindex @code{%} operator
+@cindex @code{^} operator
+@cindex @code{**} operator
+@cindex @code{++} operator
+@cindex @code{--} operator
+@cindex @code{<} operator
+@cindex @code{<=} operator
+@cindex @code{==} operator
+@cindex @code{!=} operator
+@cindex @code{>} operator
+@cindex @code{>=} operator
+@cindex @code{>>} I/O operator
+@cindex @code{|} I/O operator
+@cindex @code{|&} I/O operator
+@cindex @code{~} operator
+@cindex @code{!~} operator
+@cindex @code{in} operator
+@cindex @code{&&} operator
+@cindex @code{||} operator
+@cindex @code{?:} operator
+@cindex @code{+=} operator
+@cindex @code{-=} operator
+@cindex @code{*=} operator
+@cindex @code{/=} operator
+@cindex @code{%=} operator
+@cindex @code{^=} operator
+@cindex @code{**=} operator
@c use @code in the items, looks better in TeX w/o all the quotes
@table @code
@item (@dots{})
@@ -7152,14 +8583,11 @@ Field.
@item ++ --
Increment, decrement.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
@item ^ **
Exponentiation. These operators group right-to-left.
-(The @samp{**} operator is not specified by POSIX.)
@item + - !
-Unary plus, minus, logical ``not''.
+Unary plus, minus, logical ``not.''
@item * / %
Multiplication, division, modulus.
@@ -7167,23 +8595,24 @@ Multiplication, division, modulus.
@item + -
Addition, subtraction.
-@item @r{Concatenation}
-No special token is used to indicate concatenation.
-The operands are simply written side by side.
+@item @r{String Concatenation}
+No special symbol is used to indicate concatenation.
+The operands are simply written side by side
+(@pxref{Concatenation, ,String Concatenation}).
@item < <= == !=
-@itemx > >= >> |
-Relational, and redirection.
+@itemx > >= >> | |&
+Relational and redirection.
The relational operators and the redirections have the same precedence
level. Characters such as @samp{>} serve both as relationals and as
redirections; the context distinguishes between the two meanings.
Note that the I/O redirection operators in @code{print} and @code{printf}
statements belong to the statement level, not to expressions. The
-redirection does not produce an expression which could be the operand of
+redirection does not produce an expression that could be the operand of
another operator. As a result, it does not make sense to use a
-redirection operator near another operator of lower precedence, without
-parentheses. Such combinations, for example @samp{print foo > a ? b : c},
+redirection operator near another operator of lower precedence without
+parentheses. Such combinations (for example @samp{print foo > a ? b : c}),
result in syntax errors.
The correct way to write this statement is @samp{print foo > (a ? b : c)}.
@@ -7202,36 +8631,47 @@ Logical ``or''.
@item ?:
Conditional. This operator groups right-to-left.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
@item = += -= *=
@itemx /= %= ^= **=
Assignment. These operators group right-to-left.
-(The @samp{**=} operator is not specified by POSIX.)
@end table
-@node Patterns and Actions, Statements, Expressions, Top
-@chapter Patterns and Actions
+@cindex portability issues
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@strong{Note:}
+The @samp{|&}, @samp{**}, and @samp{**=} operators are not specified by POSIX.
+For maximum portability, do not use them.
+
+@node Patterns and Actions, Arrays, Expressions, Top
+@chapter Patterns, Actions, and Variables
@cindex pattern, definition of
-As you have already seen, each @code{awk} statement consists of
-a pattern with an associated action. This chapter describes how
-you build patterns and actions.
+As you have already seen, each @command{awk} statement consists of
+a pattern with an associated action. This @value{CHAPTER} describes how
+you build patterns and actions, what kinds of things you can do within
+actions, and @command{awk}'s built-in variables.
+
+The pattern-action rules and the statements available for use
+within actions form the core of @command{awk} programming.
+In a sense, everything covered
+up to here has been the foundation
+that programs are built on top of. Now it's time to start
+building something useful.
@menu
* Pattern Overview:: What goes into a pattern.
+* Using Shell Variables:: How to use shell variables with @command{awk}.
* Action Overview:: What goes into an action.
+* Statements:: Describes the various control statements in
+ detail.
+* Built-in Variables:: Summarizes the built-in variables.
@end menu
-@node Pattern Overview, Action Overview, Patterns and Actions, Patterns and Actions
+@node Pattern Overview, Using Shell Variables, Patterns and Actions, Patterns and Actions
@section Pattern Elements
-Patterns in @code{awk} control the execution of rules: a rule is
-executed when its pattern matches the current input record. This
-section explains all about how to write patterns.
-
@menu
-* Kinds of Patterns:: A list of all kinds of patterns.
* Regexp Patterns:: Using regexps as patterns.
* Expression Patterns:: Any expression can be used as a pattern.
* Ranges:: Pairs of patterns specify record ranges.
@@ -7239,33 +8679,32 @@ section explains all about how to write patterns.
* Empty:: The empty pattern, which matches every record.
@end menu
-@node Kinds of Patterns, Regexp Patterns, Pattern Overview, Pattern Overview
-@subsection Kinds of Patterns
@cindex patterns, types of
-
-Here is a summary of the types of patterns supported in @code{awk}.
+Patterns in @command{awk} control the execution of rules---a rule is
+executed when its pattern matches the current input record.
+The following is a summary of the types of patterns in @command{awk}:
@table @code
@item /@var{regular expression}/
-A regular expression as a pattern. It matches when the text of the
+A regular expression. It matches when the text of the
input record fits the regular expression.
(@xref{Regexp, ,Regular Expressions}.)
@item @var{expression}
A single expression. It matches when its value
-is non-zero (if a number) or non-null (if a string).
+is nonzero (if a number) or non-null (if a string).
(@xref{Expression Patterns, ,Expressions as Patterns}.)
@item @var{pat1}, @var{pat2}
A pair of patterns separated by a comma, specifying a range of records.
-The range includes both the initial record that matches @var{pat1}, and
+The range includes both the initial record that matches @var{pat1} and
the final record that matches @var{pat2}.
(@xref{Ranges, ,Specifying Record Ranges with Patterns}.)
@item BEGIN
@itemx END
-Special patterns for you to supply start-up or clean-up actions for your
-@code{awk} program.
+Special patterns for you to supply startup or cleanup actions for your
+@command{awk} program.
(@xref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}.)
@item @var{empty}
@@ -7273,10 +8712,11 @@ The empty pattern matches every input record.
(@xref{Empty, ,The Empty Pattern}.)
@end table
-@node Regexp Patterns, Expression Patterns, Kinds of Patterns, Pattern Overview
+@node Regexp Patterns, Expression Patterns, Pattern Overview, Pattern Overview
@subsection Regular Expressions as Patterns
-We have been using regular expressions as patterns since our early examples.
+Regular expressions are one of the first kinds of patterns presented
+in this book.
This kind of pattern is simply a regexp constant in the pattern part of
a rule. Its meaning is @samp{$0 ~ /@var{pattern}/}.
The pattern matches when the input record matches the regexp.
@@ -7290,55 +8730,54 @@ END @{ print buzzwords, "buzzwords seen" @}
@node Expression Patterns, Ranges, Regexp Patterns, Pattern Overview
@subsection Expressions as Patterns
-Any @code{awk} expression is valid as an @code{awk} pattern.
-Then the pattern matches if the expression's value is non-zero (if a
+Any @command{awk} expression is valid as an @command{awk} pattern.
+The pattern matches if the expression's value is nonzero (if a
number) or non-null (if a string).
-
The expression is reevaluated each time the rule is tested against a new
input record. If the expression uses fields such as @code{$1}, the
-value depends directly on the new input record's text; otherwise, it
-depends only on what has happened so far in the execution of the
-@code{awk} program, but that may still be useful.
-
-A very common kind of expression used as a pattern is the comparison
-expression, using the comparison operators described in
-@ref{Typing and Comparison, ,Variable Typing and Comparison Expressions}.
+value depends directly on the new input record's text; otherwise it
+depends on only what has happened so far in the execution of the
+@command{awk} program.
+Comparison expressions, using the comparison operators described in
+@ref{Typing and Comparison, ,Variable Typing and Comparison Expressions},
+are a very common kind of pattern.
Regexp matching and non-matching are also very common expressions.
The left operand of the @samp{~} and @samp{!~} operators is a string.
The right operand is either a constant regular expression enclosed in
-slashes (@code{/@var{regexp}/}), or any expression, whose string value
+slashes (@code{/@var{regexp}/}), or any expression whose string value
is used as a dynamic regular expression
(@pxref{Computed Regexps, , Using Dynamic Regexps}).
-
The following example prints the second field of each input record
-whose first field is precisely @samp{foo}.
+whose first field is precisely @samp{foo}:
@example
$ awk '$1 == "foo" @{ print $2 @}' BBS-list
@end example
@noindent
-(There is no output, since there is no BBS site named ``foo''.)
-Contrast this with the following regular expression match, which would
-accept any record with a first field that contains @samp{foo}:
+(There is no output, because there is no BBS site with the exact name @samp{foo}.)
+Contrast this with the following regular expression match, which
+accepts any record with a first field that contains @samp{foo}:
@example
-@group
$ awk '$1 ~ /foo/ @{ print $2 @}' BBS-list
@print{} 555-1234
@print{} 555-6699
@print{} 555-6480
@print{} 555-2127
-@end group
@end example
+A regexp constant as a pattern is also a special case of an expression
+pattern. The expression @code{/foo/} has the value one if @samp{foo}
+appears in the current input record. Thus, as a pattern, @code{/foo/}
+matches any record containing @samp{foo}.
+
Boolean expressions are also commonly used as patterns.
Whether the pattern
matches an input record depends on whether its subexpressions match.
-
-For example, the following command prints all records in
-@file{BBS-list} that contain both @samp{2400} and @samp{foo}.
+For example, the following command prints all the records in
+@file{BBS-list} that contain both @samp{2400} and @samp{foo}:
@example
$ awk '/2400/ && /foo/' BBS-list
@@ -7346,11 +8785,10 @@ $ awk '/2400/ && /foo/' BBS-list
@end example
The following command prints all records in
-@file{BBS-list} that contain @emph{either} @samp{2400} or @samp{foo}, or
-both.
+@file{BBS-list} that contain @emph{either} @samp{2400} or @samp{foo}
+(or both, of course):
@example
-@group
$ awk '/2400/ || /foo/' BBS-list
@print{} alpo-net 555-3412 2400/1200/300 A
@print{} bites 555-1675 2400/1200/300 A
@@ -7359,14 +8797,12 @@ $ awk '/2400/ || /foo/' BBS-list
@print{} macfoo 555-6480 1200/300 A
@print{} sdace 555-3430 2400/1200/300 A
@print{} sabafoo 555-2127 1200/300 C
-@end group
@end example
The following command prints all records in
-@file{BBS-list} that do @emph{not} contain the string @samp{foo}.
+@file{BBS-list} that do @emph{not} contain the string @samp{foo}:
@example
-@group
$ awk '! /foo/' BBS-list
@print{} aardvark 555-5553 1200/300 B
@print{} alpo-net 555-3412 2400/1200/300 A
@@ -7375,20 +8811,14 @@ $ awk '! /foo/' BBS-list
@print{} camelot 555-0542 300 C
@print{} core 555-2912 1200/300 C
@print{} sdace 555-3430 2400/1200/300 A
-@end group
@end example
-The subexpressions of a boolean operator in a pattern can be constant regular
-expressions, comparisons, or any other @code{awk} expressions. Range
-patterns are not expressions, so they cannot appear inside boolean
+The subexpressions of a Boolean operator in a pattern can be constant regular
+expressions, comparisons, or any other @command{awk} expressions. Range
+patterns are not expressions, so they cannot appear inside Boolean
patterns. Likewise, the special patterns @code{BEGIN} and @code{END},
which never match any input record, are not expressions and cannot
-appear inside boolean patterns.
-
-A regexp constant as a pattern is also a special case of an expression
-pattern. @code{/foo/} as an expression has the value one if @samp{foo}
-appears in the current input record; thus, as a pattern, @code{/foo/}
-matches any record containing @samp{foo}.
+appear inside Boolean patterns.
@node Ranges, BEGIN/END, Expression Patterns, Pattern Overview
@subsection Specifying Record Ranges with Patterns
@@ -7396,26 +8826,26 @@ matches any record containing @samp{foo}.
@cindex range pattern
@cindex pattern, range
@cindex matching ranges of lines
-A @dfn{range pattern} is made of two patterns separated by a comma, of
-the form @samp{@var{begpat}, @var{endpat}}. It matches ranges of
+A @dfn{range pattern} is made of two patterns separated by a comma, in
+the form @samp{@var{begpat}, @var{endpat}}. It is used to match ranges of
consecutive input records. The first pattern, @var{begpat}, controls
-where the range begins, and the second one, @var{endpat}, controls where
-it ends. For example,
+where the range begins, while @var{endpat} controls where
+the pattern ends. For example, the following:
@example
-awk '$1 == "on", $1 == "off"'
+awk '$1 == "on", $1 == "off"' myfile
@end example
@noindent
-prints every record between @samp{on}/@samp{off} pairs, inclusive.
-
-A range pattern starts out by matching @var{begpat}
-against every input record; when a record matches @var{begpat}, the
-range pattern becomes @dfn{turned on}. The range pattern matches this
-record. As long as it stays turned on, it automatically matches every
-input record read. It also matches @var{endpat} against
-every input record; when that succeeds, the range pattern is turned
-off again for the following record. Then it goes back to checking
+prints every record in @file{myfile} between @samp{on}/@samp{off} pairs, inclusive.
+
+A range pattern starts out by matching @var{begpat} against every
+input record. When a record matches @var{begpat}, the range pattern is
+@dfn{turned on} and the range pattern matches this record as well. As long as
+the range pattern stays turned on, it automatically matches every input
+record read. The range pattern also matches @var{endpat} against every
+input record; when this succeeds, the range pattern is turned off again
+for the following record. Then the range pattern goes back to checking
@var{begpat} against each record.
The record that turns on the range pattern and the one that turns it
@@ -7423,18 +8853,18 @@ off both match the range pattern. If you don't want to operate on
these records, you can write @code{if} statements in the rule's action
to distinguish them from the records you are interested in.
-It is possible for a pattern to be turned both on and off by the same
-record, if the record satisfies both conditions. Then the action is
+It is possible for a pattern to be turned on and off by the same
+record. If the record satisfies both conditions, then the action is
executed for just that record.
-
-For example, suppose you have text between two identical markers (say
-the @samp{%} symbol) that you wish to ignore. You might try to
+For example, suppose there is text between two identical markers (say
+the @samp{%} symbol), each on its own line, that should be ignored.
+A first attempt would be to
combine a range pattern that describes the delimited text with the
@code{next} statement
-(not discussed yet, @pxref{Next Statement, , The @code{next} Statement}),
-which causes @code{awk} to skip any further processing of the current
+(not discussed yet, @pxref{Next Statement, , The @code{next} Statement}).
+This causes @command{awk} to skip any further processing of the current
record and start over again with the next input record. Such a program
-would look like this:
+looks like this:
@example
/^%$/,/^%$/ @{ next @}
@@ -7443,28 +8873,37 @@ would look like this:
@noindent
@cindex skipping lines between markers
+@cindex flag variables
This program fails because the range pattern is both turned on and turned off
-by the first line with just a @samp{%} on it. To accomplish this task, you
-must write the program this way, using a flag:
+by the first line, which just has a @samp{%} on it. To accomplish this task,
+write the program in the following manner, using a flag:
+@cindex @code{!} operator
@example
/^%$/ @{ skip = ! skip; next @}
skip == 1 @{ next @} # skip lines with `skip' set
@end example
-Note that in a range pattern, the @samp{,} has the lowest precedence
-(is evaluated last) of all the operators. Thus, for example, the
-following program attempts to combine a range pattern with another,
-simpler test.
+In a range pattern, the comma (@samp{,}) has the lowest precedence of
+all the operators (i.e., it is evaluated last). Thus, the following
+program attempts to combine a range pattern with another simpler test:
@example
echo Yes | awk '/1/,/2/ || /Yes/'
@end example
-The author of this program intended it to mean @samp{(/1/,/2/) || /Yes/}.
-However, @code{awk} interprets this as @samp{/1/, (/2/ || /Yes/)}.
+The intent of this program is @samp{(/1/,/2/) || /Yes/}.
+However, @command{awk} interprets this as @samp{/1/, (/2/ || /Yes/)}.
This cannot be changed or worked around; range patterns do not combine
-with other patterns.
+with other patterns:
+
+@example
+$ echo yes | gawk '(/1/,/2/) || /Yes/'
+@error{} gawk: cmd. line:1: (/1/,/2/) || /Yes/
+@error{} gawk: cmd. line:1: ^ parse error
+@error{} gawk: cmd. line:2: (/1/,/2/) || /Yes/
+@error{} gawk: cmd. line:2: ^ unexpected newline
+@end example
@node BEGIN/END, Empty, Ranges, Pattern Overview
@subsection The @code{BEGIN} and @code{END} Special Patterns
@@ -7473,9 +8912,15 @@ with other patterns.
@cindex pattern, @code{BEGIN}
@cindex @code{END} special pattern
@cindex pattern, @code{END}
-@code{BEGIN} and @code{END} are special patterns. They are not used to
-match input records. Rather, they supply start-up or
-clean-up actions for your @code{awk} script.
+@cindex blocks, @code{BEGIN} and @code{END}
+All the patterns described so far are for matching input records.
+The @code{BEGIN} and @code{END} special patterns are different.
+They supply startup and cleanup actions for @command{awk} programs.
+@code{BEGIN} and @code{END} rules must have actions; there is no default
+action for these rules because there is no current record when they run.
+@code{BEGIN} and @code{END} rules are often referred to as
+``@code{BEGIN} and @code{END} blocks'' by long-time @command{awk}
+programmers.
@menu
* Using BEGIN/END:: How and why to use BEGIN/END rules.
@@ -7485,115 +8930,113 @@ clean-up actions for your @code{awk} script.
@node Using BEGIN/END, I/O And BEGIN/END, BEGIN/END, BEGIN/END
@subsubsection Startup and Cleanup Actions
-A @code{BEGIN} rule is executed, once, before the first input record
-has been read. An @code{END} rule is executed, once, after all the
-input has been read. For example:
+A @code{BEGIN} rule is executed once only, before the first input record
+is read. Likewise, an @code{END} rule is executed once only, after all the
+input is read. For example:
@example
-@group
$ awk '
> BEGIN @{ print "Analysis of \"foo\"" @}
> /foo/ @{ ++n @}
-> END @{ print "\"foo\" appears " n " times." @}' BBS-list
+> END @{ print "\"foo\" appears", n, "times." @}' BBS-list
@print{} Analysis of "foo"
@print{} "foo" appears 4 times.
-@end group
@end example
This program finds the number of records in the input file @file{BBS-list}
that contain the string @samp{foo}. The @code{BEGIN} rule prints a title
for the report. There is no need to use the @code{BEGIN} rule to
-initialize the counter @code{n} to zero, as @code{awk} does this
+initialize the counter @code{n} to zero, since @command{awk} does this
automatically (@pxref{Variables}).
-
The second rule increments the variable @code{n} every time a
record containing the pattern @samp{foo} is read. The @code{END} rule
prints the value of @code{n} at the end of the run.
The special patterns @code{BEGIN} and @code{END} cannot be used in ranges
-or with boolean operators (indeed, they cannot be used with any operators).
-
-An @code{awk} program may have multiple @code{BEGIN} and/or @code{END}
-rules. They are executed in the order they appear, all the @code{BEGIN}
-rules at start-up and all the @code{END} rules at termination.
+or with Boolean operators (indeed, they cannot be used with any operators).
+An @command{awk} program may have multiple @code{BEGIN} and/or @code{END}
+rules. They are executed in the order in which they appear: all the @code{BEGIN}
+rules at startup and all the @code{END} rules at termination.
@code{BEGIN} and @code{END} rules may be intermixed with other rules.
-This feature was added in the 1987 version of @code{awk}, and is included
-in the POSIX standard. The original (1978) version of @code{awk}
-required you to put the @code{BEGIN} rule at the beginning of the
-program, and the @code{END} rule at the end, and only allowed one of
-each. This is no longer required, but it is a good idea in terms of
-program organization and readability.
+This feature was added in the 1987 version of @command{awk} and is included
+in the POSIX standard.
+The original (1978) version of @command{awk}
+required the @code{BEGIN} rule to be placed at the beginning of the
+program, the @code{END} rule to be placed at the end, and only allowed one of
+each.
+This is no longer required, but it is a good idea to follow this template
+in terms of program organization and readability.
Multiple @code{BEGIN} and @code{END} rules are useful for writing
-library functions, since each library file can have its own @code{BEGIN} and/or
-@code{END} rule to do its own initialization and/or cleanup. Note that
-the order in which library functions are named on the command line
+library functions, because each library file can have its own @code{BEGIN} and/or
+@code{END} rule to do its own initialization and/or cleanup.
+The order in which library functions are named on the command line
controls the order in which their @code{BEGIN} and @code{END} rules are
-executed. Therefore you have to be careful to write such rules in
+executed. Therefore you have to be careful when writing such rules in
library files so that the order in which they are executed doesn't matter.
-@xref{Options, ,Command Line Options}, for more information on
+@xref{Options, ,Command-Line Options}, for more information on
using library functions.
-@xref{Library Functions, ,A Library of @code{awk} Functions},
+@xref{Library Functions, ,A Library of @command{awk} Functions},
for a number of useful library functions.
-@cindex dark corner
-If an @code{awk} program only has a @code{BEGIN} rule, and no other
-rules, then the program exits after the @code{BEGIN} rule has been run.
-(The original version of @code{awk} used to keep reading and ignoring input
-until end of file was seen.) However, if an @code{END} rule exists,
-then the input will be read, even if there are no other rules in
-the program. This is necessary in case the @code{END} rule checks the
-@code{FNR} and @code{NR} variables (d.c.).
-
-@code{BEGIN} and @code{END} rules must have actions; there is no default
-action for these rules since there is no current record when they run.
+If an @command{awk} program only has a @code{BEGIN} rule and no
+other rules, then the program exits after the @code{BEGIN} rule is
+run.@footnote{The original version of @command{awk} used to keep
+reading and ignoring input until end of file was seen.} However, if an
+@code{END} rule exists, then the input is read, even if there are
+no other rules in the program. This is necessary in case the @code{END}
+rule checks the @code{FNR} and @code{NR} variables.
@node I/O And BEGIN/END, , Using BEGIN/END, BEGIN/END
@subsubsection Input/Output from @code{BEGIN} and @code{END} Rules
-@cindex I/O from @code{BEGIN} and @code{END}
-There are several (sometimes subtle) issues involved when doing I/O
+@cindex I/O, from @code{BEGIN} and @code{END}
+There are several (sometimes subtle) points to remember when doing I/O
from a @code{BEGIN} or @code{END} rule.
-
The first has to do with the value of @code{$0} in a @code{BEGIN}
-rule. Since @code{BEGIN} rules are executed before any input is read,
+rule. Because @code{BEGIN} rules are executed before any input is read,
there simply is no input record, and therefore no fields, when
executing @code{BEGIN} rules. References to @code{$0} and the fields
yield a null string or zero, depending upon the context. One way
to give @code{$0} a real value is to execute a @code{getline} command
without a variable (@pxref{Getline, ,Explicit Input with @code{getline}}).
-Another way is to simply assign a value to it.
+Another way is to simply assign a value to @code{$0}.
-@cindex differences between @code{gawk} and @code{awk}
-The second point is similar to the first, but from the other direction.
-Inside an @code{END} rule, what is the value of @code{$0} and @code{NF}?
+@cindex differences between @command{gawk} and @command{awk}
+The second point is similar to the first but from the other direction.
Traditionally, due largely to implementation issues, @code{$0} and
@code{NF} were @emph{undefined} inside an @code{END} rule.
-The POSIX standard specified that @code{NF} was available in an @code{END}
-rule, containing the number of fields from the last input record.
-Due most probably to an oversight, the standard does not say that @code{$0}
+The POSIX standard specifies that @code{NF} is available in an @code{END}
+rule. It contains the number of fields from the last input record.
+Most probably due to an oversight, the standard does not say that @code{$0}
is also preserved, although logically one would think that it should be.
-In fact, @code{gawk} does preserve the value of @code{$0} for use in
-@code{END} rules. Be aware, however, that Unix @code{awk}, and possibly
+In fact, @command{gawk} does preserve the value of @code{$0} for use in
+@code{END} rules. Be aware, however, that Unix @command{awk}, and possibly
other implementations, do not.
-The third point follows from the first two. What is the meaning of
-@samp{print} inside a @code{BEGIN} or @code{END} rule? The meaning is
-the same as always, @samp{print $0}. If @code{$0} is the null string,
-then this prints an empty line. Many long time @code{awk} programmers
-use @samp{print} in @code{BEGIN} and @code{END} rules, to mean
-@samp{@w{print ""}}, relying on @code{$0} being null. While you might
-generally get away with this in @code{BEGIN} rules, in @code{gawk} at
-least, it is a very bad idea in @code{END} rules. It is also poor
-style, since if you want an empty line in the output, you
-should say so explicitly in your program.
-
-@node Empty, , BEGIN/END, Pattern Overview
+The third point follows from the first two. The meaning of @samp{print}
+inside a @code{BEGIN} or @code{END} rule is the same as always:
+@samp{print $0}. If @code{$0} is the null string, then this prints an
+empty line. Many long time @command{awk} programmers use an unadorned
+@samp{print} in @code{BEGIN} and @code{END} rules, to mean @samp{@w{print ""}},
+relying on @code{$0} being null. Although one might generally get away with
+this in @code{BEGIN} rules, it is a very bad idea in @code{END} rules,
+at least in @command{gawk}. It is also poor style, since if an empty
+line is needed in the output, the program should print one explicitly.
+
+Finally, the @code{next} and @code{nextfile} statements are not allowed
+in a @code{BEGIN} rule, because the implicit
+read-a-record-and-match-against-the-rules loop has not started yet. Similarly, those statements
+are not valid in an @code{END} rule, since all the input has been read.
+(@xref{Next Statement, ,The @code{next} Statement}, and see
+@ref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}.)
+
+@node Empty, , BEGIN/END, Pattern Overview
@subsection The Empty Pattern
@cindex empty pattern
@cindex pattern, empty
-An empty (i.e.@: non-existent) pattern is considered to match @emph{every}
+An empty (i.e., non-existent) pattern is considered to match @emph{every}
input record. For example, the program:
@example
@@ -7603,22 +9046,82 @@ awk '@{ print $1 @}' BBS-list
@noindent
prints the first field of every record.
-@node Action Overview, , Pattern Overview, Patterns and Actions
-@section Overview of Actions
+@node Using Shell Variables, Action Overview, Pattern Overview, Patterns and Actions
+@section Using Shell Variables in Programs
+@cindex shell varibles, using in @command{awk} programs
+@cindex using shell variables in @command{awk} programs
+@cindex shell and @command{awk} interaction
+
+@command{awk} programs are often used as components in larger
+programs written in shell.
+For example, it is very common to use a shell variable to
+hold a pattern that the @command{awk} program searches for.
+There are two ways to get the value of the shell variable
+into the body of the @command{awk} program.
+
+The most common method is to use shell quoting to substitute
+the variable's value into the program inside the script.
+For example, in the following program:
+
+@example
+echo -n "Enter search pattern: "
+read pattern
+awk "/$pattern/ "'@{ nmatches++ @}
+ END @{ print nmatches, "found" @}' /path/to/data
+@end example
+
+@noindent
+the @command{awk} program consists of two pieces of quoted text
+that are concatenated together to form the program.
+The first part is double-quoted, which allows substitution of
+the @code{pattern} variable inside the quotes.
+The second part is single-quoted.
+
+Variable substitution via quoting works, but can be potentially
+messy. It requires a good understanding of the shell's quoting rules
+(@pxref{Quoting, ,Shell Quoting Issues}),
+and it's often difficult to correctly
+match up the quotes when reading the program.
+
+A better method is to use @command{awk}'s variable assignment feature
+(@pxref{Assignment Options, ,Assigning Variables on the Command Line})
+to assign the shell variable's value to an @command{awk} variable's
+value. Then use dynamic regexps to match the pattern
+(@pxref{Computed Regexps, ,Using Dynamic Regexps}).
+The following shows how to redo the
+previous example using this technique:
+
+@example
+echo -n "Enter search pattern: "
+read pattern
+awk -v pat="$pattern" '$0 ~ pat @{ nmatches++ @}
+ END @{ print nmatches, "found" @}' /path/to/data
+@end example
+
+@noindent
+Now, the @command{awk} program is just one single-quoted string.
+The assignment @samp{-v pat="$pattern"} still requires double quotes,
+in case there is whitespace in the value of @code{$pattern}.
+The @command{awk} variable @code{pat} could be named @code{pattern}
+too, but that would be more confusing. Using a variable also
+provides more flexibility, since the variable can be used anywhere inside
+the program---for printing, as an array subscript, or for any other
+use---without requiring the quoting tricks at every point in the program.
+
+@node Action Overview, Statements, Using Shell Variables, Patterns and Actions
+@section Actions
@cindex action, definition of
@cindex curly braces
@cindex action, curly braces
@cindex action, separating statements
-An @code{awk} program or script consists of a series of
-rules and function definitions, interspersed. (Functions are
-described later. @xref{User-defined, ,User-defined Functions}.)
-
+An @command{awk} program or script consists of a series of
+rules and function definitions interspersed. (Functions are
+described later. @xref{User-defined, ,User-Defined Functions}.)
A rule contains a pattern and an action, either of which (but not
-both) may be
-omitted. The purpose of the @dfn{action} is to tell @code{awk} what to do
-once a match for the pattern is found. Thus, in outline, an @code{awk}
-program generally looks like this:
+both) may be omitted. The purpose of the @dfn{action} is to tell
+@command{awk} what to do once a match for the pattern is found. Thus,
+in outline, an @command{awk} program generally looks like this:
@example
@r{[}@var{pattern}@r{]} @r{[}@{ @var{action} @}@r{]}
@@ -7628,24 +9131,23 @@ function @var{name}(@var{args}) @{ @dots{} @}
@dots{}
@end example
-An action consists of one or more @code{awk} @dfn{statements}, enclosed
+An action consists of one or more @command{awk} @dfn{statements}, enclosed
in curly braces (@samp{@{} and @samp{@}}). Each statement specifies one
-thing to be done. The statements are separated by newlines or
-semicolons.
-
+thing to do. The statements are separated by newlines or semicolons.
The curly braces around an action must be used even if the action
-contains only one statement, or even if it contains no statements at
+contains only one statement, or if it contains no statements at
all. However, if you omit the action entirely, omit the curly braces as
-well. An omitted action is equivalent to @samp{@{ print $0 @}}.
+well. An omitted action is equivalent to @samp{@{ print $0 @}}:
@example
-/foo/ @{ @} # match foo, do nothing - empty action
-/foo/ # match foo, print the record - omitted action
+/foo/ @{ @} @i{match @code{foo}, do nothing --- empty action}
+/foo/ @i{match @code{foo}, print the record --- omitted action}
@end example
-Here are the kinds of statements supported in @code{awk}:
+The following types of statements are supported in @command{awk}:
@itemize @bullet
+@cindex side effects
@item
Expressions, which can call functions or assign values to variables
(@pxref{Expressions}). Executing
@@ -7654,60 +9156,54 @@ This is useful when the expression has side effects
(@pxref{Assignment Ops, ,Assignment Expressions}).
@item
-Control statements, which specify the control flow of @code{awk}
-programs. The @code{awk} language gives you C-like constructs
+Control statements, which specify the control flow of @command{awk}
+programs. The @command{awk} language gives you C-like constructs
(@code{if}, @code{for}, @code{while}, and @code{do}) as well as a few
special ones (@pxref{Statements, ,Control Statements in Actions}).
@item
Compound statements, which consist of one or more statements enclosed in
curly braces. A compound statement is used in order to put several
-statements together in the body of an @code{if}, @code{while}, @code{do}
+statements together in the body of an @code{if}, @code{while}, @code{do},
or @code{for} statement.
@item
-Input statements, using the @code{getline} command
+Input statements using the @code{getline} command
(@pxref{Getline, ,Explicit Input with @code{getline}}), the @code{next}
statement (@pxref{Next Statement, ,The @code{next} Statement}),
and the @code{nextfile} statement
-(@pxref{Nextfile Statement, ,The @code{nextfile} Statement}).
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
@item
-Output statements, @code{print} and @code{printf}.
+Output statements, such as @code{print} and @code{printf}.
@xref{Printing, ,Printing Output}.
@item
-Deletion statements, for deleting array elements.
+Deletion statements for deleting array elements.
@xref{Delete, ,The @code{delete} Statement}.
@end itemize
-@iftex
-The next chapter covers control statements in detail.
-@end iftex
-
-@node Statements, Built-in Variables, Patterns and Actions, Top
-@chapter Control Statements in Actions
+@node Statements, Built-in Variables, Action Overview, Patterns and Actions
+@section Control Statements in Actions
@cindex control statement
-@dfn{Control statements} such as @code{if}, @code{while}, and so on
-control the flow of execution in @code{awk} programs. Most of the
-control statements in @code{awk} are patterned on similar statements in
-C.
-
-All the control statements start with special keywords such as @code{if}
-and @code{while}, to distinguish them from simple expressions.
+@dfn{Control statements}, such as @code{if}, @code{while}, and so on,
+control the flow of execution in @command{awk} programs. Most of the
+control statements in @command{awk} are patterned on similar statements in C.
@cindex compound statement
@cindex statement, compound
-Many control statements contain other statements; for example, the
-@code{if} statement contains another statement which may or may not be
-executed. The contained statement is called the @dfn{body}. If you
-want to include more than one statement in the body, group them into a
+All the control statements start with special keywords, such as @code{if}
+and @code{while}, to distinguish them from simple expressions.
+Many control statements contain other statements. For example, the
+@code{if} statement contains another statement that may or may not be
+executed. The contained statement is called the @dfn{body}.
+To include more than one statement in the body, group them into a
single @dfn{compound statement} with curly braces, separating them with
newlines or semicolons.
@menu
-* If Statement:: Conditionally execute some @code{awk}
+* If Statement:: Conditionally execute some @command{awk}
statements.
* While Statement:: Loop until some condition is satisfied.
* Do Statement:: Do specified action while looping until some
@@ -7719,14 +9215,14 @@ newlines or semicolons.
loop.
* Next Statement:: Stop processing the current input record.
* Nextfile Statement:: Stop processing the current file.
-* Exit Statement:: Stop execution of @code{awk}.
+* Exit Statement:: Stop execution of @command{awk}.
@end menu
@node If Statement, While Statement, Statements, Statements
-@section The @code{if}-@code{else} Statement
+@subsection The @code{if}-@code{else} Statement
@cindex @code{if}-@code{else} statement
-The @code{if}-@code{else} statement is @code{awk}'s decision-making
+The @code{if}-@code{else} statement is @command{awk}'s decision-making
statement. It looks like this:
@example
@@ -7735,13 +9231,12 @@ if (@var{condition}) @var{then-body} @r{[}else @var{else-body}@r{]}
@noindent
The @var{condition} is an expression that controls what the rest of the
-statement will do. If @var{condition} is true, @var{then-body} is
+statement does. If the @var{condition} is true, @var{then-body} is
executed; otherwise, @var{else-body} is executed.
The @code{else} part of the statement is
optional. The condition is considered false if its value is zero or
-the null string, and true otherwise.
-
-Here is an example:
+the null string; otherwise the condition is true.
+Refer to the following:
@example
if (x % 2 == 0)
@@ -7751,14 +9246,14 @@ else
@end example
In this example, if the expression @samp{x % 2 == 0} is true (that is,
-the value of @code{x} is evenly divisible by two), then the first @code{print}
-statement is executed, otherwise the second @code{print} statement is
-executed.
-
-If the @code{else} appears on the same line as @var{then-body}, and
-@var{then-body} is not a compound statement (i.e.@: not surrounded by
+if the value of @code{x} is evenly divisible by two), then the first
+@code{print} statement is executed; otherwise the second @code{print}
+statement is executed.
+If the @code{else} keyword appears on the same line as @var{then-body} and
+@var{then-body} is not a compound statement (i.e., not surrounded by
curly braces), then a semicolon must separate @var{then-body} from
-@code{else}. To illustrate this, let's rewrite the previous example:
+the @code{else}.
+To illustrate this, the previous example can be rewritten as:
@example
if (x % 2 == 0) print "x is even"; else
@@ -7766,25 +9261,22 @@ if (x % 2 == 0) print "x is even"; else
@end example
@noindent
-If you forget the @samp{;}, @code{awk} won't be able to interpret the
-statement, and you will get a syntax error.
-
-We would not actually write this example this way, because a human
-reader might fail to see the @code{else} if it were not the first thing
-on its line.
+If the @samp{;} is left out, @command{awk} can't interpret the statement and
+it produces a syntax error. Don't actually write programs this way,
+because a human reader might fail to see the @code{else} if it is not
+the first thing on its line.
@node While Statement, Do Statement, If Statement, Statements
-@section The @code{while} Statement
+@subsection The @code{while} Statement
@cindex @code{while} statement
@cindex loop
@cindex body of a loop
-In programming, a @dfn{loop} means a part of a program that can
+In programming, a @dfn{loop} is a part of a program that can
be executed two or more times in succession.
-
The @code{while} statement is the simplest looping statement in
-@code{awk}. It repeatedly executes a statement as long as a condition is
-true. It looks like this:
+@command{awk}. It repeatedly executes a statement as long as a condition is
+true. For example:
@example
while (@var{condition})
@@ -7792,24 +9284,22 @@ while (@var{condition})
@end example
@noindent
-Here @var{body} is a statement that we call the @dfn{body} of the loop,
+@var{body} is a statement called the @dfn{body} of the loop,
and @var{condition} is an expression that controls how long the loop
keeps running.
-
-The first thing the @code{while} statement does is test @var{condition}.
-If @var{condition} is true, it executes the statement @var{body}.
+The first thing the @code{while} statement does is test the @var{condition}.
+If the @var{condition} is true, it executes the statement @var{body}.
@ifinfo
-(The @var{condition} is true when the value
+(The @var{condition} is true when the value
is not zero and not a null string.)
@end ifinfo
After @var{body} has been executed,
@var{condition} is tested again, and if it is still true, @var{body} is
-executed again. This process repeats until @var{condition} is no longer
-true. If @var{condition} is initially false, the body of the loop is
-never executed, and @code{awk} continues with the statement following
+executed again. This process repeats until the @var{condition} is no longer
+true. If the @var{condition} is initially false, the body of the loop is
+never executed and @command{awk} continues with the statement following
the loop.
-
-This example prints the first three fields of each record, one per line.
+This example prints the first three fields of each record, one per line:
@example
awk '@{ i = 1
@@ -7821,39 +9311,37 @@ awk '@{ i = 1
@end example
@noindent
-Here the body of the loop is a compound statement enclosed in braces,
+The body of this loop is a compound statement enclosed in braces,
containing two statements.
-
-The loop works like this: first, the value of @code{i} is set to one.
-Then, the @code{while} tests whether @code{i} is less than or equal to
+The loop works in the following manner: first, the value of @code{i} is set to one.
+Then, the @code{while} statement tests whether @code{i} is less than or equal to
three. This is true when @code{i} equals one, so the @code{i}-th
field is printed. Then the @samp{i++} increments the value of @code{i}
and the loop repeats. The loop terminates when @code{i} reaches four.
-As you can see, a newline is not required between the condition and the
-body; but using one makes the program clearer unless the body is a
-compound statement or is very simple. The newline after the open-brace
+A newline is not required between the condition and the
+body; however using one makes the program clearer unless the body is a
+compound statement or else is very simple. The newline after the open-brace
that begins the compound statement is not required either, but the
-program would be harder to read without it.
+program is harder to read without it.
@node Do Statement, For Statement, While Statement, Statements
-@section The @code{do}-@code{while} Statement
+@subsection The @code{do}-@code{while} Statement
+@cindex @code{do}-@code{while} statement
The @code{do} loop is a variation of the @code{while} looping statement.
-The @code{do} loop executes the @var{body} once, and then repeats @var{body}
-as long as @var{condition} is true. It looks like this:
+The @code{do} loop executes the @var{body} once and then repeats the
+@var{body} as long as the @var{condition} is true. It looks like this:
@example
-@group
do
@var{body}
while (@var{condition})
-@end group
@end example
-Even if @var{condition} is false at the start, @var{body} is executed at
-least once (and only once, unless executing @var{body} makes
-@var{condition} true). Contrast this with the corresponding
+Even if the @var{condition} is false at the start, the @var{body} is
+executed at least once (and only once, unless executing @var{body}
+makes @var{condition} true). Contrast this with the corresponding
@code{while} statement:
@example
@@ -7862,28 +9350,27 @@ while (@var{condition})
@end example
@noindent
-This statement does not execute @var{body} even once if @var{condition}
+This statement does not execute @var{body} even once if the @var{condition}
is false to begin with.
-
-Here is an example of a @code{do} statement:
+The following is an example of a @code{do} statement:
@example
-awk '@{ i = 1
+@{ i = 1
do @{
print $0
i++
@} while (i <= 10)
-@}'
+@}
@end example
@noindent
-This program prints each input record ten times. It isn't a very
+This program prints each input record ten times. However, it isn't a very
realistic example, since in this case an ordinary @code{while} would do
-just as well. But this reflects actual experience; there is only
-occasionally a real use for a @code{do} statement.
+just as well. This situation reflects actual experience; only
+occasionally is there a real use for a @code{do} statement.
@node For Statement, Break Statement, Do Statement, Statements
-@section The @code{for} Statement
+@subsection The @code{for} Statement
@cindex @code{for} statement
The @code{for} statement makes it more convenient to count iterations of a
@@ -7895,58 +9382,56 @@ for (@var{initialization}; @var{condition}; @var{increment})
@end example
@noindent
-The @var{initialization}, @var{condition} and @var{increment} parts are
-arbitrary @code{awk} expressions, and @var{body} stands for any
-@code{awk} statement.
+The @var{initialization}, @var{condition}, and @var{increment} parts are
+arbitrary @command{awk} expressions, and @var{body} stands for any
+@command{awk} statement.
The @code{for} statement starts by executing @var{initialization}.
Then, as long
-as @var{condition} is true, it repeatedly executes @var{body} and then
-@var{increment}. Typically @var{initialization} sets a variable to
+as the @var{condition} is true, it repeatedly executes @var{body} and then
+@var{increment}. Typically, @var{initialization} sets a variable to
either zero or one, @var{increment} adds one to it, and @var{condition}
compares it against the desired number of iterations.
-
-Here is an example of a @code{for} statement:
+For example:
@example
-@group
awk '@{ for (i = 1; i <= 3; i++)
print $i
@}' inventory-shipped
-@end group
@end example
@noindent
-This prints the first three fields of each input record, one field per
+This prints the first three fields of each input record, with one field per
line.
-You cannot set more than one variable in the
-@var{initialization} part unless you use a multiple assignment statement
-such as @samp{x = y = 0}, which is possible only if all the initial values
-are equal. (But you can initialize additional variables by writing
+It isn't possible to
+set more than one variable in the
+@var{initialization} part without using a multiple assignment statement
+such as @samp{x = y = 0}. This makes sense only if all the initial values
+are equal. (But it is possible to initialize additional variables by writing
their assignments as separate statements preceding the @code{for} loop.)
-The same is true of the @var{increment} part; to increment additional
-variables, you must write separate statements at the end of the loop.
-The C compound expression, using C's comma operator, would be useful in
-this context, but it is not supported in @code{awk}.
+@cindex comma operator, not supported
+The same is true of the @var{increment} part. Incrementing additional
+variables requires separate statements at the end of the loop.
+The C compound expression, using C's comma operator, is useful in
+this context but it is not supported in @command{awk}.
-Most often, @var{increment} is an increment expression, as in the
-example above. But this is not required; it can be any expression
-whatever. For example, this statement prints all the powers of two
-between one and 100:
+Most often, @var{increment} is an increment expression, as in the previous
+example. But this is not required; it can be any expression
+whatsoever. For example, the following statement prints all the powers of two
+between 1 and 100:
@example
for (i = 1; i <= 100; i *= 2)
print i
@end example
-Any of the three expressions in the parentheses following the @code{for} may
-be omitted if there is nothing to be done there. Thus, @w{@samp{for (; x
-> 0;)}} is equivalent to @w{@samp{while (x > 0)}}. If the
-@var{condition} is omitted, it is treated as @var{true}, effectively
-yielding an @dfn{infinite loop} (i.e.@: a loop that will never
-terminate).
+If there is nothing to be done, any of the three expressions in the
+parentheses following the @code{for} keyword may be omitted. Thus,
+@w{@samp{for (; x > 0;)}} is equivalent to @w{@samp{while (x > 0)}}. If the
+@var{condition} is omitted, it is treated as true, effectively
+yielding an @dfn{infinite loop} (i.e., a loop that never terminates).
In most cases, a @code{for} loop is an abbreviation for a @code{while}
loop, as shown here:
@@ -7962,10 +9447,18 @@ while (@var{condition}) @{
@noindent
The only exception is when the @code{continue} statement
(@pxref{Continue Statement, ,The @code{continue} Statement}) is used
-inside the loop; changing a @code{for} statement to a @code{while}
+inside the loop. Changing a @code{for} statement to a @code{while}
statement in this way can change the effect of the @code{continue}
statement inside the loop.
+The @command{awk} language has a @code{for} statement in addition to a
+@code{while} statement because a @code{for} loop is often both less work to
+type and more natural to think of. Counting the number of iterations is
+very common in loops. It can be easier to think of this counting as part
+of looping rather than as something to do inside the loop.
+
+@ifinfo
+@cindex @code{in} operator
There is an alternate version of the @code{for} loop, for iterating over
all the indices of an array:
@@ -7977,157 +9470,114 @@ for (i in array)
@noindent
@xref{Scanning an Array, ,Scanning All Elements of an Array},
for more information on this version of the @code{for} loop.
-
-The @code{awk} language has a @code{for} statement in addition to a
-@code{while} statement because often a @code{for} loop is both less work to
-type and more natural to think of. Counting the number of iterations is
-very common in loops. It can be easier to think of this counting as part
-of looping rather than as something to do inside the loop.
-
-The next section has more complicated examples of @code{for} loops.
+@end ifinfo
@node Break Statement, Continue Statement, For Statement, Statements
-@section The @code{break} Statement
+@subsection The @code{break} Statement
@cindex @code{break} statement
@cindex loops, exiting
The @code{break} statement jumps out of the innermost @code{for},
-@code{while}, or @code{do} loop that encloses it. The
-following example finds the smallest divisor of any integer, and also
-identifies prime numbers:
+@code{while}, or @code{do} loop that encloses it. The following example
+finds the smallest divisor of any integer, and also identifies prime
+numbers:
@example
-awk '# find smallest divisor of num
- @{ num = $1
-@group
- for (div = 2; div*div <= num; div++)
- if (num % div == 0)
- break
-@end group
- if (num % div == 0)
- printf "Smallest divisor of %d is %d\n", num, div
- else
- printf "%d is prime\n", num
- @}'
+# find smallest divisor of num
+@{
+ num = $1
+ for (div = 2; div*div <= num; div++)
+ if (num % div == 0)
+ break
+ if (num % div == 0)
+ printf "Smallest divisor of %d is %d\n", num, div
+ else
+ printf "%d is prime\n", num
+@}
@end example
-When the remainder is zero in the first @code{if} statement, @code{awk}
+When the remainder is zero in the first @code{if} statement, @command{awk}
immediately @dfn{breaks out} of the containing @code{for} loop. This means
-that @code{awk} proceeds immediately to the statement following the loop
+that @command{awk} proceeds immediately to the statement following the loop
and continues processing. (This is very different from the @code{exit}
-statement which stops the entire @code{awk} program.
+statement, which stops the entire @command{awk} program.
@xref{Exit Statement, ,The @code{exit} Statement}.)
-Here is another program equivalent to the previous one. It illustrates how
-the @var{condition} of a @code{for} or @code{while} could just as well be
-replaced with a @code{break} inside an @code{if}:
+Th following program illustrates how the @var{condition} of a @code{for}
+or @code{while} statement could be replaced with a @code{break} inside
+an @code{if}:
@example
-@group
-awk '# find smallest divisor of num
- @{ num = $1
- for (div = 2; ; div++) @{
- if (num % div == 0) @{
- printf "Smallest divisor of %d is %d\n", num, div
- break
- @}
- if (div*div > num) @{
- printf "%d is prime\n", num
- break
- @}
- @}
-@}'
-@end group
+# find smallest divisor of num
+@{
+ num = $1
+ for (div = 2; ; div++) @{
+ if (num % div == 0) @{
+ printf "Smallest divisor of %d is %d\n", num, div
+ break
+ @}
+ if (div*div > num) @{
+ printf "%d is prime\n", num
+ break
+ @}
+ @}
+@}
@end example
@cindex @code{break}, outside of loops
@cindex historical features
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@cindex dark corner
-As described above, the @code{break} statement has no meaning when
+The @code{break} statement has no meaning when
used outside the body of a loop. However, although it was never documented,
-historical implementations of @code{awk} have treated the @code{break}
+historical implementations of @command{awk} treated the @code{break}
statement outside of a loop as if it were a @code{next} statement
(@pxref{Next Statement, ,The @code{next} Statement}).
-Recent versions of Unix @code{awk} no longer allow this usage.
-@code{gawk} will support this use of @code{break} only if @samp{--traditional}
+Recent versions of Unix @command{awk} no longer allow this usage.
+@command{gawk} supports this use of @code{break} only
+if @option{--traditional}
has been specified on the command line
-(@pxref{Options, ,Command Line Options}).
-Otherwise, it will be treated as an error, since the POSIX standard
+(@pxref{Options, ,Command-Line Options}).
+Otherwise, it is treated as an error, since the POSIX standard
specifies that @code{break} should only be used inside the body of a
-loop (d.c.).
+loop.
+@value{DARKCORNER}
@node Continue Statement, Next Statement, Break Statement, Statements
-@section The @code{continue} Statement
+@subsection The @code{continue} Statement
@cindex @code{continue} statement
-The @code{continue} statement, like @code{break}, is used only inside
+As with @code{break}, the @code{continue} statement is used only inside
@code{for}, @code{while}, and @code{do} loops. It skips
over the rest of the loop body, causing the next cycle around the loop
to begin immediately. Contrast this with @code{break}, which jumps out
of the loop altogether.
-@c The point of this program was to illustrate the use of continue with
-@c a while loop. But Karl Berry points out that that is done adequately
-@c below, and that this example is very un-awk-like. So for now, we'll
-@c omit it.
-@ignore
-In Texinfo source files, text that the author wishes to ignore can be
-enclosed between lines that start with @samp{@@ignore} and end with
-@samp{@atend ignore}. Here is a program that strips out lines between
-@samp{@@ignore} and @samp{@atend ignore} pairs.
-
-@example
-BEGIN @{
- while (getline > 0) @{
- if (/^@@ignore/)
- ignoring = 1
- else if (/^@@end[ \t]+ignore/) @{
- ignoring = 0
- continue
- @}
- if (ignoring)
- continue
- print
- @}
-@}
-@end example
-
-When an @samp{@@ignore} is seen, the @code{ignoring} flag is set to one (true).
-When @samp{@atend ignore} is seen, the flag is reset to zero (false). As long
-as the flag is true, the input record is not printed, because the
-@code{continue} restarts the @code{while} loop, skipping over the @code{print}
-statement.
-
-@c Exercise!!!
-@c How could this program be written to make better use of the awk language?
-@end ignore
-
-The @code{continue} statement in a @code{for} loop directs @code{awk} to
-skip the rest of the body of the loop, and resume execution with the
+The @code{continue} statement in a @code{for} loop directs @command{awk} to
+skip the rest of the body of the loop and resume execution with the
increment-expression of the @code{for} statement. The following program
illustrates this fact:
@example
-awk 'BEGIN @{
+BEGIN @{
for (x = 0; x <= 20; x++) @{
if (x == 5)
continue
printf "%d ", x
@}
print ""
-@}'
+@}
@end example
@noindent
-This program prints all the numbers from zero to 20, except for five, for
-which the @code{printf} is skipped. Since the increment @samp{x++}
+This program prints all the numbers from 0 to 20---except for five, for
+which the @code{printf} is skipped. Because the increment @samp{x++}
is not skipped, @code{x} does not remain stuck at five. Contrast the
-@code{for} loop above with this @code{while} loop:
+@code{for} loop from the previous example with the following @code{while} loop:
@example
-awk 'BEGIN @{
+BEGIN @{
x = 0
while (x <= 20) @{
if (x == 5)
@@ -8136,186 +9586,203 @@ awk 'BEGIN @{
x++
@}
print ""
-@}'
+@}
@end example
@noindent
-This program loops forever once @code{x} gets to five.
+This program loops forever once @code{x} reaches five.
@cindex @code{continue}, outside of loops
@cindex historical features
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@cindex dark corner
-As described above, the @code{continue} statement has no meaning when
-used outside the body of a loop. However, although it was never documented,
-historical implementations of @code{awk} have treated the @code{continue}
-statement outside of a loop as if it were a @code{next} statement
+The @code{continue} statement has no meaning when used outside the body of
+a loop. Historical versions of @command{awk} treated a @code{continue}
+statement outside a loop the same way they treated a @code{break}
+statement outside a loop: as if it were a @code{next}
+statement
(@pxref{Next Statement, ,The @code{next} Statement}).
-Recent versions of Unix @code{awk} no longer allow this usage.
-@code{gawk} will support this use of @code{continue} only if
-@samp{--traditional} has been specified on the command line
-(@pxref{Options, ,Command Line Options}).
-Otherwise, it will be treated as an error, since the POSIX standard
-specifies that @code{continue} should only be used inside the body of a
-loop (d.c.).
+Recent versions of Unix @command{awk} no longer work this way, and
+@command{gawk} allows it only if @option{--traditional} is specified on
+the command line (@pxref{Options, ,Command-Line Options}). Just like the
+@code{break} statement, the POSIX standard specifies that @code{continue}
+should only be used inside the body of a loop.
+@value{DARKCORNER}
@node Next Statement, Nextfile Statement, Continue Statement, Statements
-@section The @code{next} Statement
+@subsection The @code{next} Statement
@cindex @code{next} statement
-The @code{next} statement forces @code{awk} to immediately stop processing
+The @code{next} statement forces @command{awk} to immediately stop processing
the current record and go on to the next record. This means that no
-further rules are executed for the current record. The rest of the
-current rule's action is not executed either.
+further rules are executed for the current record, and the rest of the
+current rule's action isn't executed.
Contrast this with the effect of the @code{getline} function
-(@pxref{Getline, ,Explicit Input with @code{getline}}). That too causes
-@code{awk} to read the next record immediately, but it does not alter the
-flow of control in any way. So the rest of the current action executes
-with a new input record.
+(@pxref{Getline, ,Explicit Input with @code{getline}}). That also causes
+@command{awk} to read the next record immediately, but it does not alter the
+flow of control in any way (i.e., the rest of the current action executes
+with a new input record).
-At the highest level, @code{awk} program execution is a loop that reads
+At the highest level, @command{awk} program execution is a loop that reads
an input record and then tests each rule's pattern against it. If you
think of this loop as a @code{for} statement whose body contains the
rules, then the @code{next} statement is analogous to a @code{continue}
-statement: it skips to the end of the body of this implicit loop, and
+statement. It skips to the end of the body of this implicit loop and
executes the increment (which reads another record).
-For example, if your @code{awk} program works only on records with four
-fields, and you don't want it to fail when given bad input, you might
-use this rule near the beginning of the program:
+For example, suppose an @command{awk} program works only on records
+with four fields, and it shouldn't fail when given bad input. To avoid
+complicating the rest of the program, write a ``weed out'' rule near
+the beginning, in the following manner:
@example
-@group
NF != 4 @{
err = sprintf("%s:%d: skipped: NF != 4\n", FILENAME, FNR)
print err > "/dev/stderr"
next
@}
-@end group
@end example
@noindent
-so that the following rules will not see the bad record. The error
+Because of the @code{next} statement,
+the program's subsequent rules won't see the bad record. The error
message is redirected to the standard error output stream, as error
-messages should be. @xref{Special Files, ,Special File Names in @code{gawk}}.
+messages should be.
+@xref{Special Files, ,Special @value{FFN}s in @command{gawk}}.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@cindex @code{next}, inside a user-defined function
According to the POSIX standard, the behavior is undefined if
the @code{next} statement is used in a @code{BEGIN} or @code{END} rule.
-@code{gawk} will treat it as a syntax error.
+@command{gawk} treats it as a syntax error.
Although POSIX permits it,
-some other @code{awk} implementations don't allow the @code{next}
+some other @command{awk} implementations don't allow the @code{next}
statement inside function bodies
-(@pxref{User-defined, ,User-defined Functions}).
-Just as any other @code{next} statement, a @code{next} inside a
+(@pxref{User-defined, ,User-Defined Functions}).
+Just as with any other @code{next} statement, a @code{next} statement inside a
function body reads the next record and starts processing it with the
first rule in the program.
-
If the @code{next} statement causes the end of the input to be reached,
-then the code in any @code{END} rules will be executed.
+then the code in any @code{END} rules is executed.
@xref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}.
-@cindex @code{next}, inside a user-defined function
-@strong{Caution:} Some @code{awk} implementations generate a run-time
-error if you use the @code{next} statement inside a user-defined function
-(@pxref{User-defined, , User-defined Functions}).
-@code{gawk} does not have this problem.
-
@node Nextfile Statement, Exit Statement, Next Statement, Statements
-@section The @code{nextfile} Statement
+@subsection Using @command{gawk}'s @code{nextfile} Statement
@cindex @code{nextfile} statement
-@cindex differences between @code{gawk} and @code{awk}
+@cindex differences between @command{gawk} and @command{awk}
-@code{gawk} provides the @code{nextfile} statement,
+@command{gawk} provides the @code{nextfile} statement,
which is similar to the @code{next} statement.
However, instead of abandoning processing of the current record, the
-@code{nextfile} statement instructs @code{gawk} to stop processing the
-current data file.
+@code{nextfile} statement instructs @command{gawk} to stop processing the
+current @value{DF}.
+
+The @code{nextfile} statement is a @command{gawk} extension.
+In most other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+@code{nextfile} is not special.
Upon execution of the @code{nextfile} statement, @code{FILENAME} is
-updated to the name of the next data file listed on the command line,
+updated to the name of the next @value{DF} listed on the command line,
@code{FNR} is reset to one, @code{ARGIND} is incremented, and processing
-starts over with the first rule in the progam. @xref{Built-in Variables}.
-
+starts over with the first rule in the program.
+(@code{ARGIND} hasn't been introduced yet. @xref{Built-in Variables}.)
If the @code{nextfile} statement causes the end of the input to be reached,
-then the code in any @code{END} rules will be executed.
+then the code in any @code{END} rules is executed.
@xref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}.
-The @code{nextfile} statement is a @code{gawk} extension; it is not
-(currently) available in any other @code{awk} implementation.
-@xref{Nextfile Function, ,Implementing @code{nextfile} as a Function},
-for a user-defined function you can use to simulate the @code{nextfile}
+The @code{nextfile} statement is useful when there are many @value{DF}s
+to process but it isn't necessary to process every record in every file.
+Normally, in order to move on to the next @value{DF}, a program
+has to continue scanning the unwanted records. The @code{nextfile}
+statement accomplishes this much more efficiently.
+
+While one might think that @samp{close(FILENAME)} would accomplish
+the same as @code{nextfile}, this isn't true. @code{close} is
+reserved for closing files, pipes, and coprocesses that are
+opened with redirections. It is not related to the main processing that
+@command{awk} does with the files listed in @code{ARGV}.
+
+If it's necessary to use an @command{awk} version that doesn't support
+@code{nextfile}, see
+@ref{Nextfile Function, ,Implementing @code{nextfile} as a Function},
+for a user-defined function that simulates the @code{nextfile}
statement.
-The @code{nextfile} statement would be useful if you have many data
-files to process, and you expect that you
-would not want to process every record in every file.
-Normally, in order to move on to
-the next data file, you would have to continue scanning the unwanted
-records. The @code{nextfile} statement accomplishes this much more
-efficiently.
+@cindex @code{nextfile}, inside a user-defined function
+The current version of the Bell Laboratories @command{awk}
+(@pxref{Other Versions, ,Other Freely Available @command{awk} Implementations})
+also supports @code{nextfile}. However, it doesn't allow the @code{nextfile}
+statement inside function bodies
+(@pxref{User-defined, ,User-Defined Functions}).
+@command{gawk} does; a @code{nextfile} inside a
+function body reads the next record and starts processing it with the
+first rule in the program, just as any other @code{nextfile} statement.
@cindex @code{next file} statement
-@strong{Caution:} Versions of @code{gawk} prior to 3.0 used two
-words (@samp{next file}) for the @code{nextfile} statement. This was
-changed in 3.0 to one word, since the treatment of @samp{file} was
-inconsistent. When it appeared after @code{next}, it was a keyword.
-Otherwise, it was a regular identifier. The old usage is still
-accepted. However, @code{gawk} will generate a warning message, and
-support for @code{next file} will eventually be discontinued in a
-future version of @code{gawk}.
-
-@node Exit Statement, , Nextfile Statement, Statements
-@section The @code{exit} Statement
+@strong{Caution:} Versions of @command{gawk} prior to 3.0 used two
+words (@samp{next file}) for the @code{nextfile} statement.
+In @value{PVERSION} 3.0, this was changed
+to one word, because the treatment of @samp{file} was
+inconsistent. When it appeared after @code{next}, @samp{file} was a keyword;
+otherwise, it was a regular identifier. The old usage is no longer
+accepted; @samp{next file} generates a syntax error.
+
+@node Exit Statement, , Nextfile Statement, Statements
+@subsection The @code{exit} Statement
@cindex @code{exit} statement
-The @code{exit} statement causes @code{awk} to immediately stop
+The @code{exit} statement causes @command{awk} to immediately stop
executing the current rule and to stop processing input; any remaining input
-is ignored. It looks like this:
+is ignored. The @code{exit} statement is written as follows:
@example
exit @r{[}@var{return code}@r{]}
@end example
-If an @code{exit} statement is executed from a @code{BEGIN} rule the
+When an @code{exit} statement is executed from a @code{BEGIN} rule, the
program stops processing everything immediately. No input records are
-read. However, if an @code{END} rule is present, it is executed
+read. However, if an @code{END} rule is present,
+as part of executing the @code{exit} statement,
+the @code{END} rule is executed
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
-
If @code{exit} is used as part of an @code{END} rule, it causes
the program to stop immediately.
-An @code{exit} statement that is not part
-of a @code{BEGIN} or @code{END} rule stops the execution of any further
-automatic rules for the current record, skips reading any remaining input
-records, and executes
-the @code{END} rule if there is one.
+An @code{exit} statement that is not part of a @code{BEGIN} or @code{END}
+rule stops the execution of any further automatic rules for the current
+record, skips reading any remaining input records, and executes the
+@code{END} rule if there is one.
-If you do not want the @code{END} rule to do its job in this case, you
-can set a variable to non-zero before the @code{exit} statement, and check
-that variable in the @code{END} rule.
+In such a case,
+if you don't want the @code{END} rule to do its job, set a variable
+to nonzero before the @code{exit} statement and check that variable in
+the @code{END} rule.
@xref{Assert Function, ,Assertions},
for an example that does this.
@cindex dark corner
If an argument is supplied to @code{exit}, its value is used as the exit
-status code for the @code{awk} process. If no argument is supplied,
+status code for the @command{awk} process. If no argument is supplied,
@code{exit} returns status zero (success). In the case where an argument
is supplied to a first @code{exit} statement, and then @code{exit} is
-called a second time with no argument, the previously supplied exit value
-is used (d.c.).
+called a second time from an @code{END} rule with no argument,
+@command{awk} uses the previously supplied exit value.
+@value{DARKCORNER}
-For example, let's say you've discovered an error condition you really
-don't know how to handle. Conventionally, programs report this by
-exiting with a non-zero status. Your @code{awk} program can do this
-using an @code{exit} statement with a non-zero argument. Here is an
-example:
+@cindex conventions, programming
+@cindex programming conventions
+For example, suppose an error condition occurs that is difficult or
+impossible to handle. Conventionally, programs report this by
+exiting with a nonzero status. An @command{awk} program can do this
+using an @code{exit} statement with a nonzero argument, as shown
+in the following example:
@example
-@group
BEGIN @{
if (("date" | getline date_now) <= 0) @{
print "Can't get system date" > "/dev/stderr"
@@ -8324,317 +9791,452 @@ BEGIN @{
print "current date is", date_now
close("date")
@}
-@end group
@end example
-@node Built-in Variables, Arrays, Statements, Top
-@chapter Built-in Variables
+@node Built-in Variables, , Statements, Patterns and Actions
+@section Built-in Variables
@cindex built-in variables
-Most @code{awk} variables are available for you to use for your own
-purposes; they never change except when your program assigns values to
-them, and never affect anything except when your program examines them.
-However, a few variables in @code{awk} have special built-in meanings.
-Some of them @code{awk} examines automatically, so that they enable you
-to tell @code{awk} how to do certain things. Others are set
-automatically by @code{awk}, so that they carry information from the
-internal workings of @code{awk} to your program.
+Most @command{awk} variables are available for you to use for your own
+purposes; they never change unless your program assigns values to
+them, and they never affect anything unless your program examines them.
+However, a few variables in @command{awk} have special built-in meanings.
+@command{awk} examines some of these automatically, so that they enable you
+to tell @command{awk} how to do certain things. Others are set
+automatically by @command{awk}, so that they carry information from the
+internal workings of @command{awk} to your program.
-This chapter documents all the built-in variables of @code{gawk}. Most
-of them are also documented in the chapters describing their areas of
-activity.
+This @value{SECTION} documents all the built-in variables of
+@command{gawk}, most of which are also documented in the chapters
+describing their areas of activity.
@menu
* User-modified:: Built-in variables that you change to control
- @code{awk}.
-* Auto-set:: Built-in variables where @code{awk} gives you
- information.
+ @command{awk}.
+* Auto-set:: Built-in variables where @command{awk} gives
+ you information.
* ARGC and ARGV:: Ways to use @code{ARGC} and @code{ARGV}.
@end menu
@node User-modified, Auto-set, Built-in Variables, Built-in Variables
-@section Built-in Variables that Control @code{awk}
+@subsection Built-in Variables That Control @command{awk}
@cindex built-in variables, user modifiable
-This is an alphabetical list of the variables which you can change to
-control how @code{awk} does certain things. Those variables that are
-specific to @code{gawk} are marked with an asterisk, @samp{*}.
+The following is an alphabetical list of variables that you can change to
+control how @command{awk} does certain things. The variables that are
+specific to @command{gawk} are marked with a pound sign (@samp{#}).
@table @code
-@vindex CONVFMT
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @code{BINMODE} variable
+@cindex binary I/O
+@cindex I/O, binary
+@cindex differences between @command{gawk} and @command{awk}
+@item BINMODE #
+On non-POSIX systems, this variable specifies use of ``binary'' mode for all I/O.
+Numeric values of one, two, or three, specify that input files, output files, or
+all files, respectively, should use binary I/O.
+Alternatively,
+string values of @code{"r"} or @code{"w"} specify that input files and
+output files, respectively, should use binary I/O.
+A string value of @code{"rw"} or @code{"wr"} indicates that all
+files should use binary I/O.
+Any other string value is equivalent to @code{"rw"}, but @command{gawk}
+generates a warning message.
+@code{BINMODE} is described in more detail in
+@ref{PC Using, ,Using @command{gawk} on PC Operating Systems}.
+
+This variable is a @command{gawk} extension.
+In other @command{awk} implementations
+(except @command{mawk},
+@pxref{Other Versions, , Other Freely Available @command{awk} Implementations}),
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+it is not special.
+
+@cindex @code{CONVFMT} variable
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
@item CONVFMT
This string controls conversion of numbers to
strings (@pxref{Conversion, ,Conversion of Strings and Numbers}).
It works by being passed, in effect, as the first argument to the
@code{sprintf} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
Its default value is @code{"%.6g"}.
@code{CONVFMT} was introduced by the POSIX standard.
-@vindex FIELDWIDTHS
-@item FIELDWIDTHS *
-This is a space separated list of columns that tells @code{gawk}
-how to split input with fixed, columnar boundaries. It is an
-experimental feature. Assigning to @code{FIELDWIDTHS}
+@cindex @code{FIELDWIDTHS} variable
+@item FIELDWIDTHS #
+This is a space-separated list of columns that tells @command{gawk}
+how to split input with fixed columnar boundaries.
+Assigning a value to @code{FIELDWIDTHS}
overrides the use of @code{FS} for field splitting.
-@xref{Constant Size, ,Reading Fixed-width Data}, for more information.
+@xref{Constant Size, ,Reading Fixed-Width Data}, for more information.
-If @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}), then @code{FIELDWIDTHS}
-has no special meaning, and field splitting operations are done based
+If @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}), then @code{FIELDWIDTHS}
+has no special meaning, and field-splitting operations occur based
exclusively on the value of @code{FS}.
-@vindex FS
+@cindex @code{FS} variable
@item FS
-@code{FS} is the input field separator
-(@pxref{Field Separators, ,Specifying How Fields are Separated}).
+This is the input field separator
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}).
The value is a single-character string or a multi-character regular
expression that matches the separations between fields in an input
record. If the value is the null string (@code{""}), then each
character in the record becomes a separate field.
+(This behavior is a @command{gawk} extension. POSIX @command{awk} does not
+specify the behavior when @code{FS} is the null string.)
+@c NEXT ED: Mark as common extension
The default value is @w{@code{" "}}, a string consisting of a single
space. As a special exception, this value means that any
sequence of spaces, tabs, and/or newlines is a single separator.@footnote{In
-POSIX @code{awk}, newline does not count as whitespace.} It also causes
+POSIX @command{awk}, newline does not count as whitespace.} It also causes
spaces, tabs, and newlines at the beginning and end of a record to be ignored.
You can set the value of @code{FS} on the command line using the
-@samp{-F} option:
+@option{-F} option:
@example
awk -F, '@var{program}' @var{input-files}
@end example
-If @code{gawk} is using @code{FIELDWIDTHS} for field-splitting,
-assigning a value to @code{FS} will cause @code{gawk} to return to
-the normal, @code{FS}-based, field splitting. An easy way to do this
+If @command{gawk} is using @code{FIELDWIDTHS} for field splitting,
+assigning a value to @code{FS} causes @command{gawk} to return to
+the normal, @code{FS}-based field splitting. An easy way to do this
is to simply say @samp{FS = FS}, perhaps with an explanatory comment.
-@vindex IGNORECASE
-@item IGNORECASE *
-If @code{IGNORECASE} is non-zero or non-null, then all string comparisons,
+@cindex @code{IGNORECASE} variable
+@item IGNORECASE #
+If @code{IGNORECASE} is nonzero or non-null, then all string comparisons
and all regular expression matching are case-independent. Thus, regexp
-matching with @samp{~} and @samp{!~}, and the @code{gensub},
-@code{gsub}, @code{index}, @code{match}, @code{split} and @code{sub}
+matching with @samp{~} and @samp{!~}, as well as the @code{gensub},
+@code{gsub}, @code{index}, @code{match}, @code{split}, and @code{sub}
functions, record termination with @code{RS}, and field splitting with
-@code{FS} all ignore case when doing their particular regexp operations.
-The value of @code{IGNORECASE} does @emph{not} affect array subscripting.
-@xref{Case-sensitivity, ,Case-sensitivity in Matching}.
+@code{FS}, all ignore case when doing their particular regexp operations.
+However, the value of @code{IGNORECASE} does @emph{not} affect array subscripting.
+@xref{Case-sensitivity, ,Case Sensitivity in Matching}.
-If @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}),
-then @code{IGNORECASE} has no special meaning, and string
+If @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+then @code{IGNORECASE} has no special meaning. Thus, string
and regexp operations are always case-sensitive.
-@vindex OFMT
+@cindex @code{LINT} variable
+@cindex differences between @command{gawk} and @command{awk}
+@cindex lint checks
+@item LINT #
+When this variable is true (nonzero or non-null), @command{gawk}
+behaves as if the @option{--lint} command-line option is in effect.
+(@pxref{Options, ,Command-Line Options}).
+With a value of @code{"fatal"}, lint warnings become fatal errors.
+Any other true value prints non-fatal warnings.
+Assigning a false value to @code{LINT} turns off the lint warnings.
+
+This variable is a @command{gawk} extension. It is not special
+in other @command{awk} implementations. Unlike the other special variables,
+changing @code{LINT} does affect the production of lint warnings,
+even if @command{gawk} is in compatibility mode. Much as
+the @option{--lint} and @option{--traditional} options independently
+control different aspects of @command{gawk}'s behavior, the control
+of lint warnings during program execution is independent of the flavor
+of @command{awk} being executed.
+
+@cindex @code{OFMT} variable
@item OFMT
This string controls conversion of numbers to
strings (@pxref{Conversion, ,Conversion of Strings and Numbers}) for
-printing with the @code{print} statement. It works by being passed, in
-effect, as the first argument to the @code{sprintf} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
-Its default value is @code{"%.6g"}. Earlier versions of @code{awk}
+printing with the @code{print} statement. It works by being passed
+as the first argument to the @code{sprintf} function
+(@pxref{String Functions, ,String Manipulation Functions}).
+Its default value is @code{"%.6g"}. Earlier versions of @command{awk}
also used @code{OFMT} to specify the format for converting numbers to
strings in general expressions; this is now done by @code{CONVFMT}.
-@vindex OFS
+@cindex @code{OFS} variable
@item OFS
This is the output field separator (@pxref{Output Separators}). It is
-output between the fields output by a @code{print} statement. Its
+output between the fields printed by a @code{print} statement. Its
default value is @w{@code{" "}}, a string consisting of a single space.
-@vindex ORS
+@cindex @code{ORS} variable
@item ORS
This is the output record separator. It is output at the end of every
-@code{print} statement. Its default value is @code{"\n"}.
-(@xref{Output Separators}.)
+@code{print} statement. Its default value is @code{"\n"}, the newline
+character. (@xref{Output Separators}.)
-@vindex RS
+@cindex @code{RS} variable
@item RS
-This is @code{awk}'s input record separator. Its default value is a string
+This is @command{awk}'s input record separator. Its default value is a string
containing a single newline character, which means that an input record
consists of a single line of text.
It can also be the null string, in which case records are separated by
-runs of blank lines, or a regexp, in which case records are separated by
+runs of blank lines.
+If it is a regexp, records are separated by
matches of the regexp in the input text.
-(@xref{Records, ,How Input is Split into Records}.)
+(@xref{Records, ,How Input Is Split into Records}.)
+
+The ability for @code{RS} to be a regular expression
+is a @command{gawk} extension.
+In most other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+just the first character of @code{RS}'s value is used.
-@vindex SUBSEP
+@cindex @code{SUBSEP} variable
@item SUBSEP
-@code{SUBSEP} is the subscript separator. It has the default value of
-@code{"\034"}, and is used to separate the parts of the indices of a
-multi-dimensional array. Thus, the expression @code{@w{foo["A", "B"]}}
+This is the subscript separator. It has the default value of
+@code{"\034"} and is used to separate the parts of the indices of a
+multidimensional array. Thus, the expression @code{@w{foo["A", "B"]}}
really accesses @code{foo["A\034B"]}
-(@pxref{Multi-dimensional, ,Multi-dimensional Arrays}).
+(@pxref{Multi-dimensional, ,Multidimensional Arrays}).
+
+@cindex @code{TEXTDOMAIN} variable
+@cindex internationalization
+@item TEXTDOMAIN #
+This variable is used for internationalization of programs at the
+@command{awk} level. It sets the default text domain for specially
+marked string constants in the source text, as well as for the
+@code{dcgettext} and @code{bindtextdomain} functions
+(@pxref{Internationalization, ,Internationalization with @command{gawk}}).
+The default value of @code{TEXTDOMAIN} is @code{"messages"}.
+
+This variable is a @command{gawk} extension.
+In other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+it is not special.
@end table
@node Auto-set, ARGC and ARGV, User-modified, Built-in Variables
-@section Built-in Variables that Convey Information
+@subsection Built-in Variables That Convey Information
@cindex built-in variables, convey information
-This is an alphabetical list of the variables that are set
-automatically by @code{awk} on certain occasions in order to provide
-information to your program. Those variables that are specific to
-@code{gawk} are marked with an asterisk, @samp{*}.
+The following is an alphabetical list of variables that @command{awk}
+sets automatically on certain occasions in order to provide
+information to your program. The variables that are specific to
+@command{gawk} are marked with an asterisk (@samp{*}).
@table @code
-@vindex ARGC
-@vindex ARGV
-@item ARGC
-@itemx ARGV
-The command-line arguments available to @code{awk} programs are stored in
+@cindex @code{ARGC} variable
+@cindex @code{ARGV} variable
+@item ARGC@r{,} ARGV
+The command-line arguments available to @command{awk} programs are stored in
an array called @code{ARGV}. @code{ARGC} is the number of command-line
-arguments present. @xref{Other Arguments, ,Other Command Line Arguments}.
-Unlike most @code{awk} arrays,
-@code{ARGV} is indexed from zero to @code{ARGC} @minus{} 1. For example:
+arguments present. @xref{Other Arguments, ,Other Command-Line Arguments}.
+Unlike most @command{awk} arrays,
+@code{ARGV} is indexed from 0 to @code{ARGC} @minus{} 1.
+In the following example:
@example
-@group
$ awk 'BEGIN @{
-> for (i = 0; i < ARGC; i++)
-> print ARGV[i]
+> for (i = 0; i < ARGC; i++)
+> print ARGV[i]
> @}' inventory-shipped BBS-list
@print{} awk
@print{} inventory-shipped
@print{} BBS-list
-@end group
@end example
@noindent
-In this example, @code{ARGV[0]} contains @code{"awk"}, @code{ARGV[1]}
-contains @code{"inventory-shipped"}, and @code{ARGV[2]} contains
+@code{ARGV[0]} contains @code{"awk"}, @code{ARGV[1]}
+contains @code{"inventory-shipped"} and @code{ARGV[2]} contains
@code{"BBS-list"}. The value of @code{ARGC} is three, one more than the
-index of the last element in @code{ARGV}, since the elements are numbered
+index of the last element in @code{ARGV}, because the elements are numbered
from zero.
+@cindex conventions, programming
+@cindex programming conventions
The names @code{ARGC} and @code{ARGV}, as well as the convention of indexing
-the array from zero to @code{ARGC} @minus{} 1, are derived from the C language's
-method of accessing command line arguments.
+the array from 0 to @code{ARGC} @minus{} 1, are derived from the C language's
+method of accessing command-line arguments.
+
+The value of @code{ARGV[0]} can vary from system to system.
+Also, you should note that the program text is @emph{not} included in
+@code{ARGV}, nor are any of @command{awk}'s command-line options.
@xref{ARGC and ARGV, , Using @code{ARGC} and @code{ARGV}}, for information
-about how @code{awk} uses these variables.
+about how @command{awk} uses these variables.
-@vindex ARGIND
-@item ARGIND *
-The index in @code{ARGV} of the current file being processed.
-Every time @code{gawk} opens a new data file for processing, it sets
-@code{ARGIND} to the index in @code{ARGV} of the file name.
-When @code{gawk} is processing the input files, it is always
-true that @samp{FILENAME == ARGV[ARGIND]}.
+@cindex @code{ARGIND} variable
+@item ARGIND #
+This is the index in @code{ARGV} of the current file being processed.
+Every time @command{gawk} opens a new @value{DF} for processing, it sets
+@code{ARGIND} to the index in @code{ARGV} of the @value{FN}.
+When @command{gawk} is processing the input files,
+@samp{FILENAME == ARGV[ARGIND]} is always true.
This variable is useful in file processing; it allows you to tell how far
-along you are in the list of data files, and to distinguish between
-successive instances of the same filename on the command line.
+along you are in the list of @value{DF}s as well as to distinguish between
+successive instances of the same @value{FN} on the command line.
-While you can change the value of @code{ARGIND} within your @code{awk}
-program, @code{gawk} will automatically set it to a new value when the
+While you can change the value of @code{ARGIND} within your @command{awk}
+program, @command{gawk} automatically sets it to a new value when the
next file is opened.
-This variable is a @code{gawk} extension. In other @code{awk} implementations,
-or if @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}),
+This variable is a @command{gawk} extension.
+In other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
it is not special.
-@vindex ENVIRON
+@cindex @code{ENVIRON} variable
@item ENVIRON
An associative array that contains the values of the environment. The array
-indices are the environment variable names; the values are the values of
+indices are the environment variable names; the elements are the values of
the particular environment variables. For example,
@code{ENVIRON["HOME"]} might be @file{/home/arnold}. Changing this array
does not affect the environment passed on to any programs that
-@code{awk} may spawn via redirection or the @code{system} function.
-(In a future version of @code{gawk}, it may do so.)
+@command{awk} may spawn via redirection or the @code{system} function.
+@c (In a future version of @command{gawk}, it may do so.)
Some operating systems may not have environment variables.
On such systems, the @code{ENVIRON} array is empty (except for
-@w{@code{ENVIRON["AWKPATH"]}}).
+@w{@code{ENVIRON["AWKPATH"]}},
+@pxref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}).
-@vindex ERRNO
-@item ERRNO *
-If a system error occurs either doing a redirection for @code{getline},
+@cindex @code{ERRNO} variable
+@item ERRNO #
+If a system error occurs during a redirection for @code{getline},
during a read for @code{getline}, or during a @code{close} operation,
-then @code{ERRNO} will contain a string describing the error.
+then @code{ERRNO} contains a string describing the error.
-This variable is a @code{gawk} extension. In other @code{awk} implementations,
-or if @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}),
+This variable is a @command{gawk} extension.
+In other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
it is not special.
@cindex dark corner
-@vindex FILENAME
+@cindex @code{FILENAME} variable
@item FILENAME
-This is the name of the file that @code{awk} is currently reading.
-When no data files are listed on the command line, @code{awk} reads
-from the standard input, and @code{FILENAME} is set to @code{"-"}.
+This is the name of the file that @command{awk} is currently reading.
+When no @value{DF}s are listed on the command line, @command{awk} reads
+from the standard input and @code{FILENAME} is set to @code{"-"}.
@code{FILENAME} is changed each time a new file is read
(@pxref{Reading Files, ,Reading Input Files}).
Inside a @code{BEGIN} rule, the value of @code{FILENAME} is
@code{""}, since there are no input files being processed
-yet.@footnote{Some early implementations of Unix @code{awk} initialized
-@code{FILENAME} to @code{"-"}, even if there were data files to be
-processed. This behavior was incorrect, and should not be relied
-upon in your programs.} (d.c.)
+yet.@footnote{Some early implementations of Unix @command{awk} initialized
+@code{FILENAME} to @code{"-"}, even if there were @value{DF}s to be
+processed. This behavior was incorrect and should not be relied
+upon in your programs.}
+@value{DARKCORNER}
+Note though, that using @code{getline}
+(@pxref{Getline, ,Explicit Input with @code{getline}})
+inside a @code{BEGIN} rule can give
+@code{FILENAME} a value.
-@vindex FNR
+@cindex @code{FNR} variable
@item FNR
-@code{FNR} is the current record number in the current file. @code{FNR} is
+This is the current record number in the current file. @code{FNR} is
incremented each time a new record is read
(@pxref{Getline, ,Explicit Input with @code{getline}}). It is reinitialized
to zero each time a new input file is started.
-@vindex NF
+@cindex @code{NF} variable
@item NF
-@code{NF} is the number of fields in the current input record.
+This is the number of fields in the current input record.
@code{NF} is set each time a new record is read, when a new field is
-created, or when @code{$0} changes (@pxref{Fields, ,Examining Fields}).
+created or when @code{$0} changes (@pxref{Fields, ,Examining Fields}).
-@vindex NR
+@cindex @code{NR} variable
@item NR
-This is the number of input records @code{awk} has processed since
+This is the number of input records @command{awk} has processed since
the beginning of the program's execution
-(@pxref{Records, ,How Input is Split into Records}).
-@code{NR} is set each time a new record is read.
+(@pxref{Records, ,How Input Is Split into Records}).
+@code{NR} is incremented each time a new record is read.
+
+@cindex @code{PROCINFO} variable
+@item PROCINFO #
+The elements of this array provide access to information about the
+running @command{awk} program.
+The following elements (listed alphabetically)
+are guaranteed to be available:
+
+@table @code
+@item PROCINFO["egid"]
+The value of the @code{getegid} system call.
+
+@item PROCINFO["euid"]
+The value of the @code{geteuid} system call.
+
+@item PROCINFO["FS"]
+This is
+@code{"FS"} if field splitting with @code{FS} is in effect, or it is
+@code{"FIELDWIDTHS"} if field splitting with @code{FIELDWIDTHS} is in effect.
+
+@item PROCINFO["gid"]
+The value of the @code{getgid} system call.
+
+@item PROCINFO["pgrpid"]
+The process group ID of the current process.
+
+@item PROCINFO["pid"]
+The process ID of the current process.
+
+@item PROCINFO["ppid"]
+The parent process ID of the current process.
+
+@item PROCINFO["uid"]
+The value of the @code{getuid} system call.
+@end table
+
+On some systems, there may be elements in the array, @code{"group1"}
+through @code{"group@var{N}"} for some @var{N}. @var{N} is the number of
+supplementary groups that the process has. Use the @code{in} operator
+to test for these elements
+(@pxref{Reference to Elements, , Referring to an Array Element}).
-@vindex RLENGTH
+This array is a @command{gawk} extension.
+In other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+it is not special.
+
+@cindex @code{RLENGTH} variable
@item RLENGTH
-@code{RLENGTH} is the length of the substring matched by the
+This is the length of the substring matched by the
@code{match} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
@code{RLENGTH} is set by invoking the @code{match} function. Its value
-is the length of the matched string, or @minus{}1 if no match was found.
+is the length of the matched string, or @minus{}1 if no match is found.
-@vindex RSTART
+@cindex @code{RSTART} variable
@item RSTART
-@code{RSTART} is the start-index in characters of the substring matched by the
+This is the start-index in characters of the substring that is matched by the
@code{match} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
@code{RSTART} is set by invoking the @code{match} function. Its value
is the position of the string where the matched substring starts, or zero
if no match was found.
-@vindex RT
-@item RT *
-@code{RT} is set each time a record is read. It contains the input text
+@cindex @code{RT} variable
+@item RT #
+This is set each time a record is read. It contains the input text
that matched the text denoted by @code{RS}, the record separator.
-This variable is a @code{gawk} extension. In other @code{awk} implementations,
-or if @code{gawk} is in compatibility mode
-(@pxref{Options, ,Command Line Options}),
+This variable is a @command{gawk} extension.
+In other @command{awk} implementations,
+or if @command{gawk} is in compatibility mode
+(@pxref{Options, ,Command-Line Options}),
it is not special.
@end table
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Changing @code{NR} and @code{FNR}
+@cindex advanced notes
@cindex dark corner
-A side note about @code{NR} and @code{FNR}.
-@code{awk} simply increments both of these variables
+@command{awk} increments @code{NR} and @code{FNR}
each time it reads a record, instead of setting them to the absolute
-value of the number of records read. This means that your program can
-change these variables, and their new values will be incremented for
-each record (d.c.). For example:
+value of the number of records read. This means that a program can
+change these variables and their new values are incremented for
+each record.
+@value{DARKCORNER}
+This is demonstrated in the following example:
@example
-@group
$ echo '1
> 2
> 3
@@ -8644,46 +10246,42 @@ $ echo '1
@print{} 17
@print{} 18
@print{} 19
-@end group
@end example
@noindent
-Before @code{FNR} was added to the @code{awk} language
-(@pxref{V7/SVR3.1, ,Major Changes between V7 and SVR3.1}),
-many @code{awk} programs used this feature to track the number of
+Before @code{FNR} was added to the @command{awk} language
+(@pxref{V7/SVR3.1, ,Major Changes Between V7 and SVR3.1}),
+many @command{awk} programs used this feature to track the number of
records in a file by resetting @code{NR} to zero when @code{FILENAME}
changed.
@node ARGC and ARGV, , Auto-set, Built-in Variables
-@section Using @code{ARGC} and @code{ARGV}
+@subsection Using @code{ARGC} and @code{ARGV}
-In @ref{Auto-set, , Built-in Variables that Convey Information},
-you saw this program describing the information contained in @code{ARGC}
+@ref{Auto-set, ,Built-in Variables That Convey Information},
+presented the following program describing the information contained in @code{ARGC}
and @code{ARGV}:
@example
-@group
$ awk 'BEGIN @{
-> for (i = 0; i < ARGC; i++)
-> print ARGV[i]
+> for (i = 0; i < ARGC; i++)
+> print ARGV[i]
> @}' inventory-shipped BBS-list
@print{} awk
@print{} inventory-shipped
@print{} BBS-list
-@end group
@end example
@noindent
-In this example, @code{ARGV[0]} contains @code{"awk"}, @code{ARGV[1]}
-contains @code{"inventory-shipped"}, and @code{ARGV[2]} contains
-@code{"BBS-list"}.
-
-Notice that the @code{awk} program is not entered in @code{ARGV}. The
-other special command line options, with their arguments, are also not
-entered. This includes variable assignments done with the @samp{-v}
-option (@pxref{Options, ,Command Line Options}).
+In this example, @code{ARGV[0]} contains @samp{awk}, @code{ARGV[1]}
+contains @samp{inventory-shipped}, and @code{ARGV[2]} contains
+@samp{BBS-list}.
+Notice that the @command{awk} program is not entered in @code{ARGV}. The
+other special command-line options, with their arguments, are also not
+entered. This includes variable assignments done with the @option{-v}
+option (@pxref{Options, ,Command-Line Options}).
Normal variable assignments on the command line @emph{are}
-treated as arguments, and do show up in the @code{ARGV} array.
+treated as arguments and do show up in the @code{ARGV} array:
@example
$ cat showargs.awk
@@ -8695,51 +10293,49 @@ $ cat showargs.awk
@print{} END @{ printf "A=%d, B=%d\n", A, B @}
$ awk -v A=1 -f showargs.awk B=2 /dev/null
@print{} A=1, B=0
-@print{} ARGV[0] = awk
-@print{} ARGV[1] = B=2
-@print{} ARGV[2] = /dev/null
+@print{} ARGV[0] = awk
+@print{} ARGV[1] = B=2
+@print{} ARGV[2] = /dev/null
@print{} A=1, B=2
@end example
-Your program can alter @code{ARGC} and the elements of @code{ARGV}.
-Each time @code{awk} reaches the end of an input file, it uses the next
+A program can alter @code{ARGC} and the elements of @code{ARGV}.
+Each time @command{awk} reaches the end of an input file, it uses the next
element of @code{ARGV} as the name of the next input file. By storing a
-different string there, your program can change which files are read.
-You can use @code{"-"} to represent the standard input. By storing
-additional elements and incrementing @code{ARGC} you can cause
+different string there, a program can change which files are read.
+Use @code{"-"} to represent the standard input. Storing
+additional elements and incrementing @code{ARGC} causes
additional files to be read.
-If you decrease the value of @code{ARGC}, that eliminates input files
+If the value of @code{ARGC} is decreased, that eliminates input files
from the end of the list. By recording the old value of @code{ARGC}
-elsewhere, your program can treat the eliminated arguments as
-something other than file names.
+elsewhere, a program can treat the eliminated arguments as
+something other than @value{FN}s.
To eliminate a file from the middle of the list, store the null string
(@code{""}) into @code{ARGV} in place of the file's name. As a
-special feature, @code{awk} ignores file names that have been
+special feature, @command{awk} ignores @value{FN}s that have been
replaced with the null string.
-You may also use the @code{delete} statement to remove elements from
+Another option is to
+use the @code{delete} statement to remove elements from
@code{ARGV} (@pxref{Delete, ,The @code{delete} Statement}).
-All of these actions are typically done from the @code{BEGIN} rule,
+All of these actions are typically done in the @code{BEGIN} rule,
before actual processing of the input begins.
-@xref{Split Program, ,Splitting a Large File Into Pieces}, and see
-@ref{Tee Program, ,Duplicating Output Into Multiple Files}, for an example
+@xref{Split Program, ,Splitting a Large File into Pieces}, and see
+@ref{Tee Program, ,Duplicating Output into Multiple Files}, for examples
of each way of removing elements from @code{ARGV}.
-
The following fragment processes @code{ARGV} in order to examine, and
-then remove, command line options.
+then remove, command-line options:
+@c NEXT ED: Add xref to rewind() function
@example
-@group
BEGIN @{
for (i = 1; i < ARGC; i++) @{
if (ARGV[i] == "-v")
verbose = 1
else if (ARGV[i] == "-d")
debug = 1
-@end group
-@group
else if (ARGV[i] ~ /^-?/) @{
e = sprintf("%s: unrecognized option -- %c",
ARGV[0], substr(ARGV[i], 1, ,1))
@@ -8749,44 +10345,55 @@ BEGIN @{
delete ARGV[i]
@}
@}
-@end group
@end example
-To actually get the options into the @code{awk} program, you have to
-end the @code{awk} options with @samp{--}, and then supply your options,
-like so:
+To actually get the options into the @command{awk} program,
+end the @command{awk} options with @option{--} and then supply
+the @command{awk} program's options, in the following manner:
@example
awk -f myprog -- -v -d file1 file2 @dots{}
@end example
-@cindex differences between @code{gawk} and @code{awk}
-This is not necessary in @code{gawk}: Unless @samp{--posix} has been
-specified, @code{gawk} silently puts any unrecognized options into
-@code{ARGV} for the @code{awk} program to deal with.
-
-As soon as it
-sees an unknown option, @code{gawk} stops looking for other options it might
-otherwise recognize. The above example with @code{gawk} would be:
+@cindex differences between @command{gawk} and @command{awk}
+This is not necessary in @command{gawk}. Unless @option{--posix} has
+been specified, @command{gawk} silently puts any unrecognized options
+into @code{ARGV} for the @command{awk} program to deal with. As soon
+as it sees an unknown option, @command{gawk} stops looking for other
+options that it might otherwise recognize. The previous example with
+@command{gawk} would be:
@example
gawk -f myprog -d -v file1 file2 @dots{}
@end example
@noindent
-Since @samp{-d} is not a valid @code{gawk} option, the following @samp{-v}
-is passed on to the @code{awk} program.
+Because @option{-d} is not a valid @command{gawk} option,
+it and the following @option{-v}
+are passed on to the @command{awk} program.
-@node Arrays, Built-in, Built-in Variables, Top
-@chapter Arrays in @code{awk}
+@node Arrays, Functions, Patterns and Actions, Top
+@chapter Arrays in @command{awk}
-An @dfn{array} is a table of values, called @dfn{elements}. The
+An @dfn{array} is a table of values called @dfn{elements}. The
elements of an array are distinguished by their indices. @dfn{Indices}
-may be either numbers or strings. @code{awk} maintains a single set
-of names that may be used for naming variables, arrays and functions
-(@pxref{User-defined, ,User-defined Functions}).
+may be either numbers or strings.
+
+This @value{CHAPTER} describes how arrays work in @command{awk},
+how to use array elements, how to scan through every element in an array,
+and how to remove array elements.
+It also describes how @command{awk} simulates multidimensional
+arrays, as well as some of the less obvious points about array usage.
+The @value{CHAPTER} finishes with a discussion of @command{gawk}'s facility
+for sorting an array based on its indices.
+
+@cindex names, use of
+@cindex namespace issues in @command{awk}
+@command{awk} maintains a single set
+of names that may be used for naming variables, arrays, and functions
+(@pxref{User-defined, ,User-Defined Functions}).
Thus, you cannot have a variable and an array with the same name in the
-same @code{awk} program.
+same @command{awk} program.
@menu
* Array Intro:: Introduction to Arrays
@@ -8799,49 +10406,51 @@ same @code{awk} program.
* Delete:: The @code{delete} statement removes an element
from an array.
* Numeric Array Subscripts:: How to use numbers as subscripts in
- @code{awk}.
+ @command{awk}.
* Uninitialized Subscripts:: Using Uninitialized variables as subscripts.
-* Multi-dimensional:: Emulating multi-dimensional arrays in
- @code{awk}.
-* Multi-scanning:: Scanning multi-dimensional arrays.
-* Array Efficiency:: Implementation-specific tips.
+* Multi-dimensional:: Emulating multidimensional arrays in
+ @command{awk}.
+* Multi-scanning:: Scanning multidimensional arrays.
+* Array Sorting:: Sorting array values and indices.
@end menu
@node Array Intro, Reference to Elements, Arrays, Arrays
@section Introduction to Arrays
@cindex arrays
-The @code{awk} language provides one-dimensional @dfn{arrays} for storing groups
-of related strings or numbers.
-
-Every @code{awk} array must have a name. Array names have the same
+The @command{awk} language provides one-dimensional arrays
+for storing groups of related strings or numbers.
+Every @command{awk} array must have a name. Array names have the same
syntax as variable names; any valid variable name would also be a valid
-array name. But you cannot use one name in both ways (as an array and
-as a variable) in one @code{awk} program.
-
-Arrays in @code{awk} superficially resemble arrays in other programming
-languages; but there are fundamental differences. In @code{awk}, you
-don't need to specify the size of an array before you start to use it.
-Additionally, any number or string in @code{awk} may be used as an
-array index, not just consecutive integers.
-
-In most other languages, you have to @dfn{declare} an array and specify
-how many elements or components it contains. In such languages, the
+array name. But one name cannot be used in both ways (as an array and
+as a variable) in the same @command{awk} program.
+
+Arrays in @command{awk} superficially resemble arrays in other programming
+languages, but there are fundamental differences. In @command{awk}, it
+isn't necessary to specify the size of an array before starting to use it.
+Additionally, any number or string in @command{awk}, not just consecutive integers,
+may be used as an array index.
+
+In most other languages, arrays must be @dfn{declared} before use,
+including a specification of
+how many elements or components they contain. In such languages, the
declaration causes a contiguous block of memory to be allocated for that
-many elements. An index in the array usually must be a positive integer; for
-example, the index zero specifies the first element in the array, which is
+many elements. Usually, an index in the array must be a positive integer.
+For example, the index zero specifies the first element in the array, which is
actually stored at the beginning of the block of memory. Index one
specifies the second element, which is stored in memory right after the
first element, and so on. It is impossible to add more elements to the
-array, because it has room for only as many elements as you declared.
-(Some languages allow arbitrary starting and ending indices,
-e.g., @samp{15 .. 27}, but the size of the array is still fixed when
+array, because it has room only for as many elements as given in
+the declaration.
+(Some languages allow arbitrary starting and ending
+indices---e.g., @samp{15 .. 27}---but the size of the array is still fixed when
the array is declared.)
-A contiguous array of four elements might look like this,
-conceptually, if the element values are eight, @code{"foo"},
-@code{""} and 30:
+A contiguous array of four elements might look like the following example,
+conceptually, if the element values are 8, @code{"foo"},
+@code{""}, and 30:
+@c NEXT ED: Use real images here
@iftex
@c from Karl Berry, much thanks for the help.
@tex
@@ -8852,10 +10461,10 @@ conceptually, if the element values are eight, @code{"foo"},
\centerline{\vbox{
\halign{\strut\hfil\ignorespaces#&&\vrule#&\hbox to\width{\hfil#\unskip\hfil}\cr
\noalign{\hrule width\hwidth}
- &&{\tt 8} &&{\tt "foo"} &&{\tt ""} &&{\tt 30} &&\quad value\cr
+ &&{\tt 8} &&{\tt "foo"} &&{\tt ""} &&{\tt 30} &&\quad Value\cr
\noalign{\hrule width\hwidth}
\noalign{\smallskip}
- &\omit&0&\omit &1 &\omit&2 &\omit&3 &\omit&\quad index\cr
+ &\omit&0&\omit &1 &\omit&2 &\omit&3 &\omit&\quad Index\cr
}
}}
@end tex
@@ -8863,56 +10472,55 @@ conceptually, if the element values are eight, @code{"foo"},
@ifinfo
@example
+---------+---------+--------+---------+
-| 8 | "foo" | "" | 30 | @r{value}
+| 8 | "foo" | "" | 30 | @r{Value}
+---------+---------+--------+---------+
- 0 1 2 3 @r{index}
+ 0 1 2 3 @r{Index}
@end example
@end ifinfo
@noindent
Only the values are stored; the indices are implicit from the order of
-the values. Eight is the value at index zero, because eight appears in the
+the values. 8 is the value at index zero, because 8 appears in the
position with zero elements before it.
@cindex arrays, definition of
@cindex associative arrays
@cindex arrays, associative
-Arrays in @code{awk} are different: they are @dfn{associative}. This means
+Arrays in @command{awk} are different---they are @dfn{associative}. This means
that each array is a collection of pairs: an index, and its corresponding
array element value:
@example
-@r{Element} 4 @r{Value} 30
-@r{Element} 2 @r{Value} "foo"
-@r{Element} 1 @r{Value} 8
-@r{Element} 3 @r{Value} ""
+@r{Element} 3 @r{Value} 30
+@r{Element} 1 @r{Value} "foo"
+@r{Element} 0 @r{Value} 8
+@r{Element} 2 @r{Value} ""
@end example
@noindent
-We have shown the pairs in jumbled order because their order is irrelevant.
+The pairs are shown in jumbled order because their order is irrelevant.
One advantage of associative arrays is that new pairs can be added
-at any time. For example, suppose we add to the above array a tenth element
-whose value is @w{@code{"number ten"}}. The result is this:
+at any time. For example, suppose a tenth element is added to the array
+whose value is @w{@code{"number ten"}}. The result is:
@example
@r{Element} 10 @r{Value} "number ten"
-@r{Element} 4 @r{Value} 30
-@r{Element} 2 @r{Value} "foo"
-@r{Element} 1 @r{Value} 8
-@r{Element} 3 @r{Value} ""
+@r{Element} 3 @r{Value} 30
+@r{Element} 1 @r{Value} "foo"
+@r{Element} 0 @r{Value} 8
+@r{Element} 2 @r{Value} ""
@end example
@noindent
@cindex sparse arrays
@cindex arrays, sparse
-Now the array is @dfn{sparse}, which just means some indices are missing:
-it has elements 1--4 and 10, but doesn't have elements 5, 6, 7, 8, or 9.
-@c ok, I should spell out the above, but ...
+Now the array is @dfn{sparse}, which just means some indices are missing.
+It has elements 0--3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or 9.
Another consequence of associative arrays is that the indices don't
have to be positive integers. Any number, or even a string, can be
-an index. For example, here is an array which translates words from
+an index. For example, the following is an array that translates words from
English into French:
@example
@@ -8926,21 +10534,25 @@ English into French:
Here we decided to translate the number one in both spelled-out and
numeric form---thus illustrating that a single array can have both
numbers and strings as indices.
-(In fact, array subscripts are always strings; this is discussed
+In fact, array subscripts are always strings; this is discussed
in more detail in
-@ref{Numeric Array Subscripts, ,Using Numbers to Subscript Arrays}.)
+@ref{Numeric Array Subscripts, ,Using Numbers to Subscript Arrays}.
+Here, the number @code{1} isn't double-quoted, since @command{awk}
+automatically converts it to a string.
-@cindex Array subscripts and @code{IGNORECASE}
-@cindex @code{IGNORECASE} and array subscripts
-@vindex IGNORECASE
+@cindex arrays, subscripts, and @code{IGNORECASE}
+@cindex @code{IGNORECASE}, and array subscripts
+@cindex @code{IGNORECASE} variable
The value of @code{IGNORECASE} has no effect upon array subscripting.
-You must use the exact same string value to retrieve an array element
-as you used to store it.
-
-When @code{awk} creates an array for you, e.g., with the @code{split}
-built-in function,
+The identical string value used to store an array element must be used
+to retrieve it.
+When @command{awk} creates an array (e.g., with the @code{split}
+built-in function),
that array's indices are consecutive integers starting at one.
-(@xref{String Functions, ,Built-in Functions for String Manipulation}.)
+(@xref{String Functions, ,String Manipulation Functions}.)
+
+@command{awk}'s arrays are efficient---the time to access an element
+is independent of the number of elements in the array.
@node Reference to Elements, Assigning Elements, Array Intro, Arrays
@section Referring to an Array Element
@@ -8948,8 +10560,8 @@ that array's indices are consecutive integers starting at one.
@cindex element of array
@cindex reference to array
-The principal way of using an array is to refer to one of its elements.
-An array reference is an expression which looks like this:
+The principal way to use an array is to refer to one of its elements.
+An array reference is an expression as follows:
@example
@var{array}[@var{index}]
@@ -8957,48 +10569,48 @@ An array reference is an expression which looks like this:
@noindent
Here, @var{array} is the name of an array. The expression @var{index} is
-the index of the element of the array that you want.
+the index of the desired element of the array.
The value of the array reference is the current value of that array
element. For example, @code{foo[4.3]} is an expression for the element
of array @code{foo} at index @samp{4.3}.
-If you refer to an array element that has no recorded value, the value
-of the reference is @code{""}, the null string. This includes elements
-to which you have not assigned any value, and elements that have been
+A reference to an array element that has no recorded value yields a value of
+@code{""}, the null string. This includes elements
+that have not been assigned any value as well as elements that have been
deleted (@pxref{Delete, ,The @code{delete} Statement}). Such a reference
automatically creates that array element, with the null string as its value.
(In some cases, this is unfortunate, because it might waste memory inside
-@code{awk}.)
+@command{awk}.)
@cindex arrays, presence of elements
@cindex arrays, the @code{in} operator
-You can find out if an element exists in an array at a certain index with
-the expression:
+To determine whether an element exists in an array at a certain index, use
+the following expression:
@example
@var{index} in @var{array}
@end example
+@cindex side effects
@noindent
This expression tests whether or not the particular index exists,
without the side effect of creating that element if it is not present.
The expression has the value one (true) if @code{@var{array}[@var{index}]}
-exists, and zero (false) if it does not exist.
-
-For example, to test whether the array @code{frequencies} contains the
-index @samp{2}, you could write this statement:
+exists and zero (false) if it does not exist.
+For example, this statement tests whether the array @code{frequencies}
+contains the index @samp{2}:
@example
if (2 in frequencies)
print "Subscript 2 is present."
@end example
-Note that this is @emph{not} a test of whether or not the array
+Note that this is @emph{not} a test of whether the array
@code{frequencies} contains an element whose @emph{value} is two.
-(There is no way to do that except to scan all the elements.) Also, this
+There is no way to do that except to scan all the elements. Also, this
@emph{does not} create @code{frequencies[2]}, while the following
-(incorrect) alternative would do so:
+(incorrect) alternative does:
@example
if (frequencies[2] != "")
@@ -9010,39 +10622,38 @@ if (frequencies[2] != "")
@cindex array assignment
@cindex element assignment
-Array elements are lvalues: they can be assigned values just like
-@code{awk} variables:
+Array elements can be assigned values just like
+@command{awk} variables:
@example
@var{array}[@var{subscript}] = @var{value}
@end example
@noindent
-Here @var{array} is the name of your array. The expression
-@var{subscript} is the index of the element of the array that you want
-to assign a value. The expression @var{value} is the value you are
-assigning to that element of the array.
+@var{array} is the name of an array. The expression
+@var{subscript} is the index of the element of the array that is
+assigned a value. The expression @var{value} is the value to
+assign to that element of the array.
@node Array Example, Scanning an Array, Assigning Elements, Arrays
@section Basic Array Example
The following program takes a list of lines, each beginning with a line
-number, and prints them out in order of line number. The line numbers are
-not in order, however, when they are first read: they are scrambled. This
-program sorts the lines by making an array using the line numbers as
-subscripts. It then prints out the lines in sorted order of their numbers.
-It is a very simple program, and gets confused if it encounters repeated
-numbers, gaps, or lines that don't begin with a number.
+number, and prints them out in order of line number. The line numbers
+are not in order when they are first read---instead they
+are scrambled. This program sorts the lines by making an array using
+the line numbers as subscripts. The program then prints out the lines
+in sorted order of their numbers. It is a very simple program and gets
+confused upon encountering repeated numbers, gaps, or lines that don't
+begin with a number:
@example
-@group
@c file eg/misc/arraymax.awk
@{
if ($1 > max)
max = $1
arr[$1] = $0
@}
-@end group
END @{
for (x = 1; x <= max; x++)
@@ -9054,14 +10665,11 @@ END @{
The first rule keeps track of the largest line number seen so far;
it also stores each line into the array @code{arr}, at an index that
is the line's number.
-
The second rule runs after all the input has been read, to print out
all the lines.
-
When this program is run with the following input:
@example
-@group
@c file eg/misc/arraymax.data
5 I am the Five man
2 Who are you? The new number two!
@@ -9069,11 +10677,10 @@ When this program is run with the following input:
1 Who is number one?
3 I three you.
@c endfile
-@end group
@end example
@noindent
-its output is this:
+its output is:
@example
1 Who is number one?
@@ -9085,9 +10692,8 @@ its output is this:
If a line number is repeated, the last line with a given number overrides
the others.
-
Gaps in the line numbers can be handled with an easy improvement to the
-program's @code{END} rule:
+program's @code{END} rule, as follows:
@example
END @{
@@ -9099,19 +10705,19 @@ END @{
@node Scanning an Array, Delete, Array Example, Arrays
@section Scanning All Elements of an Array
-@cindex @code{for (x in @dots{})}
+@cindex @code{for (x in @dots{})} statement
@cindex arrays, special @code{for} statement
@cindex scanning an array
+@cindex @code{in} operator
-In programs that use arrays, you often need a loop that executes
-once for each element of an array. In other languages, where arrays are
-contiguous and indices are limited to positive integers, this is
-easy: you can
-find all the valid indices by counting from the lowest index
-up to the highest. This
-technique won't do the job in @code{awk}, since any number or string
-can be an array index. So @code{awk} has a special kind of @code{for}
-statement for scanning an array:
+In programs that use arrays, it is often necessary to use a loop that
+executes once for each element of an array. In other languages, where
+arrays are contiguous and indices are limited to positive integers,
+this is easy: all the valid indices can be found by counting from
+the lowest index up to the highest. This technique won't do the job
+in @command{awk}, because any number or string can be an array index.
+So @command{awk} has a special kind of @code{for} statement for scanning
+an array:
@example
for (@var{var} in @var{array})
@@ -9119,27 +10725,27 @@ for (@var{var} in @var{array})
@end example
@noindent
-This loop executes @var{body} once for each index in @var{array} that your
-program has previously used, with the
-variable @var{var} set to that index.
+This loop executes @var{body} once for each index in @var{array} that the
+program has previously used, with the variable @var{var} set to that index.
-Here is a program that uses this form of the @code{for} statement. The
+The following program uses this form of the @code{for} statement. The
first rule scans the input records and notes which words appear (at
least once) in the input, by storing a one into the array @code{used} with
the word as index. The second rule scans the elements of @code{used} to
find all the distinct words that appear in the input. It prints each
-word that is more than 10 characters long, and also prints the number of
-such words. @xref{String Functions, ,Built-in Functions for String Manipulation}, for more information
-on the built-in function @code{length}.
+word that is more than 10 characters long and also prints the number of
+such words.
+@xref{String Functions, ,String Manipulation Functions},
+for more information on the built-in function @code{length}.
@example
-# Record a 1 for each word that is used at least once.
+# Record a 1 for each word that is used at least once
@{
for (i = 1; i <= NF; i++)
used[$i] = 1
@}
-# Find number of distinct words more than 10 characters long.
+# Find number of distinct words more than 10 characters long
END @{
for (x in used)
if (length(x) > 10) @{
@@ -9156,9 +10762,9 @@ for a more detailed example of this type.
The order in which elements of the array are accessed by this statement
is determined by the internal arrangement of the array elements within
-@code{awk} and cannot be controlled or changed. This can lead to
+@command{awk} and cannot be controlled or changed. This can lead to
problems if new elements are added to @var{array} by statements in
-the loop body; you cannot predict whether or not the @code{for} loop will
+the loop body; it is not predictable whether or not the @code{for} loop will
reach them. Similarly, changing @var{var} inside the loop may produce
strange results. It is best to avoid such things.
@@ -9169,18 +10775,17 @@ strange results. It is best to avoid such things.
@cindex removing elements of arrays
@cindex arrays, deleting an element
-You can remove an individual element of an array using the @code{delete}
+To remove an individual element of an array, use the @code{delete}
statement:
@example
delete @var{array}[@var{index}]
@end example
-Once you have deleted an array element, you can no longer obtain any
-value the element once had. It is as if you had never referred
-to it and had never given it any value.
-
-Here is an example of deleting elements in an array:
+Once an array element has been deleted, any value the element once
+had is no longer available. It is as if the element had never
+been referred to or had been given a value.
+The following is an example of deleting elements in an array:
@example
for (i in frequencies)
@@ -9189,10 +10794,9 @@ for (i in frequencies)
@noindent
This example removes all the elements from the array @code{frequencies}.
-
-If you delete an element, a subsequent @code{for} statement to scan the array
-will not report that element, and the @code{in} operator to check for
-the presence of that element will return zero (i.e.@: false):
+Once an element is deleted, a subsequent @code{for} statement to scan the array
+does not report that element and the @code{in} operator to check for
+the presence of that element returns zero (i.e., false):
@example
delete foo[4]
@@ -9202,6 +10806,7 @@ if (4 in foo)
It is important to note that deleting an element is @emph{not} the
same as assigning it a null value (the empty string, @code{""}).
+For example:
@example
foo[4] = ""
@@ -9209,46 +10814,49 @@ if (4 in foo)
print "This is printed, even though foo[4] is empty"
@end example
+@cindex lint checks
It is not an error to delete an element that does not exist.
+If @option{--lint} is provided on the command line
+(@pxref{Options, ,Command-Line Options}),
+@command{gawk} issues a warning message when an element that
+is not in the array is deleted.
@cindex arrays, deleting entire contents
@cindex deleting entire arrays
-@cindex differences between @code{gawk} and @code{awk}
-You can delete all the elements of an array with a single statement,
-by leaving off the subscript in the @code{delete} statement.
+@cindex differences between @command{gawk} and @command{awk}
+All the elements of an array may be deleted with a single statement
+by leaving off the subscript in the @code{delete} statement,
+as follows:
@example
delete @var{array}
@end example
-This ability is a @code{gawk} extension; it is not available in
-compatibility mode (@pxref{Options, ,Command Line Options}).
+This ability is a @command{gawk} extension; it is not available in
+compatibility mode (@pxref{Options, ,Command-Line Options}).
Using this version of the @code{delete} statement is about three times
more efficient than the equivalent loop that deletes each element one
at a time.
@cindex portability issues
-The following statement provides a portable, but non-obvious way to clear
-out an array.
-
@cindex Brennan, Michael
+The following statement provides a portable but non-obvious way to clear
+out an array:@footnote{Thanks to Michael Brennan for pointing this out.}
+
@example
-@group
-# thanks to Michael Brennan for pointing this out
split("", array)
-@end group
@end example
The @code{split} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation})
+(@pxref{String Functions, ,String Manipulation Functions})
clears out the target array first. This call asks it to split
-apart the null string. Since there is no data to split out, the
+apart the null string. Because there is no data to split out, the
function simply clears the array and then returns.
@strong{Caution:} Deleting an array does not change its type; you cannot
-delete an array and then use the array's name as a scalar. For
-example, this will not work:
+delete an array and then use the array's name as a scalar
+(i.e., a regular variable). For example, the following does not work:
@example
a[1] = 3; delete a; a = 3
@@ -9257,69 +10865,78 @@ a[1] = 3; delete a; a = 3
@node Numeric Array Subscripts, Uninitialized Subscripts, Delete, Arrays
@section Using Numbers to Subscript Arrays
-An important aspect of arrays to remember is that @emph{array subscripts
-are always strings}. If you use a numeric value as a subscript,
-it will be converted to a string value before it is used for subscripting
-(@pxref{Conversion, ,Conversion of Strings and Numbers}).
-
@cindex conversions, during subscripting
@cindex numbers, used as subscripts
-@vindex CONVFMT
-This means that the value of the built-in variable @code{CONVFMT} can potentially
+@cindex @code{CONVFMT} variable
+An important aspect about arrays to remember is that @emph{array subscripts
+are always strings}. When a numeric value is used as a subscript,
+it is converted to a string value before being used for subscripting
+(@pxref{Conversion, ,Conversion of Strings and Numbers}).
+This means that the value of the built-in variable @code{CONVFMT} can
affect how your program accesses elements of an array. For example:
@example
xyz = 12.153
data[xyz] = 1
CONVFMT = "%2.2f"
-@group
if (xyz in data)
printf "%s is in data\n", xyz
else
printf "%s is not in data\n", xyz
-@end group
@end example
@noindent
This prints @samp{12.15 is not in data}. The first statement gives
@code{xyz} a numeric value. Assigning to
@code{data[xyz]} subscripts @code{data} with the string value @code{"12.153"}
-(using the default conversion value of @code{CONVFMT}, @code{"%.6g"}),
-and assigns one to @code{data["12.153"]}. The program then changes
+(using the default conversion value of @code{CONVFMT}, @code{"%.6g"}).
+Thus, the array element @code{data["12.153"]} is assigned the value one.
+The program then changes
the value of @code{CONVFMT}. The test @samp{(xyz in data)} generates a new
-string value from @code{xyz}, this time @code{"12.15"}, since the value of
+string value from @code{xyz}---this time @code{"12.15"}---because the value of
@code{CONVFMT} only allows two significant digits. This test fails,
since @code{"12.15"} is a different string from @code{"12.153"}.
According to the rules for conversions
(@pxref{Conversion, ,Conversion of Strings and Numbers}), integer
values are always converted to strings as integers, no matter what the
-value of @code{CONVFMT} may happen to be. So the usual case of:
+value of @code{CONVFMT} may happen to be. So the usual case of
+the following works:
@example
for (i = 1; i <= maxsub; i++)
@i{do something with} array[i]
@end example
-@noindent
-will work, no matter what the value of @code{CONVFMT}.
+The ``integer values always convert to strings as integers'' rule
+has an additional consequence for array indexing.
+Octal and hexadecimal constants
+(@pxref{Non-decimal-numbers, ,Octal and Hexadecimal Numbers})
+are converted internally into numbers and their original form
+is forgotten.
+This means, for example, that
+@code{array[17]},
+@code{array[021]},
+and
+@code{array[0x11]}
+all refer to the same element!
-Like many things in @code{awk}, the majority of the time things work
-as you would expect them to work. But it is useful to have a precise
-knowledge of the actual rules, since sometimes they can have a subtle
+As with many things in @command{awk}, the majority of the time
+things work as one would expect them to. But it is useful to have a precise
+knowledge of the actual rules which sometimes can have a subtle
effect on your programs.
@node Uninitialized Subscripts, Multi-dimensional, Numeric Array Subscripts, Arrays
@section Using Uninitialized Variables as Subscripts
@cindex uninitialized variables, as array subscripts
-@cindex array subscripts, uninitialized variables
-Suppose you want to print your input data in reverse order.
-A reasonable attempt at a program to do so (with some test
+@cindex arrays, subscripts, uninitialized variables
+Suppose it's necessary to write a program
+to print the input data in reverse order.
+A reasonable attempt to do so (with some test
data) might look like this:
@example
-@group
$ echo 'line 1
> line 2
> line 3' | awk '@{ l[lines] = $0; ++lines @}
@@ -9329,7 +10946,6 @@ $ echo 'line 1
> @}'
@print{} line 3
@print{} line 2
-@end group
@end example
Unfortunately, the very first line of input data did not come out in the
@@ -9337,13 +10953,12 @@ output!
At first glance, this program should have worked. The variable @code{lines}
is uninitialized, and uninitialized variables have the numeric value zero.
-So, @code{awk} should have printed the value of @code{l[0]}.
+So, @command{awk} should have printed the value of @code{l[0]}.
-The issue here is that subscripts for @code{awk} arrays are @strong{always}
-strings. And uninitialized variables, when used as strings, have the
-value @code{""}, not zero. Thus, @samp{line 1} ended up stored in
+The issue here is that subscripts for @command{awk} arrays are @emph{always}
+strings. Uninitialized variables, when used as strings, have the
+value @code{""}, not zero. Thus, @samp{line 1} ends up stored in
@code{l[""]}.
-
The following version of the program works correctly:
@example
@@ -9355,33 +10970,36 @@ END @{
@end example
Here, the @samp{++} forces @code{lines} to be numeric, thus making
-the ``old value'' numeric zero, which is then converted to @code{"0"}
+the ``old value'' numeric zero. This is then converted to @code{"0"}
as the array subscript.
@cindex null string, as array subscript
@cindex dark corner
-As we have just seen, even though it is somewhat unusual, the null string
-(@code{""}) is a valid array subscript (d.c.). If @samp{--lint} is provided
-on the command line (@pxref{Options, ,Command Line Options}),
-@code{gawk} will warn about the use of the null string as a subscript.
+@cindex lint checks
+Even though it is somewhat unusual, the null string
+(@code{""}) is a valid array subscript.
+@value{DARKCORNER}
+@command{gawk} warns about the use of the null string as a subscript
+if @option{--lint} is provided
+on the command line (@pxref{Options, ,Command-Line Options}).
@node Multi-dimensional, Multi-scanning, Uninitialized Subscripts, Arrays
-@section Multi-dimensional Arrays
+@section Multidimensional Arrays
@cindex subscripts in arrays
-@cindex arrays, multi-dimensional subscripts
-@cindex multi-dimensional subscripts
-A multi-dimensional array is an array in which an element is identified
-by a sequence of indices, instead of a single index. For example, a
+@cindex arrays, multidimensional subscripts
+@cindex multidimensional subscripts
+A multidimensional array is an array in which an element is identified
+by a sequence of indices instead of a single index. For example, a
two-dimensional array requires two indices. The usual way (in most
-languages, including @code{awk}) to refer to an element of a
+languages, including @command{awk}) to refer to an element of a
two-dimensional array named @code{grid} is with
@code{grid[@var{x},@var{y}]}.
-@vindex SUBSEP
-Multi-dimensional arrays are supported in @code{awk} through
-concatenation of indices into one string. What happens is that
-@code{awk} converts the indices into strings
+@cindex @code{SUBSEP} variable
+Multidimensional arrays are supported in @command{awk} through
+concatenation of indices into one string.
+@command{awk} converts the indices into strings
(@pxref{Conversion, ,Conversion of Strings and Numbers}) and
concatenates them together, with a separator between them. This creates
a single string that describes the values of the separate indices. The
@@ -9390,32 +11008,30 @@ one-dimensional array. The separator used is the value of the built-in
variable @code{SUBSEP}.
For example, suppose we evaluate the expression @samp{foo[5,12] = "value"}
-when the value of @code{SUBSEP} is @code{"@@"}. The numbers five and 12 are
+when the value of @code{SUBSEP} is @code{"@@"}. The numbers 5 and 12 are
converted to strings and
concatenated with an @samp{@@} between them, yielding @code{"5@@12"}; thus,
the array element @code{foo["5@@12"]} is set to @code{"value"}.
-Once the element's value is stored, @code{awk} has no record of whether
+Once the element's value is stored, @command{awk} has no record of whether
it was stored with a single index or a sequence of indices. The two
expressions @samp{foo[5,12]} and @w{@samp{foo[5 SUBSEP 12]}} are always
equivalent.
The default value of @code{SUBSEP} is the string @code{"\034"},
which contains a non-printing character that is unlikely to appear in an
-@code{awk} program or in most input data.
-
+@command{awk} program or in most input data.
The usefulness of choosing an unlikely character comes from the fact
-that index values that contain a string matching @code{SUBSEP} lead to
-combined strings that are ambiguous. Suppose that @code{SUBSEP} were
+that index values that contain a string matching @code{SUBSEP} can lead to
+combined strings that are ambiguous. Suppose that @code{SUBSEP} is
@code{"@@"}; then @w{@samp{foo["a@@b", "c"]}} and @w{@samp{foo["a",
-"b@@c"]}} would be indistinguishable because both would actually be
+"b@@c"]}} are indistinguishable because both are actually
stored as @samp{foo["a@@b@@c"]}.
-You can test whether a particular index-sequence exists in a
-``multi-dimensional'' array with the same operator @samp{in} used for single
-dimensional arrays. Instead of a single index as the left-hand operand,
-write the whole sequence of indices, separated by commas, in
-parentheses:
+To test whether a particular index sequence exists in a
+``multidimensional'' array, use the same operator (@samp{in}) that is
+used for single dimensional arrays. Write the whole sequence of indices
+in parentheses, separated by commas, as the left operand:
@example
(@var{subscript1}, @var{subscript2}, @dots{}) in @var{array}
@@ -9427,190 +11043,260 @@ result. It assumes that all lines have the same number of
elements.
@example
-@group
-awk '@{
+@{
if (max_nf < NF)
max_nf = NF
max_nr = NR
for (x = 1; x <= NF; x++)
vector[x, NR] = $x
@}
-@end group
-@group
END @{
for (x = 1; x <= max_nf; x++) @{
for (y = max_nr; y >= 1; --y)
printf("%s ", vector[x, y])
printf("\n")
@}
-@}'
-@end group
+@}
@end example
@noindent
When given the input:
@example
-@group
1 2 3 4 5 6
2 3 4 5 6 1
3 4 5 6 1 2
4 5 6 1 2 3
-@end group
@end example
@noindent
-it produces:
+the program produces the following output:
@example
-@group
4 3 2 1
5 4 3 2
6 5 4 3
1 6 5 4
2 1 6 5
3 2 1 6
-@end group
@end example
-@node Multi-scanning, Array Efficiency, Multi-dimensional, Arrays
-@section Scanning Multi-dimensional Arrays
+@node Multi-scanning, Array Sorting, Multi-dimensional, Arrays
+@section Scanning Multidimensional Arrays
There is no special @code{for} statement for scanning a
-``multi-dimensional'' array; there cannot be one, because in truth there
-are no multi-dimensional arrays or elements; there is only a
-multi-dimensional @emph{way of accessing} an array.
+``multidimensional'' array. There cannot be one, because in truth there
+are no multidimensional arrays or elements---there is only a
+multidimensional @emph{way of accessing} an array.
However, if your program has an array that is always accessed as
-multi-dimensional, you can get the effect of scanning it by combining
+multidimensional, you can get the effect of scanning it by combining
the scanning @code{for} statement
(@pxref{Scanning an Array, ,Scanning All Elements of an Array}) with the
-@code{split} built-in function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
-It works like this:
+built-in @code{split} function
+(@pxref{String Functions, ,String Manipulation Functions}).
+It works in the following manner:
@example
for (combined in array) @{
- split(combined, separate, SUBSEP)
- @dots{}
+ split(combined, separate, SUBSEP)
+ @dots{}
@}
@end example
@noindent
-This sets @code{combined} to
-each concatenated, combined index in the array, and splits it
+This sets the variable @code{combined} to
+each concatenated combined index in the array, and splits it
into the individual indices by breaking it apart where the value of
-@code{SUBSEP} appears. The split-out indices become the elements of
+@code{SUBSEP} appears. The individual indices then become the elements of
the array @code{separate}.
-Thus, suppose you have previously stored a value in @code{array[1, "foo"]};
-then an element with index @code{"1\034foo"} exists in
-@code{array}. (Recall that the default value of @code{SUBSEP} is
-the character with code 034.) Sooner or later the @code{for} statement
-will find that index and do an iteration with @code{combined} set to
-@code{"1\034foo"}. Then the @code{split} function is called as
-follows:
+Thus, if a value is previously stored in @code{array[1, "foo"]}; then
+an element with index @code{"1\034foo"} exists in @code{array}. (Recall
+that the default value of @code{SUBSEP} is the character with code 034.)
+Sooner or later, the @code{for} statement finds that index and does an
+iteration with the variable @code{combined} set to @code{"1\034foo"}.
+Then the @code{split} function is called as follows:
@example
split("1\034foo", separate, "\034")
@end example
@noindent
-The result of this is to set @code{separate[1]} to @code{"1"} and
-@code{separate[2]} to @code{"foo"}. Presto, the original sequence of
-separate indices has been recovered.
+The result is to set @code{separate[1]} to @code{"1"} and
+@code{separate[2]} to @code{"foo"}. Presto! The original sequence of
+separate indices is recovered.
+
+@node Array Sorting, , Multi-scanning, Arrays
+@section Sorting Array Values and Indices with @command{gawk}
+
+@cindex arrays, sorting
+@cindex @code{asort} built-in function
+The order in which an array is scanned with a @samp{for (i in array)}
+loop is essentially arbitrary.
+In most @command{awk} implementations, sorting an array requires
+writing a @code{sort} function.
+While this can be educational for exploring different sorting algorithms,
+usually that's not the point of the program.
+@command{gawk} provides the built-in @code{asort} function
+(@pxref{String Functions, ,String Manipulation Functions})
+that sorts an array. For example:
+
+@example
+@var{populate the array} data
+n = asort(data)
+for (i = 1; i <= n; i++)
+ @var{do something with} data[i]
+@end example
+
+After the call to @code{asort}, the array @code{data} is indexed from 1
+to some number @var{n}, the total number of elements in @code{data}.
+(This count is @code{asort}'s return value.)
+@code{data[1]} @value{LEQ} @code{data[2]} @value{LEQ} @code{data[3]}, and so on.
+The comparison of array elements is done
+using @command{gawk}'s usual comparison rules
+(@pxref{Typing and Comparison, ,Variable Typing and Comparison Expressions}).
+
+@cindex side effects
+An important side effect of calling @code{asort} is that
+@emph{the array's original indices are irrevocably lost}.
+As this isn't always desirable, @code{asort} accepts a
+second argument:
+
+@example
+@var{populate the array} source
+n = asort(source, dest)
+for (i = 1; i <= n; i++)
+ @var{do something with} dest[i]
+@end example
+
+In this case, @command{gawk} copies the @code{source} array into the
+@code{dest} array and then sorts @code{dest}, destroying its indices.
+However, the @code{source} array is not affected.
+
+Often, what's needed is to sort on the values of the @emph{indices}
+instead of the values of the elements. To do this, use a helper array
+to hold the sorted index values, and then access the original array's
+elements. It works in the following way:
+
+@example
+@var{populate the array} data
+# copy indices
+j = 1
+for (i in data) @{
+ ind[j] = i # index value becomes element value
+ j++
+@}
+n = asort(ind) # index values are now sorted
+for (i = 1; i <= n; i++)
+ @var{do something with} data[ind[i]]
+@end example
+
+Sorting the array by replacing the indices provides maximal flexibility.
+To traverse the elements in decreasing order, use a loop that goes from
+@var{n} down to 1, either over the elements or over the indices.
+
+@cindex reference counting
+Copying array indices and elements isn't expensive in terms of memory.
+Internally, @command{gawk} maintains @dfn{reference counts} to data.
+For example, when @code{asort} copies the first array to the second one,
+there is only one copy of the original array elements' data, even though
+both arrays use the values. Similarly, when copying the indices from
+@code{data} to @code{ind}, there is only one copy of the actual index
+strings.
-@node Array Efficiency, , Multi-scanning, Arrays
-@section Using Array Memory Efficiently
+@cindex arrays, sorting and @code{IGNORECASE}
+@cindex @code{IGNORECASE}, and array sorting
+@cindex @code{IGNORECASE} variable
+As with array subscripts, the value of @code{IGNORECASE}
+does not affect array sorting.
-This section applies just to @code{gawk}.
+@node Functions, Internationalization, Arrays, Top
+@chapter Functions
-It is often useful to use the same bit of data as an index
-into multiple arrays.
-Due to the way @code{gawk} implements associative arrays,
-when you need to use input data as an index for multiple
-arrays, it is much more effecient to assign the input field
-to a separate variable, and then use that variable as the index.
+This @value{CHAPTER} describes @command{awk}'s built-in functions,
+which fall into three categories: numeric, string, and I/O.
+@command{gawk} provides additional groups of functions
+to work with values that represent time, do
+bit manipulation, and to internationalize and localize programs.
-@example
-@{
- name = $1
- ssn = $2
- nkids = $3
- @dots{}
- seniority[name]++ # better than seniority[$1]++
- kids[name] = nkids # better than kids[$1] = nkids
-@}
-@end example
+Besides the built-in functions, @command{awk} has provisions for
+writing new functions that the rest of a program can use.
+The second half of this @value{CHAPTER} describes these
+@dfn{user-defined} functions.
-Using separate variables with mnemonic names for the input fields
-makes programs more readable, in any case.
-It is an eventual goal to make @code{gawk}'s array indexing as efficient
-as possible, no matter what the source of the index value.
+@menu
+* Built-in:: Summarizes the built-in functions.
+* User-defined:: Describes User-defined functions in detail.
+@end menu
-@node Built-in, User-defined, Arrays, Top
-@chapter Built-in Functions
+@node Built-in, User-defined, Functions, Functions
+@section Built-in Functions
@c 2e: USE TEXINFO-2 FUNCTION DEFINITION STUFF!!!!!!!!!!!!!
@cindex built-in functions
-@dfn{Built-in} functions are functions that are always available for
-your @code{awk} program to call. This chapter defines all the built-in
-functions in @code{awk}; some of them are mentioned in other sections,
-but they are summarized here for your convenience. (You can also define
-new functions yourself. @xref{User-defined, ,User-defined Functions}.)
+@dfn{Built-in} functions are always available for
+your @command{awk} program to call. This @value{SECTION} defines all
+the built-in
+functions in @command{awk}; some of these are mentioned in other sections
+but are summarized here for your convenience.
@menu
* Calling Built-in:: How to call built-in functions.
* Numeric Functions:: Functions that work with numbers, including
@code{int}, @code{sin} and @code{rand}.
* String Functions:: Functions for string manipulation, such as
- @code{split}, @code{match}, and
- @code{sprintf}.
+ @code{split}, @code{match} and @code{sprintf}.
* I/O Functions:: Functions for files and shell commands.
-* Time Functions:: Functions for dealing with time stamps.
+* Time Functions:: Functions for dealing with timestamps.
+* Bitwise Functions:: Functions for bitwise operations.
+* I18N Functions:: Functions for string translation.
@end menu
@node Calling Built-in, Numeric Functions, Built-in, Built-in
-@section Calling Built-in Functions
+@subsection Calling Built-in Functions
-To call a built-in function, write the name of the function followed
+To call one of @command{awk}'s built-in functions, write the name of
+the function followed
by arguments in parentheses. For example, @samp{atan2(y + z, 1)}
-is a call to the function @code{atan2}, with two arguments.
+is a call to the function @code{atan2}, and has two arguments.
+@cindex conventions, programming
+@cindex programming conventions
Whitespace is ignored between the built-in function name and the
-open-parenthesis, but we recommend that you avoid using whitespace
+open parenthesis, and it is good practice to avoid using whitespace
there. User-defined functions do not permit whitespace in this way, and
-you will find it easier to avoid mistakes by following a simple
-convention which always works: no whitespace after a function name.
+it is easier to avoid mistakes by following a simple
+convention that always works---no whitespace after a function name.
-@cindex differences between @code{gawk} and @code{awk}
+@cindex fatal errors
+@cindex differences between @command{gawk} and @command{awk}
Each built-in function accepts a certain number of arguments.
In some cases, arguments can be omitted. The defaults for omitted
arguments vary from function to function and are described under the
-individual functions. In some @code{awk} implementations, extra
-arguments given to built-in functions are ignored. However, in @code{gawk},
+individual functions. In some @command{awk} implementations, extra
+arguments given to built-in functions are ignored. However, in @command{gawk},
it is a fatal error to give extra arguments to a built-in function.
When a function is called, expressions that create the function's actual
-parameters are evaluated completely before the function call is performed.
-For example, in the code fragment:
+parameters are evaluated completely before the call is performed.
+For example, in the following code fragment:
@example
i = 4
j = sqrt(i++)
@end example
-@noindent
-the variable @code{i} is set to five before @code{sqrt} is called
-with a value of four for its actual parameter.
-
@cindex evaluation, order of
@cindex order of evaluation
+@noindent
+the variable @code{i} is incremented to the value five before @code{sqrt}
+is called with a value of four for its actual parameter.
The order of evaluation of the expressions used for the function's
-parameters is undefined. Thus, you should not write programs that
+parameters is undefined. Thus, avoid writing programs that
assume that parameters are evaluated from left to right or from
-right to left. For example,
+right to left. For example:
@example
i = 5
@@ -9618,62 +11304,69 @@ j = atan2(i++, i *= 2)
@end example
If the order of evaluation is left to right, then @code{i} first becomes
-six, and then 12, and @code{atan2} is called with the two arguments six
+six, and then 12, and @code{atan2} is called with the two arguments 6
and 12. But if the order of evaluation is right to left, @code{i}
-first becomes 10, and then 11, and @code{atan2} is called with the
+first becomes 10, then 11, and @code{atan2} is called with the
two arguments 11 and 10.
@node Numeric Functions, String Functions, Calling Built-in, Built-in
-@section Numeric Built-in Functions
+@subsection Numeric Functions
-Here is a full list of built-in functions that work with numbers.
-Optional parameters are enclosed in square brackets (``['' and ``]'').
+The following list describes all of
+the built-in functions that work with numbers.
+Optional parameters are enclosed in square brackets ([ and ]):
@table @code
@item int(@var{x})
-@findex int
-This produces the nearest integer to @var{x}, located between @var{x} and zero,
+@cindex @code{int} built-in function
+This returns the nearest integer to @var{x}, located between @var{x} and zero and
truncated toward zero.
For example, @code{int(3)} is three, @code{int(3.9)} is three, @code{int(-3.9)}
is @minus{}3, and @code{int(-3)} is @minus{}3 as well.
@item sqrt(@var{x})
-@findex sqrt
-This gives you the positive square root of @var{x}. It reports an error
+@cindex @code{sqrt} built-in function
+This returns the positive square root of @var{x}.
+@command{gawk} reports an error
if @var{x} is negative. Thus, @code{sqrt(4)} is two.
@item exp(@var{x})
-@findex exp
-This gives you the exponential of @var{x} (@code{e ^ @var{x}}), or reports
+@cindex @code{exp} built-in function
+This returns the exponential of @var{x} (@code{e ^ @var{x}}) or reports
an error if @var{x} is out of range. The range of values @var{x} can have
-depends on your machine's floating point representation.
+depends on your machine's floating-point representation.
@item log(@var{x})
-@findex log
-This gives you the natural logarithm of @var{x}, if @var{x} is positive;
+@cindex @code{log} built-in function
+This returns the natural logarithm of @var{x}, if @var{x} is positive;
otherwise, it reports an error.
@item sin(@var{x})
-@findex sin
-This gives you the sine of @var{x}, with @var{x} in radians.
+@cindex @code{sin} built-in function
+This returns the sine of @var{x}, with @var{x} in radians.
@item cos(@var{x})
-@findex cos
-This gives you the cosine of @var{x}, with @var{x} in radians.
+@cindex @code{cos} built-in function
+This returns the cosine of @var{x}, with @var{x} in radians.
@item atan2(@var{y}, @var{x})
-@findex atan2
-This gives you the arctangent of @code{@var{y} / @var{x}} in radians.
+@cindex @code{atan2} built-in function
+This returns the arctangent of @code{@var{y} / @var{x}} in radians.
@item rand()
-@findex rand
-This gives you a random number. The values of @code{rand} are
-uniformly-distributed between zero and one.
-The value is never zero and never one.
+@cindex @code{rand} built-in function
+This returns a random number. The values of @code{rand} are
+uniformly distributed between zero and one.
+The value is never zero and never one.@footnote{The C version of @code{rand}
+is known to produce fairly poor sequences of random numbers.
+However, nothing requires that an @command{awk} implementation use the C
+@code{rand} to implement the @command{awk} version of @code{rand}.
+In fact, @command{gawk} uses the BSD @code{random} function, which is
+considerably better than @code{rand}, to produce random numbers.}
-Often you want random integers instead. Here is a user-defined function
-you can use to obtain a random non-negative integer less than @var{n}:
+Often random integers are needed instead. Following is a user-defined function
+that can be used to obtain a random non-negative integer less than @var{n}:
@example
function randint(n) @{
@@ -9683,45 +11376,40 @@ function randint(n) @{
@noindent
The multiplication produces a random number greater than zero and less
-than @code{n}. We then make it an integer (using @code{int}) between zero
-and @code{n} @minus{} 1, inclusive.
+than @code{n}. Using @code{int}, this result is made into
+an integer between zero and @code{n} @minus{} 1, inclusive.
-Here is an example where a similar function is used to produce
-random integers between one and @var{n}. This program
-prints a new random number for each input record.
+The following example uses a similar function to produce random integers
+between one and @var{n}. This program prints a new random number for
+each input record.
@example
-@group
-awk '
# Function to roll a simulated die.
function roll(n) @{ return 1 + int(rand() * n) @}
-@end group
-@group
# Roll 3 six-sided dice and
# print total number of points.
@{
printf("%d points\n",
roll(6)+roll(6)+roll(6))
-@}'
-@end group
+@}
@end example
@cindex seed for random numbers
@cindex random numbers, seed of
-@comment MAWK uses a different seed each time.
-@strong{Caution:} In most @code{awk} implementations, including @code{gawk},
+@c MAWK uses a different seed each time.
+@strong{Caution:} In most @command{awk} implementations, including @command{gawk},
@code{rand} starts generating numbers from the same
-starting number, or @dfn{seed}, each time you run @code{awk}. Thus,
-a program will generate the same results each time you run it.
-The numbers are random within one @code{awk} run, but predictable
+starting number, or @dfn{seed}, each time you run @command{awk}. Thus,
+a program generates the same results each time you run it.
+The numbers are random within one @command{awk} run but predictable
from run to run. This is convenient for debugging, but if you want
a program to do different things each time it is used, you must change
-the seed to a value that will be different in each run. To do this,
+the seed to a value that is different in each run. To do this,
use @code{srand}.
@item srand(@r{[}@var{x}@r{]})
-@findex srand
+@cindex @code{srand} built-in function
The function @code{srand} sets the starting point, or seed,
for generating random numbers to the value @var{x}.
@@ -9730,31 +11418,83 @@ numbers.@footnote{Computer generated random numbers really are not truly
random. They are technically known as ``pseudo-random.'' This means
that while the numbers in a sequence appear to be random, you can in
fact generate the same sequence of random numbers over and over again.}
-Thus, if you set the seed to the same value a second time, you will get
-the same sequence of random numbers again.
+Thus, if the seed is set to the same value a second time,
+the same sequence of random numbers is produced again.
-If you omit the argument @var{x}, as in @code{srand()}, then the current
+Different @command{awk} implementations use different random number
+generators internally. Don't expect the same @command{awk} program
+to produce the same series of random numbers when executed by
+different versions of @command{awk}.
+
+If the argument @var{x} is omitted, as in @samp{srand()}, then the current
date and time of day are used for a seed. This is the way to get random
numbers that are truly unpredictable.
The return value of @code{srand} is the previous seed. This makes it
-easy to keep track of the seeds for use in consistently reproducing
+easy to keep track of the seeds in case you need to consistently reproduce
sequences of random numbers.
@end table
@node String Functions, I/O Functions, Numeric Functions, Built-in
-@section Built-in Functions for String Manipulation
+@subsection String Manipulation Functions
-The functions in this section look at or change the text of one or more
+The functions in this @value{SECTION} look at or change the text of one or more
strings.
-Optional parameters are enclosed in square brackets (``['' and ``]'').
+Optional parameters are enclosed in square brackets ([ and ]).
+Those functions that are
+specific to @command{gawk} are marked with a pound sign (@samp{#}):
+
+@menu
+* Gory Details:: More than you want to know about @samp{\} and
+ @samp{&} with @code{sub}, @code{gsub}, and
+ @code{gensub}.
+@end menu
@table @code
+@item asort(@var{source} @r{[}, @var{dest}@r{]}) #
+@cindex @code{asort} built-in function
+@code{asort} is a @command{gawk}-specific extension, returning the number of
+elements in the array @var{source}. The contents of @var{source} are
+sorted using @command{gawk}'s normal rules for comparing values, and the indices
+of the sorted values of @var{source} are replaced with sequential
+integers starting with one. If the optional array @var{dest} is specified,
+then @var{source} is duplicated into @var{dest}. @var{dest} is then
+sorted, leaving the indices of @var{source} unchanged.
+For example, if the contents of @code{a} are as follows:
+
+@example
+a["last"] = "de"
+a["first"] = "sac"
+a["middle"] = "cul"
+@end example
+
+@noindent
+A call to @code{asort}:
+
+@example
+asort(a)
+@end example
+
+@noindent
+results in the following contents of @code{a}:
+
+@example
+a[1] = "cul"
+a[2] = "de"
+a[3] = "sac"
+@end example
+
+@cindex differences between @command{gawk} and @command{awk}
+The @code{asort} function is described in more detail in
+@ref{Array Sorting, ,Sorting Array Values and Indices with @command{gawk}}.
+@code{asort} is a @command{gawk} extension; it is not available
+in compatibility mode (@pxref{Options, ,Command-Line Options}).
+
@item index(@var{in}, @var{find})
-@findex index
+@cindex @code{index} built-in function
This searches the string @var{in} for the first occurrence of the string
@var{find}, and returns the position in characters where that occurrence
-begins in the string @var{in}. For example:
+begins in the string @var{in}. Consider the following example:
@example
$ awk 'BEGIN @{ print index("peanut", "an") @}'
@@ -9763,14 +11503,14 @@ $ awk 'BEGIN @{ print index("peanut", "an") @}'
@noindent
If @var{find} is not found, @code{index} returns zero.
-(Remember that string indices in @code{awk} start at one.)
+(Remember that string indices in @command{awk} start at one.)
@item length(@r{[}@var{string}@r{]})
-@findex length
-This gives you the number of characters in @var{string}. If
+@cindex @code{length} built-in function
+This returns the number of characters in @var{string}. If
@var{string} is a number, the length of the digit string representing
-that number is returned. For example, @code{length("abcde")} is five. By
-contrast, @code{length(15 * 35)} works out to three. How? Well, 15 * 35 =
+that number is returned. For example, @code{length("abcde")} is 5. By
+contrast, @code{length(15 * 35)} works out to 3. In this example, 15 * 35 =
525, and 525 is then converted to the string @code{"525"}, which has
three characters.
@@ -9778,25 +11518,33 @@ If no argument is supplied, @code{length} returns the length of @code{$0}.
@cindex historical features
@cindex portability issues
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-In older versions of @code{awk}, you could call the @code{length} function
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+@strong{Note:}
+In older versions of @command{awk}, the @code{length} function could
+be called
without any parentheses. Doing so is marked as ``deprecated'' in the
-POSIX standard. This means that while you can do this in your
-programs, it is a feature that can eventually be removed from a future
-version of the standard. Therefore, for maximal portability of your
-@code{awk} programs, you should always supply the parentheses.
-
-@item match(@var{string}, @var{regexp})
-@findex match
-The @code{match} function searches the string, @var{string}, for the
-longest, leftmost substring matched by the regular expression,
-@var{regexp}. It returns the character position, or @dfn{index}, of
+POSIX standard. This means that while a program can do this,
+it is a feature that can eventually be removed from a future
+version of the standard. Therefore, for programs to be maximally portable,
+always supply the parentheses.
+
+@item match(@var{string}, @var{regexp} @r{[}, @var{array}@r{]})
+@cindex @code{match} built-in function
+The @code{match} function searches @var{string} for the
+longest leftmost substring matched by the regular expression,
+@var{regexp}. It returns the character position, or @dfn{index},
where that substring begins (one, if it starts at the beginning of
@var{string}). If no match is found, it returns zero.
-@vindex RSTART
-@vindex RLENGTH
+The order of the first two arguments is backwards from most other string
+functions that work with regular expressions, such as
+@code{sub} and @code{gsub}. It might help to remember that
+for @code{match}, the order is the same as for the @samp{~} operator:
+@samp{@var{string} ~ @var{regexp}}.
+
+@cindex @code{RSTART} variable
+@cindex @code{RLENGTH} variable
The @code{match} function sets the built-in variable @code{RSTART} to
the index. It also sets the built-in variable @code{RLENGTH} to the
length in characters of the matched substring. If no match is found,
@@ -9805,27 +11553,25 @@ length in characters of the matched substring. If no match is found,
For example:
@example
-@group
-@c file eg/misc/findpat.sh
-awk '@{
+@c file eg/misc/findpat.awk
+@{
if ($1 == "FIND")
regex = $2
else @{
where = match($0, regex)
if (where != 0)
- print "Match of", regex, "found at", \
+ print "Match of", regex, "found at",
where, "in", $0
@}
-@}'
+@}
@c endfile
-@end group
@end example
@noindent
This program looks for lines that match the regular expression stored in
the variable @code{regex}. This regular expression can be changed. If the
first word on a line is @samp{FIND}, @code{regex} is changed to be the
-second word on that line. Therefore, given:
+second word on that line. Therefore, if given:
@example
@c file eg/misc/findpat.data
@@ -9840,16 +11586,38 @@ Melvin was here.
@end example
@noindent
-@code{awk} prints:
+@command{awk} prints:
@example
Match of ru+n found at 12 in My program runs
Match of Melvin found at 1 in Melvin was here.
@end example
+@cindex differences between @command{gawk} and @command{awk}
+If @var{array} is present, it is cleared, and then the 0'th element
+of @var{array} is set to the entire portion of @var{string}
+matched by @var{regexp}. If @var{regexp} contains parentheses,
+the integer-indexed elements of @var{array} are set to contain the
+portion of @var{string} matching the corresponding parenthesized
+sub-expression.
+For example:
+
+@example
+$ echo foooobazbarrrrr |
+> gawk '@{ match($0, /(fo+).+(ba*r)/, arr)
+> print arr[1], arr[2] @}'
+@print{} foooo barrrrr
+@end example
+
+@cindex fatal errors
+The @var{array} argument to @code{match} is a
+@command{gawk} extension. In compatibility mode
+(@pxref{Options, ,Command-Line Options}),
+using a third argument is a fatal error.
+
@item split(@var{string}, @var{array} @r{[}, @var{fieldsep}@r{]})
-@findex split
-This divides @var{string} into pieces separated by @var{fieldsep},
+@cindex @code{split} built-in function
+This function divides @var{string} into pieces separated by @var{fieldsep},
and stores the pieces in @var{array}. The first piece is stored in
@code{@var{array}[1]}, the second piece in @code{@var{array}[2]}, and so
forth. The string value of the third argument, @var{fieldsep}, is
@@ -9857,6 +11625,8 @@ a regexp describing where to split @var{string} (much as @code{FS} can
be a regexp describing where to split input records). If
the @var{fieldsep} is omitted, the value of @code{FS} is used.
@code{split} returns the number of elements created.
+If @var{string} does not match @var{fieldsep}, @var{array} is empty
+and @code{split} returns zero.
The @code{split} function splits strings into pieces in a
manner similar to the way input lines are split into fields. For example:
@@ -9878,68 +11648,78 @@ a[3] = "sac"
@noindent
The value returned by this call to @code{split} is three.
+@cindex differences between @command{gawk} and @command{awk}
As with input field-splitting, when the value of @var{fieldsep} is
-@w{@code{" "}}, leading and trailing whitespace is ignored, and the elements
+@w{@code{" "}}, leading and trailing whitespace is ignored and the elements
are separated by runs of whitespace.
-
-@cindex differences between @code{gawk} and @code{awk}
Also as with input field-splitting, if @var{fieldsep} is the null string, each
individual character in the string is split into its own array element.
-(This is a @code{gawk}-specific extension.)
+(This is a @command{gawk}-specific extension.)
@cindex dark corner
-Recent implementations of @code{awk}, including @code{gawk}, allow
-the third argument to be a regexp constant (@code{/abc/}), as well as a
-string (d.c.). The POSIX standard allows this as well.
+Modern implementations of @command{awk}, including @command{gawk}, allow
+the third argument to be a regexp constant (@code{/abc/}) as well as a
+string.
+@value{DARKCORNER}
+The POSIX standard allows this as well.
Before splitting the string, @code{split} deletes any previously existing
-elements in the array @var{array} (d.c.).
-
-If @var{string} does not match @var{fieldsep} at all, @var{array} will have
-one element. The value of that element will be the original
-@var{string}.
+elements in the array @var{array}.
+If @var{string} does not match @var{fieldsep} at all, @var{array} has
+one element only. The value of that element is the original @var{string}.
-@item sprintf(@var{format}, @var{expression1},@dots{})
-@findex sprintf
+@item sprintf(@var{format}, @var{expression1}, @dots{})
+@cindex @code{sprintf} built-in function
This returns (without printing) the string that @code{printf} would
have printed out with the same arguments
(@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing}).
For example:
@example
-sprintf("pi = %.2f (approx.)", 22/7)
+pival = sprintf("pi = %.2f (approx.)", 22/7)
@end example
@noindent
-returns the string @w{@code{"pi = 3.14 (approx.)"}}.
+assigns the string @w{@code{"pi = 3.14 (approx.)"}} to the variable @code{pival}.
+
+@cindex @code{strtonum} built-in function
+@item strtonum(@var{str}) #
+Examines @var{str} and returns its numeric value. If @var{str}
+begins with a leading @samp{0}, @code{strtonum} assumes that @var{str}
+is an octal number. If @var{str} begins with a leading @samp{0x} or
+@samp{0X}, @code{strtonum} assumes that @var{str} is a hexadecimal number.
+For example:
-@ignore
-2e: For sub, gsub, and gensub, either here or in the "how much matches"
- section, we need some explanation that it is possible to match the
- null string when using closures like *. E.g.,
+@example
+$ echo 0x11 |
+> gawk '@{ printf "%d\n", strtonum($1) @}'
+@print{} 17
+@end example
- $ echo abc | awk '{ gsub(/m*/, "X"); print }'
- @print{} XaXbXcX
+Using the @code{strtonum} function is @emph{not} the same as adding zero
+to a string value; the automatic coercion of strings to numbers
+works only for decimal data, not for octal or hexadecimal.@footnote{Unless
+you use the @option{--non-decimal-data} option, which isn't recommended.
+@xref{Non-decimal Data, ,Allowing Non-Decimal Input Data}, for more information.}
- Although this makes a certain amount of sense, it can be very
- suprising.
-@end ignore
+@cindex differences between @command{gawk} and @command{awk}
+@code{strtonum} is a @command{gawk} extension; it is not available
+in compatibility mode (@pxref{Options, ,Command-Line Options}).
@item sub(@var{regexp}, @var{replacement} @r{[}, @var{target}@r{]})
-@findex sub
+@cindex @code{sub} built-in function
The @code{sub} function alters the value of @var{target}.
It searches this value, which is treated as a string, for the
-leftmost longest substring matched by the regular expression, @var{regexp},
-extending this match as far as possible. Then the entire string is
+leftmost longest substring matched by the regular expression @var{regexp}.
+Then the entire string is
changed by replacing the matched text with @var{replacement}.
The modified string becomes the new value of @var{target}.
This function is peculiar because @var{target} is not simply
-used to compute a value, and not just any expression will do: it
-must be a variable, field or array element, so that @code{sub} can
+used to compute a value, and not just any expression will do---it
+must be a variable, field, or array element so that @code{sub} can
store a modified value there. If this argument is omitted, then the
default is to use and alter @code{$0}.
-
For example:
@example
@@ -9949,7 +11729,7 @@ sub(/at/, "ith", str)
@noindent
sets @code{str} to @w{@code{"wither, water, everywhere"}}, by replacing the
-leftmost, longest occurrence of @samp{at} with @samp{ith}.
+leftmost longest occurrence of @samp{at} with @samp{ith}.
The @code{sub} function returns the number of substitutions made (either
one or zero).
@@ -9960,26 +11740,25 @@ the regexp can match more than one string, then this precise substring
may vary.) For example:
@example
-awk '@{ sub(/candidate/, "& and his wife"); print @}'
+@{ sub(/candidate/, "& and his wife"); print @}
@end example
@noindent
changes the first occurrence of @samp{candidate} to @samp{candidate
and his wife} on each input line.
-
Here is another example:
@example
-awk 'BEGIN @{
- str = "daabaaa"
- sub(/a+/, "C&C", str)
- print str
-@}'
+$ awk 'BEGIN @{
+> str = "daabaaa"
+> sub(/a+/, "C&C", str)
+> print str
+> @}'
@print{} dCaaCbaaa
@end example
@noindent
-This shows how @samp{&} can represent a non-constant string, and also
+This shows how @samp{&} can represent a non-constant string and also
illustrates the ``leftmost, longest'' rule in regexp matching
(@pxref{Leftmost Longest, ,How Much Text Matches?}).
@@ -9987,46 +11766,47 @@ The effect of this special character (@samp{&}) can be turned off by putting a
backslash before it in the string. As usual, to insert one backslash in
the string, you must write two backslashes. Therefore, write @samp{\\&}
in a string constant to include a literal @samp{&} in the replacement.
-For example, here is how to replace the first @samp{|} on each line with
+For example, following is shown how to replace the first @samp{|} on each line with
an @samp{&}:
@example
-awk '@{ sub(/\|/, "\\&"); print @}'
+@{ sub(/\|/, "\\&"); print @}
@end example
@cindex @code{sub}, third argument of
@cindex @code{gsub}, third argument of
-@strong{Note:} As mentioned above, the third argument to @code{sub} must
+As mentioned, the third argument to @code{sub} must
be a variable, field or array reference.
-Some versions of @code{awk} allow the third argument to
-be an expression which is not an lvalue. In such a case, @code{sub}
-would still search for the pattern and return zero or one, but the result of
-the substitution (if any) would be thrown away because there is no place
-to put it. Such versions of @code{awk} accept expressions like
-this:
+Some versions of @command{awk} allow the third argument to
+be an expression that is not an lvalue. In such a case, @code{sub}
+still searches for the pattern and returns zero or one, but the result of
+the substitution (if any) is thrown away because there is no place
+to put it. Such versions of @command{awk} accept expressions
+such as the following:
@example
sub(/USA/, "United States", "the USA and Canada")
@end example
@noindent
-For historical compatibility, @code{gawk} will accept erroneous code,
-such as in the above example. However, using any other non-changeable
-object as the third parameter will cause a fatal error, and your program
+@cindex fatal errors
+For historical compatibility, @command{gawk} accepts erroneous code,
+such as in the previous example. However, using any other non-changeable
+object as the third parameter causes a fatal error and your program
will not run.
Finally, if the @var{regexp} is not a regexp constant, it is converted into a
-string and then the value of that string is treated as the regexp to match.
+string, and then the value of that string is treated as the regexp to match.
@item gsub(@var{regexp}, @var{replacement} @r{[}, @var{target}@r{]})
-@findex gsub
+@cindex @code{gsub} built-in function
This is similar to the @code{sub} function, except @code{gsub} replaces
@emph{all} of the longest, leftmost, @emph{non-overlapping} matching
substrings it can find. The @samp{g} in @code{gsub} stands for
``global,'' which means replace everywhere. For example:
@example
-awk '@{ gsub(/Britain/, "United Kingdom"); print @}'
+@{ gsub(/Britain/, "United Kingdom"); print @}
@end example
@noindent
@@ -10034,35 +11814,31 @@ replaces all occurrences of the string @samp{Britain} with @samp{United
Kingdom} for all input records.
The @code{gsub} function returns the number of substitutions made. If
-the variable to be searched and altered, @var{target}, is
-omitted, then the entire input record, @code{$0}, is used.
-
+the variable to search and alter (@var{target}) is
+omitted, then the entire input record (@code{$0}) is used.
As in @code{sub}, the characters @samp{&} and @samp{\} are special,
-and the third argument must be an lvalue.
-@end table
+and the third argument must be assignable.
-@table @code
-@item gensub(@var{regexp}, @var{replacement}, @var{how} @r{[}, @var{target}@r{]})
-@findex gensub
+@item gensub(@var{regexp}, @var{replacement}, @var{how} @r{[}, @var{target}@r{]}) #
+@cindex @code{gensub} built-in function
@code{gensub} is a general substitution function. Like @code{sub} and
@code{gsub}, it searches the target string @var{target} for matches of
-the regular expression @var{regexp}. Unlike @code{sub} and
-@code{gsub}, the modified string is returned as the result of the
-function, and the original target string is @emph{not} changed. If
-@var{how} is a string beginning with @samp{g} or @samp{G}, then it
-replaces all matches of @var{regexp} with @var{replacement}.
-Otherwise, @var{how} is a number indicating which match of @var{regexp}
-to replace. If no @var{target} is supplied, @code{$0} is used instead.
+the regular expression @var{regexp}. Unlike @code{sub} and @code{gsub},
+the modified string is returned as the result of the function and the
+original target string is @emph{not} changed. If @var{how} is a string
+beginning with @samp{g} or @samp{G}, then it replaces all matches of
+@var{regexp} with @var{replacement}. Otherwise, @var{how} is treated
+as a number that indicates which match of @var{regexp} to replace. If
+no @var{target} is supplied, @code{$0} is used.
@code{gensub} provides an additional feature that is not available
-in @code{sub} or @code{gsub}: the ability to specify components of
-a regexp in the replacement text. This is done by using parentheses
-in the regexp to mark the components, and then specifying @samp{\@var{n}}
-in the replacement text, where @var{n} is a digit from one to nine.
+in @code{sub} or @code{gsub}: the ability to specify components of a
+regexp in the replacement text. This is done by using parentheses in
+the regexp to mark the components and then specifying @samp{\@var{N}}
+in the replacement text, where @var{N} is a digit from 1 to 9.
For example:
@example
-@group
$ gawk '
> BEGIN @{
> a = "abc def"
@@ -10070,18 +11846,17 @@ $ gawk '
> print b
> @}'
@print{} def abc
-@end group
@end example
@noindent
-As described above for @code{sub}, you must type two backslashes in order
+As with @code{sub}, you must type two backslashes in order
to get one into the string.
In the replacement text, the sequence @samp{\0} represents the entire
matched text, as does the character @samp{&}.
-This example shows how you can use the third argument to control
-which match of the regexp should be changed.
+The following example shows how you can use the third argument to control
+which match of the regexp should be changed:
@example
$ echo a b c a b c |
@@ -10093,23 +11868,27 @@ In this case, @code{$0} is used as the default target string.
@code{gensub} returns the new string as its result, which is
passed directly to @code{print} for printing.
+@cindex automatic warnings
+@cindex warnings, automatic
If the @var{how} argument is a string that does not begin with @samp{g} or
-@samp{G}, or if it is a number that is less than zero, only one
-substitution is performed.
+@samp{G}, or if it is a number that is less than or equal to zero, only one
+substitution is performed. If @var{how} is zero, @command{gawk} issues
+a warning message.
If @var{regexp} does not match @var{target}, @code{gensub}'s return value
-is the original, unchanged value of @var{target}.
+is the original unchanged value of @var{target}.
-@cindex differences between @code{gawk} and @code{awk}
-@code{gensub} is a @code{gawk} extension; it is not available
-in compatibility mode (@pxref{Options, ,Command Line Options}).
+@cindex differences between @command{gawk} and @command{awk}
+@code{gensub} is a @command{gawk} extension; it is not available
+in compatibility mode (@pxref{Options, ,Command-Line Options}).
@item substr(@var{string}, @var{start} @r{[}, @var{length}@r{]})
-@findex substr
+@cindex @code{substr} built-in function
This returns a @var{length}-character-long substring of @var{string},
starting at character number @var{start}. The first character of a
-string is character number one. For example,
-@code{substr("washington", 5, 3)} returns @code{"ing"}.
+string is character number one.@footnote{This is different from
+C and C++, where the first character is number zero.}
+For example, @code{substr("washington", 5, 3)} returns @code{"ing"}.
If @var{length} is not present, this function returns the whole suffix of
@var{string} that begins at character number @var{start}. For example,
@@ -10118,9 +11897,12 @@ suffix is also returned
if @var{length} is greater than the number of characters remaining
in the string, counting from character number @var{start}.
-@strong{Note:} The string returned by @code{substr} @emph{cannot} be
-assigned to. Thus, it is a mistake to attempt to change a portion of
-a string, like this:
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+The string returned by @code{substr} @emph{cannot} be
+assigned. Thus, it is a mistake to attempt to change a portion of
+a string, as shown in the following example:
@example
string = "abcdef"
@@ -10129,57 +11911,72 @@ substr(string, 3, 3) = "CDE"
@end example
@noindent
-or to use @code{substr} as the third agument of @code{sub} or @code{gsub}:
+It is also a mistake to use @code{substr} as the third argument
+of @code{sub} or @code{gsub}:
@example
gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG
@end example
+@cindex portability issues
+(Some commercial versions of @command{awk} do in fact let you use
+@code{substr} this way, but doing so is not portable.)
+
+If you need to replace bits and pieces of a string, combine @code{substr}
+with string concatenation, in the following manner:
+
+@example
+string = "abcdef"
+@dots{}
+string = substr(string, 1, 2) "CDE" substr(string, 6)
+@end example
+
@cindex case conversion
@cindex conversion of case
@item tolower(@var{string})
-@findex tolower
-This returns a copy of @var{string}, with each upper-case character
-in the string replaced with its corresponding lower-case character.
+@cindex @code{tolower} built-in function
+This returns a copy of @var{string}, with each uppercase character
+in the string replaced with its corresponding lowercase character.
Non-alphabetic characters are left unchanged. For example,
@code{tolower("MiXeD cAsE 123")} returns @code{"mixed case 123"}.
@item toupper(@var{string})
-@findex toupper
-This returns a copy of @var{string}, with each lower-case character
-in the string replaced with its corresponding upper-case character.
+@cindex @code{toupper} built-in function
+This returns a copy of @var{string}, with each lowercase character
+in the string replaced with its corresponding uppercase character.
Non-alphabetic characters are left unchanged. For example,
@code{toupper("MiXeD cAsE 123")} returns @code{"MIXED CASE 123"}.
@end table
-@c fakenode --- for prepinfo
-@subheading More About @samp{\} and @samp{&} with @code{sub}, @code{gsub} and @code{gensub}
+@node Gory Details, , String Functions, String Functions
+@subsubsection More About @samp{\} and @samp{&} with @code{sub}, @code{gsub}, and @code{gensub}
@cindex escape processing, @code{sub} et. al.
-When using @code{sub}, @code{gsub} or @code{gensub}, and trying to get literal
+@cindex @code{sub}, escape processing
+@cindex @code{gsub}, escape processing
+@cindex @code{gensub}, escape processing
+When using @code{sub}, @code{gsub}, or @code{gensub}, and trying to get literal
backslashes and ampersands into the replacement text, you need to remember
that there are several levels of @dfn{escape processing} going on.
-First, there is the @dfn{lexical} level, which is when @code{awk} reads
-your program, and builds an internal copy of your program that can
-be executed.
-
-Then there is the run-time level, when @code{awk} actually scans the
+First, there is the @dfn{lexical} level, which is when @command{awk} reads
+your program
+and builds an internal copy of it that can be executed.
+Then there is the runtime level, which is when @command{awk} actually scans the
replacement string to determine what to generate.
-At both levels, @code{awk} looks for a defined set of characters that
+At both levels, @command{awk} looks for a defined set of characters that
can come after a backslash. At the lexical level, it looks for the
escape sequences listed in @ref{Escape Sequences}.
-Thus, for every @samp{\} that @code{awk} will process at the run-time
-level, you type two @samp{\}s at the lexical level.
+Thus, for every @samp{\} that @command{awk} processes at the runtime
+level, type two backslashes at the lexical level.
When a character that is not valid for an escape sequence follows the
-@samp{\}, Unix @code{awk} and @code{gawk} both simply remove the initial
-@samp{\}, and put the following character into the string. Thus, for
+@samp{\}, Unix @command{awk} and @command{gawk} both simply remove the initial
+@samp{\} and put the next character into the string. Thus, for
example, @code{"a\qb"} is treated as @code{"aqb"}.
-At the run-time level, the various functions handle sequences of
+At the runtime level, the various functions handle sequences of
@samp{\} and @samp{&} differently. The situation is (sadly) somewhat complex.
-
Historically, the @code{sub} and @code{gsub} functions treated the two
character sequence @samp{\&} specially; this sequence was replaced in
the generated text with a single @samp{&}. Any other @samp{\} within
@@ -10206,7 +12003,7 @@ through unchanged. To illustrate with a table:
}
@bigskip}
@end tex
-@ifinfo
+@ifnottex
@display
You type @code{sub} sees @code{sub} generates
-------- ---------- ---------------
@@ -10218,25 +12015,24 @@ through unchanged. To illustrate with a table:
@code{\\\\\\&} @code{\\\&} a literal @samp{\\&}
@code{\\q} @code{\q} a literal @samp{\q}
@end display
-@end ifinfo
+@end ifnottex
@noindent
-This table shows both the lexical level processing, where
-an odd number of backslashes becomes an even number at the run time level,
-and the run-time processing done by @code{sub}.
+This table shows both the lexical-level processing, where
+an odd number of backslashes becomes an even number at the runtime level,
+as well as the runtime processing done by @code{sub}.
(For the sake of simplicity, the rest of the tables below only show the
-case of even numbers of @samp{\}s entered at the lexical level.)
+case of even numbers of backslashes entered at the lexical level.)
The problem with the historical approach is that there is no way to get
a literal @samp{\} followed by the matched text.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
The 1992 POSIX standard attempted to fix this problem. The standard
says that @code{sub} and @code{gsub} look for either a @samp{\} or an @samp{&}
after the @samp{\}. If either one follows a @samp{\}, that character is
-output literally. The interpretation of @samp{\} and @samp{&} then becomes
-like this:
+output literally. The interpretation of @samp{\} and @samp{&} then becomes:
@c thanks to Karl Berry for formatting this table
@tex
@@ -10255,7 +12051,7 @@ like this:
}
@bigskip}
@end tex
-@ifinfo
+@ifnottex
@display
You type @code{sub} sees @code{sub} generates
-------- ---------- ---------------
@@ -10264,34 +12060,32 @@ like this:
@code{\\\\&} @code{\\&} a literal @samp{\}, then the matched text
@code{\\\\\\&} @code{\\\&} a literal @samp{\&}
@end display
-@end ifinfo
+@end ifnottex
@noindent
-This would appear to solve the problem.
+This appears to solve the problem.
Unfortunately, the phrasing of the standard is unusual. It
says, in effect, that @samp{\} turns off the special meaning of any
-following character, but that for anything other than @samp{\} and @samp{&},
-such special meaning is undefined. This wording leads to two problems.
+following character, but for anything other than @samp{\} and @samp{&},
+such special meaning is undefined. This wording leads to two problems:
-@enumerate
+@itemize @bullet
@item
Backslashes must now be doubled in the @var{replacement} string, breaking
-historical @code{awk} programs.
+historical @command{awk} programs.
@item
-To make sure that an @code{awk} program is portable, @emph{every} character
+To make sure that an @command{awk} program is portable, @emph{every} character
in the @var{replacement} string must be preceded with a
backslash.@footnote{This consequence was certainly unintended.}
@c I can say that, 'cause I was involved in making this change
-@end enumerate
+@end itemize
-The POSIX standard is under revision.@footnote{As of @value{UPDATE-MONTH},
-with final approval and publication as part of the Austin Group
-Standards hopefully sometime in 2001.}
-Because of the above problems, proposed text for the revised standard
+The POSIX standard is under revision.
+Because of the problems just listed, proposed text for the revised standard
reverts to rules that correspond more closely to the original existing
practice. The proposed rules have special cases that make it possible
-to produce a @samp{\} preceding the matched text.
+to produce a @samp{\} preceding the matched text:
@tex
\vbox{\bigskip
@@ -10320,26 +12114,30 @@ to produce a @samp{\} preceding the matched text.
@end display
@end ifinfo
-In a nutshell, at the run-time level, there are now three special sequences
-of characters, @samp{\\\&}, @samp{\\&} and @samp{\&}, whereas historically,
+In a nutshell, at the runtime level, there are now three special sequences
+of characters (@samp{\\\&}, @samp{\\&} and @samp{\&}) whereas historically
there was only one. However, as in the historical case, any @samp{\} that
-is not part of one of these three sequences is not special, and appears
+is not part of one of these three sequences is not special and appears
in the output literally.
-@code{gawk} 3.0 follows these proposed POSIX rules for @code{sub} and
+@command{gawk} 3.0 and 3.1 follow these proposed POSIX rules for @code{sub} and
@code{gsub}.
@c As much as we think it's a lousy idea. You win some, you lose some. Sigh.
Whether these proposed rules will actually become codified into the
-standard is unknown at this point. Subsequent @code{gawk} releases will
+standard is unknown at this point. Subsequent @command{gawk} releases will
track the standard and implement whatever the final version specifies;
-this @value{DOCUMENT} will be updated as well.
-
-The rules for @code{gensub} are considerably simpler. At the run-time
-level, whenever @code{gawk} sees a @samp{\}, if the following character
+this @value{DOCUMENT} will be updated as
+well.@footnote{As this @value{DOCUMENT} was being finalized,
+we learned that the POSIX standard will not use these rules.
+However, it was too late to change @command{gawk} for the 3.1 release.
+@command{gawk} behaves as described here.}
+
+The rules for @code{gensub} are considerably simpler. At the runtime
+level, whenever @command{gawk} sees a @samp{\}, if the following character
is a digit, then the text that matched the corresponding parenthesized
subexpression is placed in the generated output. Otherwise,
-no matter what the character after the @samp{\} is, that character will
-appear in the generated text, and the @samp{\} will not.
+no matter what the character after the @samp{\} is, it
+appears in the generated text and the @samp{\} does not:
@tex
\vbox{\bigskip
@@ -10359,7 +12157,7 @@ appear in the generated text, and the @samp{\} will not.
}
@bigskip}
@end tex
-@ifinfo
+@ifnottex
@display
You type @code{gensub} sees @code{gensub} generates
-------- ------------- ------------------
@@ -10370,73 +12168,110 @@ appear in the generated text, and the @samp{\} will not.
@code{\\\\\\&} @code{\\\&} a literal @samp{\&}
@code{\\q} @code{\q} a literal @samp{q}
@end display
-@end ifinfo
+@end ifnottex
-Because of the complexity of the lexical and run-time level processing,
+Because of the complexity of the lexical and runtime level processing
and the special cases for @code{sub} and @code{gsub},
-we recommend the use of @code{gawk} and @code{gensub} for when you have
+we recommend the use of @command{gawk} and @code{gensub} when you have
to do substitutions.
+@c fakenode --- for prepinfo
+@subheading Advanced Notes: Matching the Null String
+@cindex advanced notes
+@cindex matching, the null string
+
+In @command{awk}, the @samp{*} operator can match the null string.
+This is particularly important for the @code{sub}, @code{gsub},
+and @code{gensub} functions. For example:
+
+@example
+$ echo abc | awk '@{ gsub(/m*/, "X"); print @}'
+@print{} XaXbXcX
+@end example
+
+@noindent
+Although this makes a certain amount of sense, it can be surprising.
+
@node I/O Functions, Time Functions, String Functions, Built-in
-@section Built-in Functions for Input/Output
+@subsection Input/Output Functions
-The following functions are related to Input/Output (I/O).
-Optional parameters are enclosed in square brackets (``['' and ``]'').
+The following functions relate to Input/Output (I/O).
+Optional parameters are enclosed in square brackets ([ and ]):
@table @code
-@item close(@var{filename})
-@findex close
-Close the file @var{filename}, for input or output. The argument may
-alternatively be a shell command that was used for redirecting to or
-from a pipe; then the pipe is closed.
-@xref{Close Files And Pipes, ,Closing Input and Output Files and Pipes},
+@item close(@var{filename} @r{[}, @var{how}@r{]})
+@cindex @code{close} built-in function
+Close the file @var{filename} for input or output. Alternatively, the
+argument may be a shell command that was used for creating a coprocess, or
+for redirecting to or from a pipe; then the coprocess or pipe is closed.
+@xref{Close Files And Pipes, ,Closing Input and Output Redirections},
for more information.
+When closing a coprocess, it is occasionally useful to first close
+one end of the two-way pipe, and then to close the other. This is done
+by providing a second argument to @code{close}. This second argument
+should be one of the two string values @code{"to"} or @code{"from"},
+indicating which end of the pipe to close. Case in the string does
+not matter.
+@xref{Two-way I/O, ,Two-Way Communications with Another Process},
+which discusses this feature in more detail and gives an example.
+
@item fflush(@r{[}@var{filename}@r{]})
-@findex fflush
+@cindex @code{fflush} built-in function
@cindex portability issues
@cindex flushing buffers
@cindex buffers, flushing
@cindex buffering output
@cindex output, buffering
-Flush any buffered output associated @var{filename}, which is either a
-file opened for writing, or a shell command for redirecting output to
-a pipe.
+Flush any buffered output associated with @var{filename}, which is either a
+file opened for writing or a shell command for redirecting output to
+a pipe or coprocess.
-Many utility programs will @dfn{buffer} their output; they save information
-to be written to a disk file or terminal in memory, until there is enough
-for it to be worthwhile to send the data to the ouput device.
+Many utility programs @dfn{buffer} their output; i.e., they save information
+to write to a disk file or terminal in memory, until there is enough
+for it to be worthwhile to send the data to the output device.
This is often more efficient than writing
every little bit of information as soon as it is ready. However, sometimes
it is necessary to force a program to @dfn{flush} its buffers; that is,
write the information to its destination, even if a buffer is not full.
-This is the purpose of the @code{fflush} function; @code{gawk} too
-buffers its output, and the @code{fflush} function can be used to force
-@code{gawk} to flush its buffers.
+This is the purpose of the @code{fflush} function---@command{gawk} also
+buffers its output and the @code{fflush} function forces
+@command{gawk} to flush its buffers.
-@code{fflush} is a recent (1994) addition to the Bell Labs research
-version of @code{awk}; it is not part of the POSIX standard, and will
-not be available if @samp{--posix} has been specified on the command
-line (@pxref{Options, ,Command Line Options}).
+@code{fflush} was added to the Bell Laboratories research
+version of @command{awk} in 1994; it is not part of the POSIX standard and is
+not available if @option{--posix} has been specified on the
+command line (@pxref{Options, ,Command-Line Options}).
-@code{gawk} extends the @code{fflush} function in two ways. The first
+@command{gawk} extends the @code{fflush} function in two ways. The first
is to allow no argument at all. In this case, the buffer for the
-standard output is flushed. The second way is to allow the null string
+standard output is flushed. The second is to allow the null string
(@w{@code{""}}) as the argument. In this case, the buffers for
@emph{all} open output files and pipes are flushed.
-@code{fflush} returns zero if the buffer was successfully flushed,
-and nonzero otherwise.
+@cindex automatic warnings
+@cindex warnings, automatic
+@code{fflush} returns zero if the buffer is successfully flushed;
+otherwise it returns @minus{}1.
+In the case where all buffers are flushed, the return value is zero
+only if all buffers were flushed successfully. Otherwise, it is
+@minus{}1, and @command{gawk} warns about the @var{filename} that had the problem.
+
+@command{gawk} also issues a warning message if you attempt to flush
+a file or pipe that was opened for reading (such as with @code{getline}),
+or if @var{filename} is not an open file, pipe, or coprocess.
+In such a case, @code{fflush} returns @minus{}1 as well.
@item system(@var{command})
-@findex system
-@cindex interaction, @code{awk} and other programs
-The @code{system} function allows the user to execute operating system commands
-and then return to the @code{awk} program. The @code{system} function
-executes the command given by the string @var{command}. It returns, as
-its value, the status returned by the command that was executed.
-
-For example, if the following fragment of code is put in your @code{awk}
+@cindex @code{system} built-in function
+@cindex interaction, @command{awk} and other programs
+The @code{system} function allows the user to execute operating system
+commands and then return to the @command{awk} program. The @code{system}
+function executes the command given by the string @var{command}.
+It returns the status returned by the command that was executed as
+its value.
+
+For example, if the following fragment of code is put in your @command{awk}
program:
@example
@@ -10446,12 +12281,12 @@ END @{
@end example
@noindent
-the system administrator will be sent mail when the @code{awk} program
+the system administrator is sent mail when the @command{awk} program
finishes processing input and begins its end-of-input processing.
Note that redirecting @code{print} or @code{printf} into a pipe is often
enough to accomplish your task. If you need to run many commands, it
-will be more efficient to simply print them to a pipe to the shell:
+is more efficient to simply print them down a pipeline to the shell:
@example
while (@var{more stuff to do})
@@ -10460,34 +12295,34 @@ close("/bin/sh")
@end example
@noindent
-However, if your @code{awk}
+@cindex fatal errors
+However, if your @command{awk}
program is interactive, @code{system} is useful for cranking up large
self-contained programs, such as a shell or an editor.
-
Some operating systems cannot implement the @code{system} function.
@code{system} causes a fatal error if it is not supported.
@end table
@c fakenode --- for prepinfo
-@subheading Interactive vs. Non-Interactive Buffering
+@subheading Advanced Notes: Interactive Versus Non-Interactive Buffering
+@cindex advanced notes
@cindex buffering, interactive vs. non-interactive
@cindex buffering, non-interactive vs. interactive
@cindex interactive buffering vs. non-interactive
@cindex non-interactive buffering vs. interactive
-As a side point, buffering issues can be even more confusing depending
-upon whether or not your program is @dfn{interactive}, i.e., communicating
+As a side point, buffering issues can be even more confusing, depending
+upon whether your program is @dfn{interactive}; i.e., communicating
with a user sitting at a keyboard.@footnote{A program is interactive
if the standard output is connected
to a terminal device.}
-Interactive programs generally @dfn{line buffer} their output; they
-write out every line. Non-interactive programs wait until they have
-a full buffer, which may be many lines of output.
-
@c Thanks to Walter.Mecky@dresdnerbank.de for this example, and for
@c motivating me to write this section.
-Here is an example of the difference.
+Interactive programs generally @dfn{line buffer} their output; i.e., they
+write out every line. Non-interactive programs wait until they have
+a full buffer, which may be many lines of output.
+Here is an example of the difference:
@example
$ awk '@{ print $1 + $2 @}'
@@ -10495,28 +12330,29 @@ $ awk '@{ print $1 + $2 @}'
@print{} 2
2 3
@print{} 5
-@kbd{Control-d}
+@kbd{Ctrl-d}
@end example
@noindent
Each line of output is printed immediately. Compare that behavior
-with this example.
+with this example:
@example
$ awk '@{ print $1 + $2 @}' | cat
1 1
2 3
-@kbd{Control-d}
+@kbd{Ctrl-d}
@print{} 2
@print{} 5
@end example
@noindent
-Here, no output is printed until after the @kbd{Control-d} is typed, since
-it is all buffered, and sent down the pipe to @code{cat} in one shot.
+Here, no output is printed until after the @kbd{Ctrl-d} is typed, because
+it is all buffered and sent down the pipe to @command{cat} in one shot.
@c fakenode --- for prepinfo
-@subheading Controlling Output Buffering with @code{system}
+@subheading Advanced Notes: Controlling Output Buffering with @code{system}
+@cindex advanced notes
@cindex flushing buffers
@cindex buffers, flushing
@cindex buffering output
@@ -10524,21 +12360,21 @@ it is all buffered, and sent down the pipe to @code{cat} in one shot.
The @code{fflush} function provides explicit control over output buffering for
individual files and pipes. However, its use is not portable to many other
-@code{awk} implementations. An alternative method to flush output
-buffers is by calling @code{system} with a null string as its argument:
+@command{awk} implementations. An alternative method to flush output
+buffers is to call @code{system} with a null string as its argument:
@example
system("") # flush output
@end example
@noindent
-@code{gawk} treats this use of the @code{system} function as a special
-case, and is smart enough not to run a shell (or other command
-interpreter) with the empty command. Therefore, with @code{gawk}, this
-idiom is not only useful, it is efficient. While this method should work
-with other @code{awk} implementations, it will not necessarily avoid
+@command{gawk} treats this use of the @code{system} function as a special
+case and is smart enough not to run a shell (or other command
+interpreter) with the empty command. Therefore, with @command{gawk}, this
+idiom is not only useful, it is also efficient. While this method should work
+with other @command{awk} implementations, it does not necessarily avoid
starting an unnecessary shell. (Other implementations may only
-flush the buffer associated with the standard output, and not necessarily
+flush the buffer associated with the standard output and not necessarily
all buffered output.)
If you think about what a programmer expects, it makes sense that
@@ -10553,7 +12389,7 @@ BEGIN @{
@end example
@noindent
-must print
+must print:
@example
first print
@@ -10562,7 +12398,7 @@ second print
@end example
@noindent
-and not
+and not:
@example
system echo
@@ -10570,67 +12406,114 @@ first print
second print
@end example
-If @code{awk} did not flush its buffers before calling @code{system}, the
-latter (undesirable) output is what you would see.
+If @command{awk} did not flush its buffers before calling @code{system}, the
+latter (undesirable) output is what you see.
-@node Time Functions, , I/O Functions, Built-in
-@section Functions for Dealing with Time Stamps
+@node Time Functions, Bitwise Functions, I/O Functions, Built-in
+@subsection Using @command{gawk}'s Timestamp Functions
@cindex timestamps
@cindex time of day
-A common use for @code{awk} programs is the processing of log files
-containing time stamp information, indicating when a
-particular log record was written. Many programs log their time stamp
+A common use for @command{awk} programs is the processing of log files
+containing timestamp information, indicating when a
+particular log record was written. Many programs log their timestamp
in the form returned by the @code{time} system call, which is the
-number of seconds since a particular epoch. On POSIX systems,
-it is the number of seconds since Midnight, January 1, 1970, UTC.
-
-In order to make it easier to process such log files, and to produce
-useful reports, @code{gawk} provides two functions for working with time
-stamps. Both of these are @code{gawk} extensions; they are not specified
-in the POSIX standard, nor are they in any other known version
-of @code{awk}.
-
-Optional parameters are enclosed in square brackets (``['' and ``]'').
+number of seconds since a particular epoch. On POSIX-compliant systems,
+it is the number of seconds since
+1970-01-01 00:00:00 UTC, not counting leap seconds.@footnote{@xref{Glossary},
+especially the entries for ``Epoch'' and ``UTC.''}
+All known POSIX-compliant systems support timestamps from 0 through
+@math{2^31 - 1}, which is sufficient to represent times through
+2038-01-19 03:14:07 UTC. Many systems support a wider range of timestamps,
+including negative timestamps that represent times before the
+epoch.
+
+In order to make it easier to process such log files and to produce
+useful reports, @command{gawk} provides the following functions for
+working with timestamps. They are @command{gawk} extensions; they are
+not specified in the POSIX standard, nor are they in any other known
+version of @command{awk}.@footnote{The GNU @command{date} utility can
+also do many of the things described here. It's use may be preferable
+for simple time-related operations in shell scripts.}
+Optional parameters are enclosed in square brackets ([ and ]):
@table @code
@item systime()
-@findex systime
+@cindex @code{systime} built-in function
This function returns the current time as the number of seconds since
the system epoch. On POSIX systems, this is the number of seconds
-since Midnight, January 1, 1970, UTC. It may be a different number on
+since 1970-01-01 00:00:00 UTC, not counting leap seconds.
+It may be a different number on
other systems.
+@item mktime(@var{datespec})
+@cindex @code{mktime} built-in function
+This function turns @var{datespec} into a timestamp in the same form
+as is returned by @code{systime}. It is similar to the function of the
+same name in ISO C. The argument, @var{datespec}, is a string of the form
+@w{@code{"@var{YYYY} @var{MM} @var{DD} @var{HH} @var{MM} @var{SS} [@var{DST}]"}}.
+The string consists of six or seven numbers representing, respectively,
+the full year including century, the month from 1 to 12, the day of the month
+from 1 to 31, the hour of the day from 0 to 23, the minute from 0 to
+59, the second from 0 to 60,@footnote{Occasionally there are
+minutes in a year with a leap second, which is why the
+seconds can go up to 60.}
+and an optional daylight savings flag.
+
+The values of these numbers need not be within the ranges specified;
+for example, an hour of @minus{}1 means 1 hour before midnight.
+The origin-zero Gregorian calendar is assumed, with year 0 preceding
+year 1 and year @minus{}1 preceding year 0.
+The time is assumed to be in the local timezone.
+If the daylight savings flag is positive, the time is assumed to be
+daylight savings time; if zero, the time is assumed to be standard
+time; and if negative (the default), @code{mktime} attempts to determine
+whether daylight savings time is in effect for the specified time.
+
+If @var{datespec} does not contain enough elements or if the resulting time
+is out of range, @code{mktime} returns @minus{}1.
+
@item strftime(@r{[}@var{format} @r{[}, @var{timestamp}@r{]]})
-@findex strftime
+@cindex @code{strftime} built-in function
This function returns a string. It is similar to the function of the
-same name in ANSI C. The time specified by @var{timestamp} is used to
+same name in ISO C. The time specified by @var{timestamp} is used to
produce a string, based on the contents of the @var{format} string.
The @var{timestamp} is in the same format as the value returned by the
@code{systime} function. If no @var{timestamp} argument is supplied,
-@code{gawk} will use the current time of day as the time stamp.
+@command{gawk} uses the current time of day as the timestamp.
If no @var{format} argument is supplied, @code{strftime} uses
@code{@w{"%a %b %d %H:%M:%S %Z %Y"}}. This format string produces
-output (almost) equivalent to that of the @code{date} utility.
-(Versions of @code{gawk} prior to 3.0 require the @var{format} argument.)
+output that is (almost) equivalent to that of the @command{date} utility.
+(Versions of @command{gawk} prior to 3.0 require the @var{format} argument.)
@end table
-The @code{systime} function allows you to compare a time stamp from a
+The @code{systime} function allows you to compare a timestamp from a
log file with the current time of day. In particular, it is easy to
determine how long ago a particular record was logged. It also allows
you to produce log records using the ``seconds since the epoch'' format.
-The @code{strftime} function allows you to easily turn a time stamp
+@cindex converting dates to timestamps
+@cindex dates, converting to timestamps
+@cindex timestamps, converting from dates
+The @code{mktime} function allows you to convert a textual representation
+of a date and time into a timestamp. This makes it easy to do before/after
+comparisons of dates and times, particularly when dealing with date and
+time data coming from an external source, such as a log file.
+
+The @code{strftime} function allows you to easily turn a timestamp
into human-readable information. It is similar in nature to the @code{sprintf}
function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}),
+(@pxref{String Functions, ,String Manipulation Functions}),
in that it copies non-format specification characters verbatim to the
returned string, while substituting date and time values for format
specifications in the @var{format} string.
-@code{strftime} is guaranteed by the ANSI C standard to support
-the following date format specifications:
+@code{strftime} is guaranteed by the 1999 ISO C standard@footnote{As this
+is a recent standard, not every system's @code{strftime} necessarily
+supports all of the conversions listed here.}
+to support the following date format specifications:
+@cindex format specifier, @code{strftime}
@table @code
@item %a
The locale's abbreviated weekday name.
@@ -10646,10 +12529,38 @@ The locale's full month name.
@item %c
The locale's ``appropriate'' date and time representation.
+(This is @samp{%A %B %d %T %Y} in the @code{"C"} locale.)
+
+@item %C
+The century. This is the year divided by 100 and truncated to the next
+lower integer.
@item %d
The day of the month as a decimal number (01--31).
+@item %D
+Equivalent to specifying @samp{%m/%d/%y}.
+
+@item %e
+The day of the month, padded with a space if it is only one digit.
+
+@item %F
+Equivalent to specifying @samp{%Y-%m-%d}.
+This is the ISO 8601 date format.
+
+@item %g
+The year modulo 100 of the ISO week number, as a decimal number (00--99).
+For example, January 1, 1993, is in week 53 of 1992. Thus, the year
+of its ISO week number is 1992, even though its year is 1993.
+Similarly, December 31, 1973, is in week 1 of 1974. Thus, the year
+of its ISO week number is 1974, even though its year is 1973.
+
+@item %G
+The full year of the ISO week number, as a decimal number.
+
+@item %h
+Equivalent to @samp{%b}.
+
@item %H
The hour (24-hour clock) as a decimal number (00--23).
@@ -10665,19 +12576,45 @@ The month as a decimal number (01--12).
@item %M
The minute as a decimal number (00--59).
+@item %n
+A newline character (ASCII LF).
+
@item %p
The locale's equivalent of the AM/PM designations associated
with a 12-hour clock.
+@item %r
+The locale's 12-hour clock time.
+(This is @samp{%I:%M:%S %p} in the @code{"C"} locale.)
+
+@item %R
+Equivalent to specifying @samp{%H:%M}.
+
@item %S
-The second as a decimal number (00--60).@footnote{Occasionally there are
-minutes in a year with a leap second, which is why the
-seconds can go up to 60.}
+The second as a decimal number (00--60).
+
+@item %t
+A tab character.
+
+@item %T
+Equivalent to specifying @samp{%H:%M:%S}.
+
+@item %u
+The weekday as a decimal number (1--7). Monday is day one.
@item %U
The week number of the year (the first Sunday as the first day of week one)
as a decimal number (00--53).
+@cindex ISO 8601
+@item %V
+The week number of the year (the first Monday as the first
+day of week one) as a decimal number (01--53).
+The method for determining the week number is as specified by ISO 8601.
+(To wit: if the week containing January 1 has four or more days in the
+new year, then it is week one, otherwise it is week 53 of the previous year
+and the next week is week one.)
+
@item %w
The weekday as a decimal number (0--6). Sunday is day zero.
@@ -10687,165 +12624,129 @@ as a decimal number (00--53).
@item %x
The locale's ``appropriate'' date representation.
+(This is @samp{%A %B %d %Y} in the @code{"C"} locale.)
@item %X
The locale's ``appropriate'' time representation.
+(This is @samp{%T} in the @code{"C"} locale.)
@item %y
-The year without century as a decimal number (00--99).
+The year modulo 100 as a decimal number (00--99).
@item %Y
-The year with century as a decimal number (e.g., 1995).
+The full year as a decimal number (e.g., 1995).
+
+@cindex RFC 822
+@cindex RFC 1036
+@item %z
+The timezone offset in a +HHMM format (e.g., the format necessary to
+produce RFC 822/RFC 1036 date headers).
@item %Z
-The time zone name or abbreviation, or no characters if
+The time zone name or abbreviation; no characters if
no time zone is determinable.
+@item %Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH
+@itemx %OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy
+These are ``alternate representations'' for the specifications
+that use only the second letter (@samp{%c}, @samp{%C},
+and so on).@footnote{If you don't understand any of this, don't worry about
+it; these facilities are meant to make it easier to ``internationalize''
+programs.
+Other internationalization features are described in
+@ref{Internationalization, ,Internationalization with @command{gawk}}.}
+(These facilitate compliance with the POSIX @command{date} utility.)
+
@item %%
A literal @samp{%}.
@end table
If a conversion specifier is not one of the above, the behavior is
-undefined.@footnote{This is because ANSI C leaves the
-behavior of the C version of @code{strftime} undefined, and @code{gawk}
-will use the system's version of @code{strftime} if it's there.
-Typically, the conversion specifier will either not appear in the
-returned string, or it will appear literally.}
+undefined.@footnote{This is because ISO C leaves the
+behavior of the C version of @code{strftime} undefined and @command{gawk}
+uses the system's version of @code{strftime} if it's there.
+Typically, the conversion specifier either does not appear in the
+returned string or it appears literally.}
@cindex locale, definition of
Informally, a @dfn{locale} is the geographic place in which a program
is meant to run. For example, a common way to abbreviate the date
-September 4, 1991 in the United States would be ``9/4/91''.
-In many countries in Europe, however, it would be abbreviated ``4.9.91''.
+September 4, 1991 in the United States is ``9/4/91.''
+In many countries in Europe, however, it is abbreviated ``4.9.91.''
Thus, the @samp{%x} specification in a @code{"US"} locale might produce
@samp{9/4/91}, while in a @code{"EUROPE"} locale, it might produce
-@samp{4.9.91}. The ANSI C standard defines a default @code{"C"}
+@samp{4.9.91}. The ISO C standard defines a default @code{"C"}
locale, which is an environment that is typical of what most C programmers
are used to.
-A public-domain C version of @code{strftime} is supplied with @code{gawk}
-for systems that are not yet fully ANSI-compliant. If that version is
-used to compile @code{gawk} (@pxref{Installation, ,Installing @code{gawk}}),
+A public-domain C version of @code{strftime} is supplied with @command{gawk}
+for systems that are not yet fully standards-compliant.
+It supports all of the just listed format specifications.
+If that version is
+used to compile @command{gawk} (@pxref{Installation, ,Installing @command{gawk}}),
then the following additional format specifications are available:
@table @code
-@item %D
-Equivalent to specifying @samp{%m/%d/%y}.
-
-@item %e
-The day of the month, padded with a space if it is only one digit.
-
-@item %h
-Equivalent to @samp{%b}, above.
-
-@item %n
-A newline character (ASCII LF).
-
-@item %r
-Equivalent to specifying @samp{%I:%M:%S %p}.
-
-@item %R
-Equivalent to specifying @samp{%H:%M}.
-
-@item %T
-Equivalent to specifying @samp{%H:%M:%S}.
-
-@item %t
-A tab character.
-
@item %k
-The hour (24-hour clock) as a decimal number (0-23).
+The hour (24-hour clock) as a decimal number (0--23).
Single digit numbers are padded with a space.
@item %l
-The hour (12-hour clock) as a decimal number (1-12).
+The hour (12-hour clock) as a decimal number (1--12).
Single digit numbers are padded with a space.
-@item %C
-The century, as a number between 00 and 99.
-
-@item %u
-The weekday as a decimal number
-[1 (Monday)--7].
-
-@cindex ISO 8601
-@item %V
-The week number of the year (the first Monday as the first
-day of week one) as a decimal number (01--53).
-The method for determining the week number is as specified by ISO 8601
-(to wit: if the week containing January 1 has four or more days in the
-new year, then it is week one, otherwise it is week 53 of the previous year
-and the next week is week one).
-
-@item %G
-The year with century of the ISO week number, as a decimal number.
-
-For example, January 1, 1993, is in week 53 of 1992. Thus, the year
-of its ISO week number is 1992, even though its year is 1993.
-Similarly, December 31, 1973, is in week 1 of 1974. Thus, the year
-of its ISO week number is 1974, even though its year is 1973.
+@item %N
+The ``Emperor/Era'' name.
+Equivalent to @code{%C}.
-@item %g
-The year without century of the ISO week number, as a decimal number (00--99).
+@item %o
+The ``Emperor/Era'' year.
+Equivalent to @code{%y}.
-@item %Ec %EC %Ex %Ey %EY %Od %Oe %OH %OI
-@itemx %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy
-These are ``alternate representations'' for the specifications
-that use only the second letter (@samp{%c}, @samp{%C}, and so on).
-They are recognized, but their normal representations are
-used.@footnote{If you don't understand any of this, don't worry about
-it; these facilities are meant to make it easier to ``internationalize''
-programs.}
-(These facilitate compliance with the POSIX @code{date} utility.)
+@item %s
+The time as a decimal timestamp in seconds since the epoch.
@item %v
-The date in VMS format (e.g., 20-JUN-1991).
-
-@cindex RFC-822
-@cindex RFC-1036
-@item %z
-The timezone offset in a +HHMM format (e.g., the format necessary to
-produce RFC-822/RFC-1036 date headers).
+The date in VMS format (e.g., @samp{20-JUN-1991}).
@end table
-This example is an @code{awk} implementation of the POSIX
-@code{date} utility. Normally, the @code{date} utility prints the
-current date and time of day in a well known format. However, if you
-provide an argument to it that begins with a @samp{+}, @code{date}
-will copy non-format specifier characters to the standard output, and
-will interpret the current time according to the format specifiers in
+Additionally, the alternate representations are recognized but their
+normal representations are used.
+
+This example is an @command{awk} implementation of the POSIX
+@command{date} utility. Normally, the @command{date} utility prints the
+current date and time of day in a well-known format. However, if you
+provide an argument to it that begins with a @samp{+}, @command{date}
+copies non-format specifier characters to the standard output and
+interprets the current time according to the format specifiers in
the string. For example:
@example
$ date '+Today is %A, %B %d, %Y.'
-@print{} Today is Thursday, July 11, 1991.
+@print{} Today is Thursday, September 14, 2000.
@end example
-Here is the @code{gawk} version of the @code{date} utility.
-It has a shell ``wrapper'', to handle the @samp{-u} option,
-which requires that @code{date} run as if the time zone
-was set to UTC.
+Here is the @command{gawk} version of the @command{date} utility.
+It has a shell ``wrapper'' to handle the @option{-u} option,
+which requires that @command{date} run as if the time zone
+is set to UTC:
@example
-@group
#! /bin/sh
#
# date --- approximate the P1003.2 'date' command
case $1 in
--u) TZ=GMT0 # use UTC
+-u) TZ=UTC0 # use UTC
export TZ
shift ;;
esac
-@end group
-@group
+@c FIXME: One day, change %d to %e, when C 99 is common.
gawk 'BEGIN @{
format = "%a %b %d %H:%M:%S %Z %Y"
exitval = 0
-@end group
-@group
if (ARGC > 2)
exitval = 1
else if (ARGC == 2) @{
@@ -10856,18 +12757,291 @@ gawk 'BEGIN @{
print strftime(format)
exit exitval
@}' "$@@"
-@end group
@end example
-@node User-defined, Invoking Gawk, Built-in, Top
-@chapter User-defined Functions
+@node Bitwise Functions, I18N Functions, Time Functions, Built-in
+@subsection Using @command{gawk}'s Bit Manipulation Functions
+@cindex bitwise operations
+@quotation
+@i{I can explain it for you, but I can't understand it for you.}@*
+Anonymous
+@end quotation
+
+@cindex AND bitwise operation
+@cindex OR bitwise operation
+@cindex XOR bitwise operation
+Many languages provide the ability to perform @dfn{bitwise} operations
+on two integer numbers. In other words, the operation is performed on
+each successive pair of bits in the operands.
+Three common operations are bitwise AND, OR, and XOR.
+The operations are described by the following table:
+
+@ifnottex
+@display
+ Bit Operator
+ | AND | OR | XOR
+ |---+---+---+---+---+---
+Operands | 0 | 1 | 0 | 1 | 0 | 1
+----------+---+---+---+---+---+---
+ 0 | 0 0 | 0 1 | 0 1
+ 1 | 0 1 | 1 1 | 1 0
+@end display
+@end ifnottex
+@tex
+\centerline{
+\vbox{\bigskip % space above the table (about 1 linespace)
+% Because we have vertical rules, we can't let TeX insert interline space
+% in its usual way.
+\offinterlineskip
+\halign{\strut\hfil#\quad\hfil % operands
+ &\vrule#&\quad#\quad % rule, 0 (of and)
+ &\vrule#&\quad#\quad % rule, 1 (of and)
+ &\vrule# % rule between and and or
+ &\quad#\quad % 0 (of or)
+ &\vrule#&\quad#\quad % rule, 1 (of of)
+ &\vrule# % rule between or and xor
+ &\quad#\quad % 0 of xor
+ &\vrule#&\quad#\quad % rule, 1 of xor
+ \cr
+&\omit&\multispan{11}\hfil\bf Bit operator\hfil\cr
+\noalign{\smallskip}
+& &\multispan3\hfil AND\hfil&&\multispan3\hfil OR\hfil
+ &&\multispan3\hfil XOR\hfil\cr
+\bf Operands&&0&&1&&0&&1&&0&&1\cr
+\noalign{\hrule}
+\omit&height 2pt&&\omit&&&&\omit&&&&\omit\cr
+\noalign{\hrule height0pt}% without this the rule does not extend; why?
+0&&0&\omit&0&&0&\omit&1&&0&\omit&1\cr
+1&&0&\omit&1&&1&\omit&1&&1&\omit&0\cr
+}}}
+@end tex
+
+@cindex bitwise complement
+@cindex complement, bitwise
+As you can see, the result of an AND operation is 1 only when @emph{both}
+bits are 1.
+The result of an OR operation is 1 if @emph{either} bit is 1.
+The result of an XOR operation is 1 if either bit is 1,
+but not both.
+The next operation is the @dfn{complement}; the complement of 1 is 0 and
+the complement of 0 is 1. Thus, this operation ``flips'' all the bits
+of a given value.
+
+@cindex bitwise shift
+@cindex left shift, bitwise
+@cindex right shift, bitwise
+@cindex shift, bitwise
+Finally, two other common operations are to shift the bits left or right.
+For example, if you have a bit string @samp{10111001} and you shift it
+right by three bits, you end up with @samp{00010111}.@footnote{This example
+shows that 0's come in on the left side. For @command{gawk}, this is
+always true, but in some languages, it's possible to have the left side
+fill with 1's. Caveat emptor.}
+@c Purposely decided to use 0's and 1's here. 2/2001.
+If you start over
+again with @samp{10111001} and shift it left by three bits, you end up
+with @samp{11001000}.
+@command{gawk} provides built-in functions that implement the
+bitwise operations just described. They are:
+
+@ignore
+@table @code
+@cindex @code{and} built-in function
+@item and(@var{v1}, @var{v2})
+Return the bitwise AND of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{or} built-in function
+@item or(@var{v1}, @var{v2})
+Return the bitwise OR of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{xor} built-in function
+@item xor(@var{v1}, @var{v2})
+Return the bitwise XOR of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{compl} built-in function
+@item compl(@var{val})
+Return the bitwise complement of @var{val}.
+
+@cindex @code{lshift} built-in function
+@item lshift(@var{val}, @var{count})
+Return the value of @var{val}, shifted left by @var{count} bits.
+
+@cindex @code{rshift} built-in function
+@item rshift(@var{val}, @var{count})
+Return the value of @var{val}, shifted right by @var{count} bits.
+@end table
+@end ignore
+
+@multitable {@code{rshift(@var{val}, @var{count})}} {Return the value of @var{val}, shifted right by @var{count} bits.}
+@cindex @code{and} built-in function
+@item @code{and(@var{v1}, @var{v2})}
+@tab Return the bitwise AND of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{or} built-in function
+@item @code{or(@var{v1}, @var{v2})}
+@tab Return the bitwise OR of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{xor} built-in function
+@item @code{xor(@var{v1}, @var{v2})}
+@tab Return the bitwise XOR of the values provided by @var{v1} and @var{v2}.
+
+@cindex @code{compl} built-in function
+@item @code{compl(@var{val})}
+@tab Return the bitwise complement of @var{val}.
+
+@cindex @code{lshift} built-in function
+@item @code{lshift(@var{val}, @var{count})}
+@tab Return the value of @var{val}, shifted left by @var{count} bits.
+
+@cindex @code{rshift} built-in function
+@item @code{rshift(@var{val}, @var{count})}
+@tab Return the value of @var{val}, shifted right by @var{count} bits.
+@end multitable
+
+For all of these functions, first the double-precision floating-point value is
+converted to a C @code{unsigned long}, then the bitwise operation is
+performed and then the result is converted back into a C @code{double}. (If
+you don't understand this paragraph, don't worry about it.)
+
+Here is a user-defined function
+(@pxref{User-defined, ,User-Defined Functions})
+that illustrates the use of these functions:
+
+@cindex @code{bits2str} user-defined function
+@cindex @code{testbits.awk} program
+@smallexample
+@group
+@c file eg/lib/bits2str.awk
+# bits2str --- turn a byte into readable 1's and 0's
+
+function bits2str(bits, data, mask)
+@{
+ if (bits == 0)
+ return "0"
+
+ mask = 1
+ for (; bits != 0; bits = rshift(bits, 1))
+ data = (and(bits, mask) ? "1" : "0") data
+
+ while ((length(data) % 8) != 0)
+ data = "0" data
+
+ return data
+@}
+@c endfile
+@end group
+
+@c this is a hack to make testbits.awk self-contained
+@ignore
+@c file eg/prog/testbits.awk
+# bits2str --- turn a byte into readable 1's and 0's
+
+function bits2str(bits, data, mask)
+@{
+ if (bits == 0)
+ return "0"
+
+ mask = 1
+ for (; bits != 0; bits = rshift(bits, 1))
+ data = (and(bits, mask) ? "1" : "0") data
+
+ while ((length(data) % 8) != 0)
+ data = "0" data
+
+ return data
+@}
+@c endfile
+@end ignore
+@c file eg/prog/testbits.awk
+BEGIN @{
+ printf "123 = %s\n", bits2str(123)
+ printf "0123 = %s\n", bits2str(0123)
+ printf "0x99 = %s\n", bits2str(0x99)
+ comp = compl(0x99)
+ printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp)
+ shift = lshift(0x99, 2)
+ printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
+ shift = rshift(0x99, 2)
+ printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
+@}
+@c endfile
+@end smallexample
+
+@noindent
+This program produces the following output when run:
+
+@smallexample
+$ gawk -f testbits.awk
+@print{} 123 = 01111011
+@print{} 0123 = 01010011
+@print{} 0x99 = 10011001
+@print{} compl(0x99) = 0xffffff66 = 11111111111111111111111101100110
+@print{} lshift(0x99, 2) = 0x264 = 0000001001100100
+@print{} rshift(0x99, 2) = 0x26 = 00100110
+@end smallexample
+
+The @code{bits2str} function turns a binary number into a string.
+The number @code{1} represents a binary value where the rightmost bit
+is set to 1. Using this mask,
+the function repeatedly checks the rightmost bit.
+AND-ing the mask with the value indicates whether the
+rightmost bit is 1 or not. If so, a @code{"1"} is concatenated onto the front
+of the string.
+Otherwise, a @code{"0"} is added.
+The value is then shifted right by one bit and the loop continues
+until there are no more 1 bits.
+
+If the initial value is zero it returns a simple @code{"0"}.
+Otherwise, at the end, it pads the value with zeros to represent multiples
+of eight-bit quantities. This is typical in modern computers.
+
+The main code in the @code{BEGIN} rule shows the difference between the
+decimal and octal values for the same numbers
+(@pxref{Non-decimal-numbers, ,Octal and Hexadecimal Numbers}),
+and then demonstrates the
+results of the @code{compl}, @code{lshift}, and @code{rshift} functions.
+
+@node I18N Functions, , Bitwise Functions, Built-in
+@subsection Using @command{gawk}'s String Translation Functions
+
+@command{gawk} provides facilities for internationalizing @command{awk} programs.
+These include the functions described in the following list.
+The description here is purposely brief.
+@xref{Internationalization, ,Internationalization with @command{gawk}},
+for the full story.
+Optional parameters are enclosed in square brackets ([ and ]):
+
+@table @code
+@cindex @code{dcgettext} built-in function
+@item dcgettext(@var{string} @r{[}, @var{domain} @r{[}, @var{category}@r{]]})
+This function returns the translation of @var{string} in
+text domain @var{domain} for locale category @var{category}.
+The default value for @var{domain} is the current value of @code{TEXTDOMAIN}.
+The default value for @var{category} is @code{"LC_MESSAGES"}.
+
+@cindex @code{bindtextdomain} built-in function
+@item bindtextdomain(@var{directory} @r{[}, @var{domain}@r{]})
+This function allows you to specify the directory where
+@command{gawk} will look for message translation files, in case they
+will not or cannot be placed in the ``standard'' locations
+(e.g., during testing).
+It returns the directory where @var{domain} is ``bound.''
+
+The default @var{domain} is the value of @code{TEXTDOMAIN}.
+If @var{directory} is the null string (@code{""}), then
+@code{bindtextdomain} returns the current binding for the
+given @var{domain}.
+@end table
+
+@node User-defined, , Built-in, Functions
+@section User-Defined Functions
@cindex user-defined functions
-@cindex functions, user-defined
-Complicated @code{awk} programs can often be simplified by defining
+@cindex function, user-defined
+Complicated @command{awk} programs can often be simplified by defining
your own functions. User-defined functions can be called just like
built-in ones (@pxref{Function Calls}), but it is up to you to define
-them---to tell @code{awk} what they should do.
+them; i.e., to tell @command{awk} what they should do.
@menu
* Definition Syntax:: How to write definitions and what they mean.
@@ -10875,22 +13049,24 @@ them---to tell @code{awk} what they should do.
does.
* Function Caveats:: Things to watch out for.
* Return Statement:: Specifying the value a function returns.
+* Dynamic Typing:: How variable types can change at runtime.
@end menu
@node Definition Syntax, Function Example, User-defined, User-defined
-@section Function Definition Syntax
+@subsection Function Definition Syntax
@cindex defining functions
@cindex function definition
Definitions of functions can appear anywhere between the rules of an
-@code{awk} program. Thus, the general form of an @code{awk} program is
+@command{awk} program. Thus, the general form of an @command{awk} program is
extended to include sequences of rules @emph{and} user-defined function
definitions.
-There is no need in @code{awk} to put the definition of a function
-before all uses of the function. This is because @code{awk} reads the
+There is no need to put the definition of a function
+before all uses of the function. This is because @command{awk} reads the
entire program before starting to execute any of it.
The definition of a function named @var{name} looks like this:
+@c NEXT ED: put [ ] around parameter list
@example
function @var{name}(@var{parameter-list})
@@ -10900,31 +13076,33 @@ function @var{name}(@var{parameter-list})
@end example
@cindex names, use of
-@cindex namespaces
+@cindex namespace issues in @command{awk}
@noindent
-@var{name} is the name of the function to be defined. A valid function
-name is like a valid variable name: a sequence of letters, digits and
-underscores, not starting with a digit.
-Within a single @code{awk} program, any particular name can only be
-used as a variable, array or function.
+@var{name} is the name of the function to define. A valid function
+name is like a valid variable name: a sequence of letters, digits, and
+underscores, that doesn't start with a digit.
+Within a single @command{awk} program, any particular name can only be
+used as a variable, array, or function.
+@c NEXT ED: parameter-list is an OPTIONAL list of ...
@var{parameter-list} is a list of the function's arguments and local
variable names, separated by commas. When the function is called,
the argument names are used to hold the argument values given in
the call. The local variables are initialized to the empty string.
-A function cannot have two parameters with the same name.
+A function cannot have two parameters with the same name, nor may it
+have a parameter with the same name as the function itself.
-The @var{body-of-function} consists of @code{awk} statements. It is the
+The @var{body-of-function} consists of @command{awk} statements. It is the
most important part of the definition, because it says what the function
should actually @emph{do}. The argument names exist to give the body a
-way to talk about the arguments; local variables, to give the body
+way to talk about the arguments; local variables exist to give the body
places to keep temporary values.
Argument names are not distinguished syntactically from local variable
-names; instead, the number of arguments supplied when the function is
+names. Instead, the number of arguments supplied when the function is
called determines how many argument variables there are. Thus, if three
argument values are given, the first three names in @var{parameter-list}
-are arguments, and the rest are local variables.
+are arguments and the rest are local variables.
It follows that if the number of arguments is not the same in all calls
to the function, some of the names in @var{parameter-list} may be
@@ -10932,10 +13110,12 @@ arguments on some occasions and local variables on others. Another
way to think of this is that omitted arguments default to the
null string.
-Usually when you write a function you know how many names you intend to
+@cindex conventions, programming
+@cindex programming conventions
+Usually when you write a function, you know how many names you intend to
use for arguments and how many you intend to use as local variables. It is
conventional to place some extra space between the arguments and
-the local variables, to document how your function is supposed to be used.
+the local variables, in order to document how your function is supposed to be used.
@cindex variable shadowing
During execution of the function body, the arguments and local variable
@@ -10943,7 +13123,7 @@ values hide or @dfn{shadow} any variables of the same names used in the
rest of the program. The shadowed variables are not accessible in the
function definition, because there is no way to name them while their
names have been taken away for the local variables. All other variables
-used in the @code{awk} program can be referenced or set normally in the
+used in the @command{awk} program can be referenced or set normally in the
function's body.
The arguments and local variables last only as long as the function body
@@ -10952,19 +13132,20 @@ variables that were shadowed while the function was running.
@cindex recursive function
@cindex function, recursive
-The function body can contain expressions which call functions. They
+The function body can contain expressions that call functions. They
can even call this function, either directly or by way of another
function. When this happens, we say the function is @dfn{recursive}.
+The act of a function calling itself is called @dfn{recursion}.
-@cindex @code{awk} language, POSIX version
-@cindex POSIX @code{awk}
-In many @code{awk} implementations, including @code{gawk},
+@cindex @command{awk} language, POSIX version
+@cindex POSIX @command{awk}
+In many @command{awk} implementations, including @command{gawk},
the keyword @code{function} may be
abbreviated @code{func}. However, POSIX only specifies the use of
the keyword @code{function}. This actually has some practical implications.
-If @code{gawk} is in POSIX-compatibility mode
-(@pxref{Options, ,Command Line Options}), then the following
-statement will @emph{not} define a function:
+If @command{gawk} is in POSIX-compatibility mode
+(@pxref{Options, ,Command-Line Options}), then the following
+statement does @emph{not} define a function:
@example
func foo() @{ a = sqrt($1) ; print a @}
@@ -10974,19 +13155,20 @@ func foo() @{ a = sqrt($1) ; print a @}
Instead it defines a rule that, for each record, concatenates the value
of the variable @samp{func} with the return value of the function @samp{foo}.
If the resulting string is non-null, the action is executed.
-This is probably not what was desired. (@code{awk} accepts this input as
-syntactically valid, since functions may be used before they are defined
-in @code{awk} programs.)
+This is probably not what is desired. (@command{awk} accepts this input as
+syntactically valid, because functions may be used before they are defined
+in @command{awk} programs.)
+@c NEXT ED: This won't actually run, since foo() is undefined ...
@cindex portability issues
-To ensure that your @code{awk} programs are portable, always use the
+To ensure that your @command{awk} programs are portable, always use the
keyword @code{function} when defining a function.
@node Function Example, Function Caveats, Definition Syntax, User-defined
-@section Function Definition Examples
+@subsection Function Definition Examples
Here is an example of a user-defined function, called @code{myprint}, that
-takes a number and prints it in a specific format.
+takes a number and prints it in a specific format:
@example
function myprint(num)
@@ -10996,7 +13178,7 @@ function myprint(num)
@end example
@noindent
-To illustrate, here is an @code{awk} rule which uses our @code{myprint}
+To illustrate, here is an @command{awk} rule that uses our @code{myprint}
function:
@example
@@ -11005,14 +13187,12 @@ $3 > 0 @{ myprint($3) @}
@noindent
This program prints, in our special format, all the third fields that
-contain a positive number in our input. Therefore, when given:
+contain a positive number in our input. Therefore, when given the following:
@example
-@group
1.2 3.4 5.6 7.8
9.10 11.12 -13.14 15.16
17.18 19.20 21.22 23.24
-@end group
@end example
@noindent
@@ -11023,7 +13203,8 @@ this program, using our function to format the results, prints:
21.2
@end example
-This function deletes all the elements in an array.
+@page
+This function deletes all the elements in an array:
@example
function delarray(a, i)
@@ -11037,13 +13218,16 @@ When working with arrays, it is often necessary to delete all the elements
in an array and start over with a new list of elements
(@pxref{Delete, ,The @code{delete} Statement}).
Instead of having
-to repeat this loop everywhere in your program that you need to clear out
+to repeat this loop everywhere that you need to clear out
an array, your program can just call @code{delarray}.
-(This guarantees portability. The usage @samp{delete @var{array}} to delete
+(This guarantees portability. The use of @samp{delete @var{array}} to delete
the contents of an entire array is a non-standard extension.)
-Here is an example of a recursive function. It takes a string
-as an input parameter, and returns the string in backwards order.
+The following is an example of a recursive function. It takes a string
+as an input parameter and returns the string in backwards order.
+Recursive functions must always have a test that stops the recursion.
+In this case, the recursion terminates when the starting position
+is zero; i.e., when there are no more characters left in the string.
@example
function rev(str, start)
@@ -11055,7 +13239,7 @@ function rev(str, start)
@}
@end example
-If this function is in a file named @file{rev.awk}, we can test it
+If this function is in a file named @file{rev.awk}, it can be tested
this way:
@example
@@ -11064,19 +13248,19 @@ $ echo "Don't Panic!" |
@print{} !cinaP t'noD
@end example
-Here is an example that uses the built-in function @code{strftime}.
-(@xref{Time Functions, ,Functions for Dealing with Time Stamps},
-for more information on @code{strftime}.)
The C @code{ctime} function takes a timestamp and returns it in a string,
-formatted in a well known fashion. Here is an @code{awk} version:
+formatted in a well-known fashion.
+The following example uses the built-in @code{strftime} function
+(@pxref{Time Functions, ,Using @command{gawk}'s Timestamp Functions})
+to create an @command{awk} version of @code{ctime}:
+@c FIXME: One day, change %d to %e, when C 99 is common.
@example
@c file eg/lib/ctime.awk
# ctime.awk
#
# awk version of C ctime(3) function
-@group
function ctime(ts, format)
@{
format = "%a %b %d %H:%M:%S %Z %Y"
@@ -11085,23 +13269,20 @@ function ctime(ts, format)
return strftime(format, ts)
@}
@c endfile
-@end group
@end example
@node Function Caveats, Return Statement, Function Example, User-defined
-@section Calling User-defined Functions
+@subsection Calling User-Defined Functions
-@cindex call by value
-@cindex call by reference
@cindex calling a function
@cindex function call
@dfn{Calling a function} means causing the function to run and do its job.
-A function call is an expression, and its value is the value returned by
+A function call is an expression and its value is the value returned by
the function.
A function call consists of the function name followed by the arguments
-in parentheses. What you write in the call for the arguments are
-@code{awk} expressions; each time the call is executed, these
+in parentheses. @command{awk} expressions are what you write in the
+call for the arguments. Each time the call is executed, these
expressions are evaluated, and the values are the actual arguments. For
example, here is a call to @code{foo} with three arguments (the first
being a string concatenation):
@@ -11110,9 +13291,9 @@ being a string concatenation):
foo(x y, "lose", 4 * z)
@end example
-@strong{Caution:} whitespace characters (spaces and tabs) are not allowed
+@strong{Caution:} Whitespace characters (spaces and tabs) are not allowed
between the function name and the open-parenthesis of the argument list.
-If you write whitespace by mistake, @code{awk} might think that you mean
+If you write whitespace by mistake, @command{awk} might think that you mean
to concatenate a variable with an expression in parentheses. However, it
notices that you used a function name and not a variable name, and reports
an error.
@@ -11121,8 +13302,8 @@ an error.
When a function is called, it is given a @emph{copy} of the values of
its arguments. This is known as @dfn{call by value}. The caller may use
a variable as the expression for the argument, but the called function
-does not know this: it only knows what value the argument had. For
-example, if you write this code:
+does not know this---it only knows what value the argument had. For
+example, if you write the following code:
@example
foo = "bar"
@@ -11132,27 +13313,24 @@ z = myfunc(foo)
@noindent
then you should not think of the argument to @code{myfunc} as being
``the variable @code{foo}.'' Instead, think of the argument as the
-string value, @code{"bar"}.
-
+string value @code{"bar"}.
If the function @code{myfunc} alters the values of its local variables,
this has no effect on any other variables. Thus, if @code{myfunc}
does this:
@example
-@group
function myfunc(str)
@{
print str
str = "zzz"
print str
@}
-@end group
@end example
@noindent
-to change its first argument variable @code{str}, this @emph{does not}
+to change its first argument variable @code{str}, it @emph{does not}
change the value of @code{foo} in the caller. The role of @code{foo} in
-calling @code{myfunc} ended when its value, @code{"bar"}, was computed.
+calling @code{myfunc} ended when its value (@code{"bar"}) was computed.
If @code{str} also exists outside of @code{myfunc}, the function body
cannot alter this outer value, because it is shadowed during the
execution of @code{myfunc} and cannot be seen or changed from there.
@@ -11162,23 +13340,17 @@ However, when arrays are the parameters to functions, they are @emph{not}
copied. Instead, the array itself is made available for direct manipulation
by the function. This is usually called @dfn{call by reference}.
Changes made to an array parameter inside the body of a function @emph{are}
-visible outside that function.
-@ifinfo
-This can be @strong{very} dangerous if you do not watch what you are
-doing. For example:
-@end ifinfo
-@iftex
-@emph{This can be very dangerous if you do not watch what you are
-doing.} For example:
-@end iftex
+visible outside that function.
+
+@strong{Note:} Changing an array parameter inside a function
+can be very dangerous if you do not watch what you are doing.
+For example:
@example
-@group
function changeit(array, ind, nvalue)
@{
array[ind] = nvalue
@}
-@end group
BEGIN @{
a[1] = 1; a[2] = 2; a[3] = 3
@@ -11194,12 +13366,11 @@ This program prints @samp{a[1] = 1, a[2] = two, a[3] = 3}, because
@cindex undefined functions
@cindex functions, undefined
-Some @code{awk} implementations allow you to call a function that
-has not been defined, and only report a problem at run-time when the
+Some @command{awk} implementations allow you to call a function that
+has not been defined. They only report a problem at runtime when the
program actually tries to call the function. For example:
@example
-@group
BEGIN @{
if (0)
foo()
@@ -11208,36 +13379,32 @@ BEGIN @{
@}
function bar() @{ @dots{} @}
# note that `foo' is not defined
-@end group
@end example
@noindent
-Since the @samp{if} statement will never be true, it is not really a
+Because the @samp{if} statement will never be true, it is not really a
problem that @code{foo} has not been defined. Usually though, it is a
problem if a program calls an undefined function.
-@ignore
-At one point, I had gawk dieing on this, but later decided that this might
-break old programs and/or test suites.
-@end ignore
-
-If @samp{--lint} has been specified
-(@pxref{Options, ,Command Line Options}),
-@code{gawk} will report about calls to undefined functions.
+@cindex lint checks
+If @option{--lint} is specified
+(@pxref{Options, ,Command-Line Options}),
+@command{gawk} reports calls to undefined functions.
-Some @code{awk} implementations generate a run-time
+@cindex portability issues
+Some @command{awk} implementations generate a runtime
error if you use the @code{next} statement
(@pxref{Next Statement, , The @code{next} Statement})
inside a user-defined function.
-@code{gawk} does not have this problem.
+@command{gawk} does not have this limitation.
-@node Return Statement, , Function Caveats, User-defined
-@section The @code{return} Statement
+@node Return Statement, Dynamic Typing, Function Caveats, User-defined
+@subsection The @code{return} Statement
@cindex @code{return} statement
The body of a user-defined function can contain a @code{return} statement.
-This statement returns control to the rest of the @code{awk} program. It
-can also be used to return a value for use in the rest of the @code{awk}
+This statement returns control to the calling part of the @command{awk} program. It
+can also be used to return a value for use in the rest of the @command{awk}
program. It looks like this:
@example
@@ -11245,24 +13412,23 @@ return @r{[}@var{expression}@r{]}
@end example
The @var{expression} part is optional. If it is omitted, then the returned
-value is undefined and, therefore, unpredictable.
+value is undefined, and therefore, unpredictable.
A @code{return} statement with no value expression is assumed at the end of
every function definition. So if control reaches the end of the function
-body, then the function returns an unpredictable value. @code{awk}
-will @emph{not} warn you if you use the return value of such a function.
+body, then the function returns an unpredictable value. @command{awk}
+does @emph{not} warn you if you use the return value of such a function.
Sometimes, you want to write a function for what it does, not for
what it returns. Such a function corresponds to a @code{void} function
in C or to a @code{procedure} in Pascal. Thus, it may be appropriate to not
-return any value; you should simply bear in mind that if you use the return
+return any value; simply bear in mind that if you use the return
value of such a function, you do so at your own risk.
-Here is an example of a user-defined function that returns a value
+The following is an example of a user-defined function that returns a value
for the largest number among the elements of an array:
@example
-@group
function maxelt(vec, i, ret)
@{
for (i in vec) @{
@@ -11271,9 +13437,10 @@ function maxelt(vec, i, ret)
@}
return ret
@}
-@end group
@end example
+@cindex conventions, programming
+@cindex programming conventions
@noindent
You call @code{maxelt} with one argument, which is an array name. The local
variables @code{i} and @code{ret} are not intended to be arguments;
@@ -11283,13 +13450,11 @@ to @code{maxelt}, the results would be strange. The extra space before
@code{ret} are not supposed to be arguments. This is a convention that
you should follow when you define functions.
-Here is a program that uses our @code{maxelt} function. It loads an
+The following program uses the @code{maxelt} function. It loads an
array, calls @code{maxelt}, and then reports the maximum number in that
array:
@example
-@group
-awk '
function maxelt(vec, i, ret)
@{
for (i in vec) @{
@@ -11298,9 +13463,7 @@ function maxelt(vec, i, ret)
@}
return ret
@}
-@end group
-@group
# Load all fields of each record into nums.
@{
for(i = 1; i <= NF; i++)
@@ -11309,203 +13472,1660 @@ function maxelt(vec, i, ret)
END @{
print maxelt(nums)
-@}'
-@end group
+@}
@end example
Given the following input:
@example
-@group
1 5 23 8 16
44 3 5 2 8 26
256 291 1396 2962 100
-6 467 998 1101
99385 11 0 225
+@end example
+
+@noindent
+the program reports (predictably) that @code{99385} is the largest number
+in the array.
+
+@node Dynamic Typing, , Return Statement, User-defined
+@subsection Functions and Their Effect on Variable Typing
+
+@command{awk} is a very fluid language.
+It is possible that @command{awk} can't tell if an identifier
+represents a regular variable or an array until runtime.
+Here is an annotated sample program:
+
+@example
+function foo(a)
+@{
+ a[1] = 1 # parameter is an array
+@}
+
+BEGIN @{
+ b = 1
+ foo(b) # invalid: fatal type mismatch
+
+ foo(x) # x uninitialized, becomes an array dynamically
+ x = 1 # now not allowed, runtime error
+@}
+@end example
+
+Usually, such things aren't a big issue, but it's worth
+being aware of them.
+
+@node Internationalization, Advanced Features, Functions, Top
+@chapter Internationalization with @command{gawk}
+
+Once upon a time, computer makers
+wrote software that only worked in English.
+Eventually, hardware and software vendors noticed that if their
+systems worked in the native languages of non-English-speaking
+countries, they were able to sell more systems.
+As a result, internationalization and localization
+of programs and software systems became a common practice.
+
+@cindex internationalization features in @command{gawk}
+Until recently, the ability to provide internationalization
+was largely restricted to programs written in C and C++.
+This @value{CHAPTER} describes the underlying library @command{gawk}
+uses for internationalization, as well as how
+@command{gawk} makes internationalization
+features available at the @command{awk} program level.
+Having internationalization available at the @command{awk} level
+gives software developers additional flexibility---they are no
+longer required to write in C when internationalization is
+a requirement.
+
+@menu
+* I18N and L10N:: Internationalization and Localization.
+* Explaining gettext:: How GNU @code{gettext} works.
+* Programmer i18n:: Features for the programmer.
+* Translator i18n:: Features for the translator.
+* I18N Example:: A simple i18n example.
+* Gawk I18N:: @command{gawk} is also internationalized.
+@end menu
+
+@node I18N and L10N, Explaining gettext, Internationalization, Internationalization
+@section Internationalization and Localization
+
+@cindex internationalization
+@cindex localization
+@dfn{Internationalization} means writing (or modifying) a program once,
+in such a way that it can use multiple languages without requiring
+further source code changes.
+@dfn{Localization} means providing the data necessary for an
+internationalized program to work in a particular language.
+Most typically, these terms refer to features such as the language
+used for printing error messages, the language used to read
+responses, and information related to how numerical and
+monetary values are printed and read.
+
+@node Explaining gettext, Programmer i18n, I18N and L10N, Internationalization
+@section GNU @code{gettext}
+
+@cindex @code{gettext}, how it works
+@cindex internationalizing a program
+The facilities in GNU @code{gettext} focus on messages; strings printed
+by a program, either directly or via formatting with @code{printf} or
+@code{sprintf}.@footnote{For some operating systems, the @command{gawk}
+port doesn't support GNU @code{gettext}. This applies most notably to
+the PC operating systems. As such, these features are not available
+if you are using one of those operating systems. Sorry.}
+
+When using GNU @code{gettext}, each application has its own
+@dfn{text domain}. This is a unique name such as @samp{kpilot} or @samp{gawk},
+that identifies the application.
+A complete application may have multiple components---programs written
+in C or C++, as well as scripts written in @command{sh} or @command{awk}.
+All of the components use the same text domain.
+
+To make the discussion concrete, assume we're writing an application
+named @command{guide}. Internationalization consists of the
+following steps, in this order:
+
+@enumerate
+@item
+The programmer goes
+through the source for all of @command{guide}'s components
+and marks each string that is a candidate for translation.
+For example, @code{"`-F': option required"} is a good candidate for translation.
+A table with strings of option names is not (e.g., @command{gawk}'s
+@option{--profile} option should remain the same, no matter what the local
+language).
+
+@cindex @code{textdomain} C library function
+@item
+The programmer indicates the application's text domain
+(@code{"guide"}) to the @code{gettext} library,
+by calling the @code{textdomain} function.
+
+@item
+Messages from the application are extracted from the source code and
+collected into a Portable Object file (@file{guide.po}),
+which lists the strings and their translations.
+The translations are initially empty.
+The original (usually English) messages serve as the key for
+lookup of the translations.
+
+@cindex portable object files (@code{gettext})
+@item
+For each language with a translator, @file{guide.po}
+is copied and translations are created and shipped with the application.
+
+@cindex message object files (@code{gettext})
+@item
+Each language's @file{.po} file is converted into a binary
+message object (@file{.mo}) file.
+A message object file contains the original messages and their
+translations in a binary format that allows fast lookup of translations
+at runtime.
+
+@item
+When @command{guide} is built and installed, the binary translation files
+are installed in a standard place.
+
+@cindex @code{bindtextdomain} C library function
+@item
+For testing and development, it is possible to tell @code{gettext}
+to use @file{.mo} files in a different directory than the standard
+one by using the @code{bindtextdomain} function.
+
+@item
+At runtime, @command{guide} looks up each string via a call
+to @code{gettext}. The returned string is the translated string
+if available, or the original string if not.
+
+@item
+If necessary, it is possible to access messages from a different
+text domain than the one belonging to the application, without
+having to switch the application's default text domain back
+and forth.
+@end enumerate
+
+@cindex @code{gettext} C library function
+In C (or C++), the string marking and dynamic translation lookup
+are accomplished by wrapping each string in a call to @code{gettext}:
+
+@example
+printf(gettext("Don't Panic!\n"));
+@end example
+
+The tools that extract messages from source code pull out all
+strings enclosed in calls to @code{gettext}.
+
+@cindex @code{_} C macro (@code{gettext})
+The GNU @code{gettext} developers, recognizing that typing
+@samp{gettext} over and over again is both painful and ugly to look
+at, use the macro @samp{_} (an underscore) to make things easier:
+
+@example
+/* In the standard header file: */
+#define _(str) gettext(str)
+
+/* In the program text: */
+printf(_("Don't Panic!\n"));
+@end example
+
+@cindex locale categories
+@noindent
+This reduces the typing overhead to just three extra characters per string
+and is considerably easier to read as well.
+There are locale @dfn{categories}
+for different types of locale-related information.
+The defined locale categories that @code{gettext} knows about are:
+
+@table @code
+@cindex @code{LC_MESSAGES} locale category
+@item LC_MESSAGES
+Text messages. This is the default category for @code{gettext}
+operations, but it is possible to supply a different one explicitly,
+if necessary. (It is almost never necessary to supply a different category.)
+
+@cindex @code{LC_COLLATE} locale category
+@item LC_COLLATE
+Text collation information; i.e., how different characters
+and/or groups of characters sort in a given language.
+
+@cindex @code{LC_CTYPE} locale category
+@item LC_CTYPE
+Character type information (alphabetic, digit, upper- or lowercase, and
+so on).
+This information is accessed via the
+POSIX character classes in regular expressions,
+such as @code{/[[:alnum:]]/}
+(@pxref{Regexp Operators, ,Regular Expression Operators}).
+
+@cindex @code{LC_MONETARY} locale category
+@item LC_MONETARY
+Monetary information, such as the currency symbol, and whether the
+symbol goes before or after a number.
+
+@cindex @code{LC_NUMERIC} locale category
+@item LC_NUMERIC
+Numeric information, such as which characters to use for the decimal
+point and the thousands separator.@footnote{Americans
+use a comma every three decimal places and a period for the decimal
+point, while many Europeans do exactly the opposite:
+@code{1,234.56} vs.@: @code{1.234,56}.}
+
+@cindex @code{LC_RESPONSE} locale category
+@item LC_RESPONSE
+Response information, such as how ``yes'' and ``no'' appear in the
+local language, and possibly other information as well.
+
+@cindex @code{LC_TIME} locale category
+@item LC_TIME
+Time and date related information, such as 12- or 24-hour clock, month printed
+before or after day in a date, local month abbreviations, and so on.
+
+@cindex @code{LC_ALL} locale category
+@item LC_ALL
+All of the above. (Not too useful in the context of @code{gettext}.)
+@end table
+
+@node Programmer i18n, Translator i18n, Explaining gettext, Internationalization
+@section Internationalizing @command{awk} Programs
+
+@command{gawk} provides the following variables and functions for
+internationalization:
+
+@table @code
+@cindex @code{TEXTDOMAIN} variable
+@item TEXTDOMAIN
+This variable indicates the application's text domain.
+For compatibility with GNU @code{gettext}, the default
+value is @code{"messages"}.
+
+@cindex internationalization, marked strings
+@cindex marked strings for internationalization
+@item _"your message here"
+String constants marked with a leading underscore
+are candidates for translation at runtime.
+String constants without a leading underscore are not translated.
+
+@cindex @code{dcgettext} built-in function
+@item dcgettext(@var{string} @r{[}, @var{domain} @r{[}, @var{category}@r{]]})
+This built-in function returns the translation of @var{string} in
+text domain @var{domain} for locale category @var{category}.
+The default value for @var{domain} is the current value of @code{TEXTDOMAIN}.
+The default value for @var{category} is @code{"LC_MESSAGES"}.
+
+If you supply a value for @var{category}, it must be a string equal to
+one of the known locale categories described in
+@ifnotinfo
+the previous @value{SECTION}.
+@end ifnotinfo
+@ifinfo
+@ref{Explaining gettext, ,GNU @code{gettext}}.
+@end ifinfo
+You must also supply a text domain. Use @code{TEXTDOMAIN} if
+you want to use the current domain.
+
+@strong{Caution:} The order of arguments to the @command{awk} version
+of the @code{dcgettext} function is purposely different from the order for
+the C version. The @command{awk} version's order was
+chosen to be simple and to allow for reasonable @command{awk}-style
+default arguments.
+
+@cindex @code{bindtextdomain} built-in function
+@item bindtextdomain(@var{directory} @r{[}, @var{domain}@r{]})
+This built-in function allows you to specify the directory where
+@code{gettext} looks for @file{.mo} files, in case they
+will not or cannot be placed in the standard locations
+(e.g., during testing).
+It returns the directory where @var{domain} is ``bound.''
+
+The default @var{domain} is the value of @code{TEXTDOMAIN}.
+If @var{directory} is the null string (@code{""}), then
+@code{bindtextdomain} returns the current binding for the
+given @var{domain}.
+@end table
+
+To use these facilities in your @command{awk} program, follow the steps
+outlined in
+@ifnotinfo
+the previous @value{SECTION},
+@end ifnotinfo
+@ifinfo
+@ref{Explaining gettext, ,GNU @code{gettext}},
+@end ifinfo
+like so:
+
+@enumerate
+@item
+Set the variable @code{TEXTDOMAIN} to the text domain of
+your program. This is best done in a @code{BEGIN} rule
+(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}),
+or it can also be done via the @option{-v} command-line
+option (@pxref{Options, ,Command-Line Options}):
+
+@example
+BEGIN @{
+ TEXTDOMAIN = "guide"
+ @dots{}
+@}
+@end example
+
+@item
+Mark all translatable strings with a leading underscore (@samp{_})
+character. It @emph{must} be adjacent to the opening
+quote of the string. For example:
+
+@example
+print _"hello, world"
+x = _"you goofed"
+printf(_"Number of users is %d\n", nusers)
+@end example
+
+@item
+If you are creating strings dynamically, you can
+still translate them, using the @code{dcgettext}
+built-in function.
+
+@example
+message = nusers " users logged in"
+message = dcgettext(message, "adminprog")
+print message
+@end example
+
+Here, the call to @code{dcgettext} supplies a different
+text domain (@code{"adminprog"}) in which to find the
+message, but it uses the default @code{"LC_MESSAGES"} category.
+
+@item
+During development, you might want to put the @file{.mo}
+file in a private directory for testing. This is done
+with the @code{bindtextdomain} built-in function:
+
+@example
+BEGIN @{
+ TEXTDOMAIN = "guide" # our text domain
+ if (Testing) @{
+ # where to find our files
+ bindtextdomain("testdir")
+ # joe is in charge of adminprog
+ bindtextdomain("../joe/testdir", "adminprog")
+ @}
+ @dots{}
+@}
+@end example
+
+@end enumerate
+
+@xref{I18N Example, ,A Simple Internationalization Example},
+for an example program showing the steps necessary to create
+and use translations from @command{awk}.
+
+@node Translator i18n, I18N Example, Programmer i18n, Internationalization
+@section Translating @command{awk} Programs
+
+Once a program's translatable strings have been marked, they must
+be extracted to create the initial @file{.po} file.
+As part of translation, it is often helpful to rearrange the order
+in which arguments to @code{printf} are output.
+
+@command{gawk}'s @option{--gen-po} command-line option extracts
+the messages and is discussed next.
+After that, @code{printf}'s ability to
+rearrange the order for @code{printf} arguments at runtime
+is covered.
+
+@menu
+* String Extraction:: Extracting marked strings.
+* Printf Ordering:: Rearranging @code{printf} arguments.
+* I18N Portability:: @command{awk}-level portability issues.
+@end menu
+
+@node String Extraction, Printf Ordering, Translator i18n, Translator i18n
+@subsection Extracting Marked Strings
+@cindex string extraction (internationalization)
+@cindex marked string extraction (internationalization)
+@cindex extraction, of marked strings (internationalization)
+
+@cindex @code{--gen-po} option
+@cindex command-line option, @code{--gen-po}
+Once your @command{awk} program is working, and all the strings have
+been marked and you've set (and perhaps bound) the text domain,
+it is time to produce translations.
+First, use the @option{--gen-po} command-line option to create
+the initial @file{.po} file:
+
+@example
+$ gawk --gen-po -f guide.awk > guide.po
+@end example
+
+@cindex @code{xgettext} utility
+When run with @option{--gen-po}, @command{gawk} does not execute your
+program. Instead, it parses it as usual and prints all marked strings
+to standard output in the format of a GNU @code{gettext} Portable Object
+file. Also included in the output are any constant strings that
+appear as the first argument to @code{dcgettext}.@footnote{Eventually,
+the @command{xgettext} utility that comes with GNU @code{gettext} will be
+taught to automatically run @samp{gawk --gen-po} for @file{.awk} files,
+freeing the translator from having to do it manually.}
+@xref{I18N Example, ,A Simple Internationalization Example},
+for the full list of steps to go through to create and test
+translations for @command{guide}.
+
+@node Printf Ordering, I18N Portability, String Extraction, Translator i18n
+@subsection Rearranging @code{printf} Arguments
+
+@cindex @code{printf}, positional specifier
+@cindex positional specifier, @code{printf}
+Format strings for @code{printf} and @code{sprintf}
+(@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing})
+present a special problem for translation.
+Consider the following:@footnote{This example is borrowed
+from the GNU @code{gettext} manual.}
+
+@c line broken here only for smallbook format
+@example
+printf(_"String `%s' has %d characters\n",
+ string, length(string)))
+@end example
+
+A possible German translation for this might be:
+
+@example
+"%d Zeichen lang ist die Zeichenkette `%s'\n"
+@end example
+
+The problem should be obvious: the order of the format
+specifications is different from the original!
+Even though @code{gettext} can return the translated string
+at runtime,
+it cannot change the argument order in the call to @code{printf}.
+
+To solve this problem, @code{printf} format specificiers may have
+an additional optional element, which we call a @dfn{positional specifier}.
+For example:
+
+@example
+"%2$d Zeichen lang ist die Zeichenkette `%1$s'\n"
+@end example
+
+Here, the positional specifier consists of an integer count, which indicates which
+argument to use, and a @samp{$}. Counts are one-based, and the
+format string itself is @emph{not} included. Thus, in the following
+example, @samp{string} is the first argument and @samp{length(string)} is the second.
+
+@example
+$ gawk 'BEGIN @{
+> string = "Dont Panic"
+> printf _"%2$d characters live in \"%1$s\"\n",
+> string, length(string)
+> @}'
+@print{} 10 characters live in "Dont Panic"
+@end example
+
+If present, positional specifiers come first in the format specification,
+before the flags, the field width, and/or the precision.
+
+Positional specifiers can be used with the dynamic field width and
+precision capability:
+
+@example
+$ gawk 'BEGIN @{
+> printf("%*.*s\n", 10, 20, "hello")
+> printf("%3$*2$.*1$s\n", 20, 10, "hello")
+> @}'
+@print{} hello
+@print{} hello
+@end example
+
+@noindent
+@strong{Note:} When using @samp{*} with a positional specifier, the @samp{*}
+comes first, then the integer position, and then the @samp{$}.
+This is somewhat counter-intutive.
+
+@cindex @code{printf}, mixing positional specifiers with regular formats
+@cindex positional specifiers, mixing with regular formats (@code{printf})
+@cindex format specifiers, mixing regular with positional specifiers (@code{printf})
+@command{gawk} does not allow you to mix regular format specifiers
+and those with positional specifiers in the same string:
+
+@smallexample
+$ gawk 'BEGIN @{ printf _"%d %3$s\n", 1, 2, "hi" @}'
+@error{} gawk: cmd. line:1: fatal: must use `count$' on all formats or none
+@end smallexample
+
+@strong{Note:} There are some pathological cases that @command{gawk} may fail to
+diagnose. In such cases, the output may not be what you expect.
+It's still a bad idea to try mixing them, even if @command{gawk}
+doesn't detect it.
+
+Although positional specifiers can be used directly in @command{awk} programs,
+their primary purpose is to help in producing correct translations of
+format strings into languages different from the one in which the program
+is first written.
+
+@node I18N Portability, , Printf Ordering, Translator i18n
+@subsection @command{awk} Portability Issues
+
+@cindex portability issues
+@cindex portability issues, internationalization of @command{awk} programs
+@cindex internationalization of @command{awk} programs, portability issues
+@command{gawk}'s internationalization features were purposely chosen to
+have as little impact as possible on the portability of @command{awk}
+programs that use them to other versions of @command{awk}.
+Consider this program:
+
+@example
+BEGIN @{
+ TEXTDOMAIN = "guide"
+ if (Test_Guide) # set with -v
+ bindtextdomain("/test/guide/messages")
+ print _"don't panic!"
+@}
+@end example
+
+@noindent
+As written, it won't work on other versions of @command{awk}.
+However, it is actually almost portable, requiring very little
+change.
+
+@itemize @bullet
+@item
+Assignments to @code{TEXTDOMAIN} won't have any effect,
+since @code{TEXTDOMAIN} is not special in other @command{awk} implementations.
+
+@item
+Non-GNU versions of @command{awk} treat marked strings
+as the concatenation of a variable named @code{_} with the string
+following it.@footnote{This is good fodder for an ``Obfuscated
+@command{awk}'' contest.} Typically, the variable @code{_} has
+the null string (@code{""}) as its value, leaving the original string constant as
+the result.
+
+@item
+By defining ``dummy'' functions to replace @code{dcgettext}
+and @code{bindtextdomain}, the @command{awk} program can be made to run, but
+all the messages are output in the original language.
+For example:
+
+@cindex @code{bindtextdomain} user-defined function
+@cindex @code{dcgettext} user-defined function
+@example
+@c file eg/lib/libintl.awk
+function bindtextdomain(dir, domain)
+@{
+ return dir
+@}
+
+function dcgettext(string, domain, category)
+@{
+ return string
+@}
+@c endfile
+@end example
+
+@item
+The use of positional specifications in @code{printf} or
+@code{sprintf} is @emph{not} portable.
+To support @code{gettext} at the C level, many systems' C versions of
+@code{sprintf} do support positional specifiers. But it works only if
+enough arguments are supplied in the function call. Many versions of
+@command{awk} pass @code{printf} formats and arguments unchanged to the
+underlying C library version of @code{sprintf}, but only one format and
+argument at a time. What happens if a positional specification is
+used is anybody's guess.
+However, since the positional specifications are primarily for use in
+@emph{translated} format strings, and since non-GNU @command{awk}s never
+retrieve the translated string, this should not be a problem in practice.
+@end itemize
+
+@node I18N Example, Gawk I18N, Translator i18n, Internationalization
+@section A Simple Internationalization Example
+
+Now let's look at a step-by-step example of how to internationalize and
+localize a simple @command{awk} program, using @file{guide.awk} as our
+original source:
+
+@example
+@c file eg/prog/guide.awk
+BEGIN @{
+ TEXTDOMAIN = "guide"
+ bindtextdomain(".") # for testing
+ print _"Don't Panic"
+ print _"The Answer Is", 42
+ print "Pardon me, Zaphod who?"
+@}
+@c endfile
+@end example
+
+@noindent
+Run @samp{gawk --gen-po} to create the @file{.po} file:
+
+@example
+$ gawk --gen-po -f guide.awk > guide.po
+@end example
+
+@noindent
+This produces:
+
+@example
+@c file eg/data/guide.po
+#: guide.awk:4
+msgid "Don't Panic"
+msgstr ""
+
+#: guide.awk:5
+msgid "The Answer Is"
+msgstr ""
+
+@c endfile
+@end example
+
+This original portable object file is saved and reused for each language
+into which the application is translated. The @code{msgid}
+is the original string and the @code{msgstr} is the translation.
+
+@strong{Note:} Strings not marked with a leading underscore do not
+appear in the @file{guide.po} file.
+
+Next, the messages must be translated.
+Here is a translation to a hypothetical dialect of English,
+called ``Mellow'':@footnote{Perhaps it would be better if it were
+called ``Hippy.'' Ah, well.}
+
+@example
+@group
+$ cp guide.po guide-mellow.po
+@var{Add translations to} guide-mellow.po @dots{}
@end group
@end example
@noindent
-our program tells us (predictably) that @code{99385} is the largest number
-in our array.
+Following are the translations:
+
+@example
+@c file eg/data/guide-mellow.po
+#: guide.awk:4
+msgid "Don't Panic"
+msgstr "Hey man, relax!"
+
+#: guide.awk:5
+msgid "The Answer Is"
+msgstr "Like, the scoop is"
+
+@c endfile
+@end example
+
+@cindex Linux
+@cindex GNU/Linux
+The next step is to make the directory to hold the binary message object
+file and then to create the @file{guide.mo} file.
+The directory layout shown here is standard for GNU @code{gettext} on
+GNU/Linux systems. Other versions of @code{gettext} may use a different
+layout:
+
+@example
+$ mkdir en_US en_US/LC_MESSAGES
+@end example
+
+@cindex @command{msgfmt} utility
+The @command{msgfmt} utility does the conversion from human-readable
+@file{.po} file to machine-readable @file{.mo} file.
+By default, @command{msgfmt} creates a file named @file{messages}.
+This file must be renamed and placed in the proper directory so that
+@command{gawk} can find it:
+
+@example
+$ msgfmt guide-mellow.po
+$ mv messages en_US/LC_MESSAGES/guide.mo
+@end example
+
+Finally, we run the program to test it:
+
+@example
+$ gawk -f guide.awk
+@print{} Hey man, relax!
+@print{} Like, the scoop is 42
+@print{} Pardon me, Zaphod who?
+@end example
+
+If the two replacement functions for @code{dcgettext}
+and @code{bindtextdomain}
+(@pxref{I18N Portability, ,@command{awk} Portability Issues})
+are in a file named @file{libintl.awk},
+then we can run @file{guide.awk} unchanged as follows:
+
+@example
+$ gawk --posix -f guide.awk -f libintl.awk
+@print{} Don't Panic
+@print{} The Answer Is 42
+@print{} Pardon me, Zaphod who?
+@end example
+
+@node Gawk I18N, , I18N Example, Internationalization
+@section @command{gawk} Can Speak Your Language
+
+As of @value{PVERSION} 3.1, @command{gawk} itself has been internationalized
+using the GNU @code{gettext} package.
+@ifinfo
+(GNU @code{gettext} is described in
+complete detail in
+@ref{Top}.)
+@end ifinfo
+@ifnotinfo
+(GNU @code{gettext} is described in
+complete detail in
+@cite{GNU gettext tools}.)
+@end ifnotinfo
+As of this writing, the latest version of GNU @code{gettext} is
+@uref{ftp://gnudist.gnu.org/gnu/gettext/gettext-0.10.37.tar.gz, @value{PVERSION} 0.10.37}.
+
+If a translation of @command{gawk}'s messages exists,
+then @command{gawk} produces usage messages, warnings,
+and fatal errors in the local language.
+
+@cindex @code{--with-included-gettext} configuration option
+@cindex configuration option, @code{--with-included-gettext}
+On systems that do not use @value{PVERSION} 2 (or later) of the GNU C library, you should
+configure @command{gawk} with the @option{--with-included-gettext} option
+before compiling and installing it.
+@xref{Additional Configuration Options},
+for more information.
+
+@node Advanced Features, Invoking Gawk, Internationalization, Top
+@chapter Advanced Features of @command{gawk}
+@cindex advanced features
+@cindex features, advanced
+@ignore
+Contributed by: Peter Langston <pud!psl@bellcore.bellcore.com>
+
+ Found in Steve English's "signature" line:
+
+"Write documentation as if whoever reads it is a violent psychopath
+who knows where you live."
+@end ignore
+@quotation
+@i{Write documentation as if whoever reads it is
+a violent psychopath who knows where you live.}@*
+Steve English, as quoted by Peter Langston
+@end quotation
+
+This @value{CHAPTER} discusses advanced features in @command{gawk}.
+It's a bit of a ``grab bag'' of items that are otherwise unrelated
+to each other.
+First, a command-line option allows @command{gawk} to recognize
+non-decimal numbers in input data, not just in @command{awk}
+programs. Next, two-way I/O, discussed briefly in earlier parts of this
+@value{DOCUMENT}, is described in full detail, along with the basics
+of TCP/IP networking and BSD portal files. Finally, @command{gawk}
+can @dfn{profile} an @command{awk} program, making it possible to tune
+it for performance.
+
+@ref{Dynamic Extensions, ,Adding New Built-in Functions to @command{gawk}},
+discusses the ability to dynamically add new built-in functions to
+@command{gawk}. As this feature is still immature and likely to change,
+its description is relegated to an appendix.
+
+@menu
+* Non-decimal Data:: Allowing non-decimal input data.
+* Two-way I/O:: Two-way communications with another process.
+* TCP/IP Networking:: Using @command{gawk} for network programming.
+* Portal Files:: Using @command{gawk} with BSD portals.
+* Profiling:: Profiling your @command{awk} programs.
+@end menu
+
+@node Non-decimal Data, Two-way I/O, Advanced Features, Advanced Features
+@section Allowing Non-Decimal Input Data
+@cindex @code{--non-decimal-data} option
+@cindex command-line option, @code{--non-decimal-data}
+
+If you run @command{gawk} with the @option{--non-decimal-data} option,
+you can have non-decimal constants in your input data:
+
+@c line break here for small book format
+@example
+$ echo 0123 123 0x123 |
+> gawk --non-decimal-data '@{ printf "%d, %d, %d\n",
+> $1, $2, $3 @}'
+@print{} 83, 123, 291
+@end example
+
+For this feature to work, write your program so that
+@command{gawk} treats your data as numeric:
+
+@example
+$ echo 0123 123 0x123 | gawk '@{ print $1, $2, $3 @}'
+@print{} 0123 123 0x123
+@end example
+
+@noindent
+The @code{print} statement treats its expressions as strings.
+Although the fields can act as numbers when necessary,
+they are still strings, so @code{print} does not try to treat them
+numerically. You may need to add zero to a field to force it to
+be treated as a number. For example:
+
+@example
+$ echo 0123 123 0x123 | gawk --non-decimal-data '
+> @{ print $1, $2, $3
+> print $1 + 0, $2 + 0, $3 + 0 @}'
+@print{} 0123 123 0x123
+@print{} 83 123 291
+@end example
+
+Because it is common to have decimal data with leading zeros, and because
+using it could lead to surprising results, the default is to leave this
+facility disabled. If you want it, you must explicitly request it.
+
+@cindex conventions, programming
+@cindex programming conventions
+@strong{Caution:}
+@emph{Use of this option is not recommended.}
+It can break old programs very badly.
+Instead, use the @code{strtonum} function to convert your data
+(@pxref{Non-decimal-numbers, ,Octal and Hexadecimal Numbers}).
+This makes your programs easier to write and easier to read, and
+leads to less surprising results.
+
+@node Two-way I/O, TCP/IP Networking, Non-decimal Data, Advanced Features
+@section Two-Way Communications with Another Process
+@cindex Brennan, Michael
+@cindex sex, programmer attractiveness
+@smallexample
+@c Path: cssun.mathcs.emory.edu!gatech!newsxfer3.itd.umich.edu!news-peer.sprintlink.net!news-sea-19.sprintlink.net!news-in-west.sprintlink.net!news.sprintlink.net!Sprint!204.94.52.5!news.whidbey.com!brennan
+From: brennan@@whidbey.com (Mike Brennan)
+Newsgroups: comp.lang.awk
+Subject: Re: Learn the SECRET to Attract Women Easily
+Date: 4 Aug 1997 17:34:46 GMT
+@c Organization: WhidbeyNet
+@c Lines: 12
+Message-ID: <5s53rm$eca@@news.whidbey.com>
+@c References: <5s20dn$2e1@chronicle.concentric.net>
+@c Reply-To: brennan@whidbey.com
+@c NNTP-Posting-Host: asn202.whidbey.com
+@c X-Newsreader: slrn (0.9.4.1 UNIX)
+@c Xref: cssun.mathcs.emory.edu comp.lang.awk:5403
+
+On 3 Aug 1997 13:17:43 GMT, Want More Dates???
+<tracy78@@kilgrona.com> wrote:
+>Learn the SECRET to Attract Women Easily
+>
+>The SCENT(tm) Pheromone Sex Attractant For Men to Attract Women
+
+The scent of awk programmers is a lot more attractive to women than
+the scent of perl programmers.
+--
+Mike Brennan
+@c brennan@@whidbey.com
+@end smallexample
+
+It is often useful to be able to
+send data to a separate program for
+processing and then read the result. This can always be
+done with temporary files:
+
+@example
+# write the data for processing
+tempfile = ("/tmp/mydata." PROCINFO["pid"])
+while (@var{not done with data})
+ print @var{data} | ("subprogram > " tempfile)
+close("subprogram > " tempfile)
+
+# read the results, remove tempfile when done
+while ((getline newdata < tempfile) > 0)
+ @var{process} newdata @var{appropriately}
+close(tempfile)
+system("rm " tempfile)
+@end example
+
+@noindent
+This works, but not elegantly.
+
+@cindex coprocess
+@cindex two-way I/O
+@cindex I/O, two-way
+@cindex @code{|&} I/O operator
+@cindex @command{csh} utility
+Starting with @value{PVERSION} 3.1 of @command{gawk}, it is possible to
+open a @emph{two-way} pipe to another process. The second process is
+termed a @dfn{coprocess}, since it runs in parallel with @command{gawk}.
+The two-way connection is created using the new @samp{|&} operator
+(borrowed from the Korn Shell, @command{ksh}):@footnote{This is very
+different from the same operator in the C shell, @command{csh}.}
+
+@example
+do @{
+ print @var{data} |& "subprogram"
+ "subprogram" |& getline results
+@} while (@var{data left to process})
+close("subprogram")
+@end example
+
+The first time an I/O operation is executed using the @samp{|&}
+operator, @command{gawk} creates a two-way pipeline to a child process
+that runs the other program. Output created with @code{print}
+or @code{printf} is written to the program's standard input, and
+output from the program's standard output can be read by the @command{gawk}
+program using @code{getline}.
+As is the case with processes started by @samp{|}, the subprogram
+can be any program, or pipeline of programs, that can be started by
+the shell.
+
+There are some cautionary items to be aware of:
+
+@itemize @bullet
+@item
+As the code inside @command{gawk} currently stands, the coprocess's
+standard error goes to the same place that the parent @command{gawk}'s
+standard error goes. It is not possible to read the child's
+standard error separately.
+
+@cindex deadlock
+@item
+I/O buffering may be a problem. @command{gawk} automatically
+flushes all output down the pipe to the child process.
+However, if the coprocess does not flush its output,
+@command{gawk} may hang when doing a @code{getline} in order to read
+the coprocess's results. This could lead to a situation
+known as @dfn{deadlock}, where each process is waiting for the
+other one to do something.
+@end itemize
+
+It is possible to close just one end of the two-way pipe to
+a coprocess, by supplying a second argument to the @code{close}
+function of either @code{"to"} or @code{"from"}
+(@pxref{Close Files And Pipes, ,Closing Input and Output Redirections}).
+These strings tell @command{gawk} to close the end of the pipe
+that sends data to the process or the end that reads from it,
+respectively.
+
+This is particularly necessary in order to use
+the system @command{sort} utility as part of a coprocess;
+@command{sort} must read @emph{all} of its input
+data before it can produce any output.
+The @command{sort} program does not receive an end-of-file indication
+until @command{gawk} closes the write end of the pipe.
+
+When you have finished writing data to the @command{sort}
+utility, you can close the @code{"to"} end of the pipe, and
+then start reading sorted data via @code{getline}.
+For example:
+
+@example
+BEGIN @{
+ command = "LC_ALL=C sort"
+ n = split("abcdefghijklmnopqrstuvwxyz", a, "")
+
+ for (i = n; i > 0; i--)
+ print a[i] |& command
+ close(command, "to")
+
+ while ((command |& getline line) > 0)
+ print "got", line
+ close(command)
+@}
+@end example
+
+This program writes the letters of the alphabet in reverse order, one
+per line, down the two-way pipe to @command{sort}. It then closes the
+write end of the pipe, so that @command{sort} receives an end-of-file
+indication. This causes @command{sort} to sort the data and write the
+sorted data back to the @command{gawk} program. Once all of the data
+has been read, @command{gawk} terminates the coprocess and exits.
+
+As a side note, the assignment @samp{LC_ALL=C} in the @command{sort}
+command ensures traditional Unix (ASCII) sorting from @command{sort}.
+
+@node TCP/IP Networking, Portal Files, Two-way I/O, Advanced Features
+@section Using @command{gawk} for Network Programming
+@cindex networking, TCP/IP
+@cindex TCP/IP networking
+@cindex @file{/inet} special files
+@cindex @code{EMISTERED}
+@quotation
+@code{EMISTERED}: @i{A host is a host from coast to coast,@*
+and no-one can talk to host that's close,@*
+unless the host that isn't close@*
+is busy hung or dead.}
+@end quotation
+
+In addition to being able to open a two-way pipeline to a coprocess
+on the same system
+(@pxref{Two-way I/O, ,Two-Way Communications with Another Process}),
+it is possible to make a two-way connection to
+another process on another system across an IP networking connection.
+
+You can think of this as just a @emph{very long} two-way pipeline to
+a coprocess.
+The way @command{gawk} decides that you want to use TCP/IP networking is
+by recognizing special @value{FN}s that begin with @samp{/inet/}.
+
+The full syntax of the special @value{FN} is
+@file{/inet/@var{protocol}/@var{local-port}/@var{remote-host}/@var{remote-port}}.
+The meaning of the components are:
+
+@table @var
+@item protocol
+The protocol to use over IP. This must be either @samp{tcp},
+@samp{udp}, or @samp{raw}, for a TCP, UDP, or raw IP connection,
+respectively. The use of TCP is recommended for most applications.
+
+@strong{Caution:} The use of raw sockets is not currently supported
+in @value{PVERSION} 3.1 of @command{gawk}.
+
+@item local-port
+@cindex @code{getservbyname} C library function
+The local TCP or UDP port number to use. Use a port number of @samp{0}
+when you want the system to pick a port. This is what you should do
+when writing a TCP or UDP client.
+You may also use a well-known service name, such as @samp{smtp}
+or @samp{http}, in which case @command{gawk} attempts to determine
+the pre-defined port number using the C @code{getservbyname} function.
+
+@item remote-host
+The IP address or fully-qualified domain name of the Internet
+host to which you want to connect.
+
+@item remote-port
+The TCP or UDP port number to use on the given @var{remote-host}.
+Again, use @samp{0} if you don't care, or else a well-known
+service name.
+@end table
+
+Consider the following very simple example:
+
+@example
+BEGIN @{
+ Service = "/inet/tcp/0/localhost/daytime"
+ Service |& getline
+ print $0
+ close(Service)
+@}
+@end example
+
+This program reads the current date and time from the local system's
+TCP @samp{daytime} server.
+It then prints the results and closes the connection.
+
+Because this topic is extensive, the use of @command{gawk} for
+TCP/IP programming is documented separately.
+@ifinfo
+@xref{Top},
+@end ifinfo
+@ifnotinfo
+See @cite{TCP/IP Internetworking with @command{gawk}},
+which comes as part of the @command{gawk} distribution,
+@end ifnotinfo
+for a much more complete introduction and discussion, as well as
+extensive examples.
+
+@node Portal Files, Profiling, TCP/IP Networking, Advanced Features
+@section Using @command{gawk} with BSD Portals
+@cindex portal files
+@cindex BSD portal files
+@cindex TCP/IP networking
+@cindex @file{/p} special files
+@cindex @code{--enable-portals} configuration option
+@cindex configuration option, @code{--enable-portals}
+@cindex BSD-based operating systems
+
+Similar to the @file{/inet} special files, if @command{gawk}
+is configured with the @option{--enable-portals} option
+(@pxref{Quick Installation, , Compiling @command{gawk} for Unix}),
+then @command{gawk} treats
+files whose pathnames begin with @code{/p} as 4.4 BSD-style portals.
+
+When used with the @samp{|&} operator, @command{gawk} opens the file
+for two-way communications. The operating system's portal mechanism
+then manages creating the process associated with the portal and
+the corresponding communications with the portal's process.
+
+@node Profiling, , Portal Files, Advanced Features
+@section Profiling Your @command{awk} Programs
+@cindex profiling @command{awk} programs
+@cindex @command{pgawk} program
+
+Beginning with @value{PVERSION} 3.1 of @command{gawk}, you may produce execution
+traces of your @command{awk} programs.
+This is done with a specially compiled version of @command{gawk},
+called @command{pgawk} (``profiling @command{gawk}'').
+
+@cindex @file{awkprof.out} profiling output file
+@cindex profiling output file (@file{awkprof.out})
+@command{pgawk} is identical in every way to @command{gawk}, except that when
+it has finished running, it creates a profile of your program in a file
+named @file{awkprof.out}.
+Because it is profiling, it also executes up to 45 percent slower than
+@command{gawk} normally does.
+
+As shown in the following example,
+the @option{--profile} option can be used to change the name of the file
+where @command{pgawk} will write the profile:
+
+@example
+$ pgawk --profile=myprog.prof -f myprog.awk data1 data2
+@end example
+
+@noindent
+In the above example, @command{pgawk} places the profile in
+@file{myprog.prof} instead of in @file{awkprof.out}.
+
+Regular @command{gawk} also accepts this option. When called with just
+@option{--profile}, @command{gawk} ``pretty prints'' the program into
+@file{awkprof.out}, without any execution counts. You may supply an
+option to @option{--profile} to change the @value{FN}. Here is a sample
+session showing a simple @command{awk} program, its input data, and the
+results from running @command{pgawk}. First, the @command{awk} program:
+
+@example
+BEGIN @{ print "First BEGIN rule" @}
+
+END @{ print "First END rule" @}
+
+/foo/ @{
+ print "matched /foo/, gosh"
+ for (i = 1; i <= 3; i++)
+ sing()
+@}
+
+@{
+ if (/foo/)
+ print "if is true"
+ else
+ print "else is true"
+@}
+
+BEGIN @{ print "Second BEGIN rule" @}
+
+END @{ print "Second END rule" @}
+
+function sing( dummy)
+@{
+ print "I gotta be me!"
+@}
+@end example
+
+Following is the input data:
+
+@example
+foo
+bar
+baz
+foo
+junk
+@end example
+
+Here is the @file{awkprof.out} that results from running @command{pgawk}
+on this program and data. (This example also illustrates that @command{awk}
+programmers sometimes have to work late.):
+
+@cindex blocks, @code{BEGIN} and @code{END}
+@example
+ # gawk profile, created Sun Aug 13 00:00:15 2000
+
+ # BEGIN block(s)
+
+ BEGIN @{
+ 1 print "First BEGIN rule"
+ 1 print "Second BEGIN rule"
+ @}
+
+ # Rule(s)
+
+ 5 /foo/ @{ # 2
+ 2 print "matched /foo/, gosh"
+ 6 for (i = 1; i <= 3; i++) @{
+ 6 sing()
+ @}
+ @}
+
+ 5 @{
+ 5 if (/foo/) @{ # 2
+ 2 print "if is true"
+ 3 @} else @{
+ 3 print "else is true"
+ @}
+ @}
+
+ # END block(s)
+
+ END @{
+ 1 print "First END rule"
+ 1 print "Second END rule"
+ @}
+
+ # Functions, listed alphabetically
-@node Invoking Gawk, Library Functions, User-defined, Top
-@chapter Running @code{awk}
+ 6 function sing(dummy)
+ @{
+ 6 print "I gotta be me!"
+ @}
+@end example
+
+The previous example illustrates many of the basic rules for profiling output.
+The rules are as follows:
+
+@itemize @bullet
+@item
+The program is printed in the order @code{BEGIN} rule,
+pattern/action rules, @code{END} rule and functions, listed
+alphabetically.
+Multiple @code{BEGIN} and @code{END} rules are merged together.
+
+@item
+Pattern-action rules have two counts.
+The first count, to the left of the rule, shows how many times
+the rule's pattern was @emph{tested}.
+The second count, to the right of the rule's opening left brace
+in a comment,
+shows how many times the rule's action was @emph{executed}.
+The difference between the two indicates how many times the rule's
+pattern evaluated to false.
+
+@item
+Similarly,
+the count for an @code{if}-@code{else} statement shows how many times
+the condition was tested.
+To the right of the opening left brace for the @code{if}'s body
+is a count showing how many times the condition was true.
+The count for the @code{else}
+indicates how many times the test failed.
+
+@item
+The count for a loop header (such as @code{for}
+or @code{while}) shows how many times the loop test was executed.
+(Because of this, you can't just look at the count on the first
+statement in a rule to determine how many times the rule was executed.
+If the first statement is a loop, the count is misleading.)
+
+@item
+For user-defined functions, the count next to the @code{function}
+keyword indicates how many times the function was called.
+The counts next to the statements in the body show how many times
+those statements were executed.
+
+@item
+The layout uses ``K&R'' style using tabs.
+Braces are used everywhere, even when
+the body of an @code{if}, @code{else}, or loop is only a single statement.
+
+@item
+Parentheses are used only where needed, as indicated by the structure
+of the program and the precedence rules.
+@c extra verbiage here satisfies the copyeditor. ugh.
+For example, @samp{(3 + 5) * 4} means add three plus five, then multiply
+the total by four. However, @samp{3 + 5 * 4} has no parentheses, and
+means @samp{3 + (5 * 4)}.
+
+@item
+All string concatenations are parenthesized too.
+(This could be made a bit smarter.)
+
+@item
+Parentheses are used around the arguments to @code{print}
+and @code{printf} only when
+the @code{print} or @code{printf} statement is followed by a redirection.
+Similarly, if
+the target of a redirection isn't a scalar, it gets parenthesized.
+
+@item
+@command{pgawk} supplies leading comments in
+front of the @code{BEGIN} and @code{END} rules,
+the pattern/action rules, and the functions.
+
+@end itemize
+
+The profiled version of your program may not look exactly like what you
+typed when you wrote it. This is because @command{pgawk} creates the
+profiled version by ``pretty printing'' its internal representation of
+the program. The advantage to this is that @command{pgawk} can produce
+a standard representation. The disadvantage is that all source code
+comments are lost, as are the distinctions among multiple @code{BEGIN}
+and @code{END} rules. Also, things such as:
+
+@example
+/foo/
+@end example
+
+@noindent
+come out as:
+
+@example
+/foo/ @{
+ print $0
+@}
+@end example
+
+@noindent
+which is correct, but possibly surprising.
+
+@cindex dynamic profiling
+@cindex profiling, dynamic
+Besides creating profiles when a program has completed,
+@command{pgawk} can produce a profile while it is running.
+This is useful if your @command{awk} program goes into an
+infinite loop and you want to see what has been executed.
+To use this feature, run @command{pgawk} in the background:
+
+@example
+$ pgawk -f myprog &
+[1] 13992
+@end example
+
+@cindex @command{kill} command
+@cindex @code{SIGUSR1} signal
+@cindex @code{USR1} signal
+@cindex signals, @code{SIGUSR1}
+@noindent
+The shell prints a job number and process ID number, in this case, 13992.
+Use the @command{kill} command to send the @code{USR1} signal
+to @command{pgawk}:
+
+@example
+$ kill -USR1 13992
+@end example
+
+@noindent
+As usual, the profiled version of the program is written to
+@file{awkprof.out}, or to a different file if you use the @option{--profile}
+option.
+
+Along with the regular profile, as shown earlier, the profile
+includes a trace of any active functions:
+
+@example
+# Function Call Stack:
+
+# 3. baz
+# 2. bar
+# 1. foo
+# -- main --
+@end example
+
+You may send @command{pgawk} the @code{USR1} signal as many times as you like.
+Each time, the profile and function call trace are appended to the output
+profile file.
+
+@cindex @code{SIGHUP} signal
+@cindex @code{HUP} signal
+@cindex signals, @code{SIGHUP}
+If you use the @code{HUP} signal instead of the @code{USR1} signal,
+@command{pgawk} produces the profile and the function call trace, and then exits.
+
+@node Invoking Gawk, Library Functions, Advanced Features, Top
+@chapter Running @command{awk} and @command{gawk}
+
+This @value{CHAPTER} covers how to run awk, both POSIX-standard
+and @command{gawk}-specific command-line options, and what
+@command{awk} and
+@command{gawk} do with non-option arguments.
+It then proceeds to cover how @command{gawk} searches for source files,
+obsolete options and/or features, and known bugs in @command{gawk}.
+This @value{CHAPTER} rounds out the discussion of @command{awk}
+as a program and as a language.
+
+While a number of the options and features described here were
+discussed in passing earlier in the book, this @value{CHAPTER} provides the
+full details.
+
+@menu
+* Command Line:: How to run @command{awk}.
+* Options:: Command-line options and their meanings.
+* Other Arguments:: Input file names and variable assignments.
+* AWKPATH Variable:: Searching directories for @command{awk}
+ programs.
+* Obsolete:: Obsolete Options and/or features.
+* Undocumented:: Undocumented Options and Features.
+* Known Bugs:: Known Bugs in @command{gawk}.
+@end menu
+
+@node Command Line, Options, Invoking Gawk, Invoking Gawk
+@section Invoking @command{awk}
@cindex command line
-@cindex invocation of @code{gawk}
-@cindex arguments, command line
-@cindex options, command line
+@cindex invocation of @command{gawk}
+@cindex arguments, command-line
+@cindex options, command-line
@cindex long options
@cindex options, long
-There are two ways to run @code{awk}: with an explicit program, or with
+There are two ways to run @command{awk}---with an explicit program or with
one or more program files. Here are templates for both of them; items
-enclosed in @samp{@r{[}@dots{}@r{]}} in these templates are optional.
-
-Besides traditional one-letter POSIX-style options, @code{gawk} also
-supports GNU long options.
+enclosed in [@dots{}] in these templates are optional:
@example
awk @r{[@var{options}]} -f progfile @r{[@code{--}]} @var{file} @dots{}
awk @r{[@var{options}]} @r{[@code{--}]} '@var{program}' @var{file} @dots{}
@end example
+Besides traditional one-letter POSIX-style options, @command{gawk} also
+supports GNU long options.
+
@cindex empty program
@cindex dark corner
-It is possible to invoke @code{awk} with an empty program:
+@cindex lint checks
+It is possible to invoke @command{awk} with an empty program:
@example
-$ awk '' datafile1 datafile2
+awk '' datafile1 datafile2
@end example
@noindent
-Doing so makes little sense though; @code{awk} will simply exit
-silently when given an empty program (d.c.). If @samp{--lint} has
-been specified on the command line, @code{gawk} will issue a
+Doing so makes little sense though; @command{awk} exits
+silently when given an empty program.
+@value{DARKCORNER}
+If @option{--lint} has
+been specified on the command-line, @command{gawk} issues a
warning that the program is empty.
-@menu
-* Options:: Command line options and their meanings.
-* Other Arguments:: Input file names and variable assignments.
-* AWKPATH Variable:: Searching directories for @code{awk} programs.
-* Obsolete:: Obsolete Options and/or features.
-* Undocumented:: Undocumented Options and Features.
-* Known Bugs:: Known Bugs in @code{gawk}.
-@end menu
-
-@node Options, Other Arguments, Invoking Gawk, Invoking Gawk
-@section Command Line Options
+@node Options, Other Arguments, Command Line, Invoking Gawk
+@section Command-Line Options
-Options begin with a dash, and consist of a single character.
-GNU style long options consist of two dashes and a keyword.
-The keyword can be abbreviated, as long the abbreviation allows the option
+Options begin with a dash and consist of a single character.
+GNU-style long options consist of two dashes and a keyword.
+The keyword can be abbreviated, as long as the abbreviation allows the option
to be uniquely identified. If the option takes an argument, then the
keyword is either immediately followed by an equals sign (@samp{=}) and the
argument's value, or the keyword and the argument's value are separated
-by whitespace. For brevity, the discussion below only refers to the
-traditional short options; however the long and short options are
-interchangeable in all contexts.
+by whitespace.
+If a particular option with a value is given more than once, it is the
+last value that counts.
-Each long option for @code{gawk} has a corresponding
-POSIX-style option. The options and their meanings are as follows:
+Each long option for @command{gawk} has a corresponding
+POSIX-style option.
+The long and short options are
+interchangeable in all contexts.
+The options and their meanings are as follows:
@table @code
@item -F @var{fs}
@itemx --field-separator @var{fs}
@cindex @code{-F} option
+@cindex command-line option, @code{-F}
@cindex @code{--field-separator} option
+@cindex command-line option, @code{--field-separator}
Sets the @code{FS} variable to @var{fs}
-(@pxref{Field Separators, ,Specifying How Fields are Separated}).
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}).
@item -f @var{source-file}
@itemx --file @var{source-file}
@cindex @code{-f} option
+@cindex command-line option, @code{-f}
@cindex @code{--file} option
-Indicates that the @code{awk} program is to be found in @var{source-file}
+@cindex command-line option, @code{--file}
+Indicates that the @command{awk} program is to be found in @var{source-file}
instead of in the first non-option argument.
@item -v @var{var}=@var{val}
@itemx --assign @var{var}=@var{val}
@cindex @code{-v} option
+@cindex command-line option, @code{-v}
@cindex @code{--assign} option
-Sets the variable @var{var} to the value @var{val} @strong{before}
+@cindex command-line option, @code{--assign}
+Sets the variable @var{var} to the value @var{val} @emph{before}
execution of the program begins. Such variable values are available
inside the @code{BEGIN} rule
-(@pxref{Other Arguments, ,Other Command Line Arguments}).
+(@pxref{Other Arguments, ,Other Command-Line Arguments}).
-The @samp{-v} option can only set one variable, but you can use
-it more than once, setting another variable each time, like this:
+The @option{-v} option can only set one variable, but it can be used
+more than once, setting another variable each time, like this:
@samp{awk @w{-v foo=1} @w{-v bar=2} @dots{}}.
-@strong{Caution:} Using @samp{-v} to set the values of the builtin
-variables may lead to suprising results. @code{awk} will reset the
+@strong{Caution:} Using @option{-v} to set the values of the built-in
+variables may lead to surprising results. @command{awk} will reset the
values of those variables as it needs to, possibly ignoring any
predefined value you may have given.
-@item -mf @var{NNN}
-@itemx -mr @var{NNN}
-Set various memory limits to the value @var{NNN}. The @samp{f} flag sets
-the maximum number of fields, and the @samp{r} flag sets the maximum
-record size. These two flags and the @samp{-m} option are from the
-Bell Labs research version of Unix @code{awk}. They are provided
-for compatibility, but otherwise ignored by
-@code{gawk}, since @code{gawk} has no predefined limits.
+@item -mf @var{N}
+@itemx -mr @var{N}
+@cindex @code{-mf} option
+@cindex command-line option, @code{-mf}
+@cindex @code{-mr} option
+@cindex command-line option, @code{-mr}
+Set various memory limits to the value @var{N}. The @samp{f} flag sets
+the maximum number of fields and the @samp{r} flag sets the maximum
+record size. These two flags and the @option{-m} option are from the
+Bell Laboratories research version of Unix @command{awk}. They are provided
+for compatibility but otherwise ignored by
+@command{gawk}, since @command{gawk} has no predefined limits.
+(The Bell Laboratories @command{awk} no longer needs these options;
+it continues to accept them to avoid breaking old programs.)
@item -W @var{gawk-opt}
@cindex @code{-W} option
-Following the POSIX standard, options that are implementation
-specific are supplied as arguments to the @samp{-W} option. These options
-also have corresponding GNU style long options.
-See below.
+@cindex command-line option, @code{-W}
+Following the POSIX standard, implementation-specific
+options are supplied as arguments to the @option{-W} option. These options
+also have corresponding GNU-style long options.
+Note that the long options may be abbreviated, as long as
+the abbreviations remain unique.
+The full list of @command{gawk}-specific options is provided next.
@item --
-Signals the end of the command line options. The following arguments
+Signals the end of the command-line options. The following arguments
are not treated as options even if they begin with @samp{-}. This
-interpretation of @samp{--} follows the POSIX argument parsing
+interpretation of @option{--} follows the POSIX argument parsing
conventions.
-This is useful if you have file names that start with @samp{-},
-or in shell scripts, if you have file names that will be specified
-by the user which could start with @samp{-}.
+This is useful if you have @value{FN}s that start with @samp{-},
+or in shell scripts, if you have @value{FN}s that will be specified
+by the user that could start with @samp{-}.
@end table
-The following @code{gawk}-specific options are available:
+The previous list described options mandated by the POSIX standard,
+as well as options available in the Bell Laboratories version of @command{awk}.
+The following list describes @command{gawk}-specific options:
@table @code
-@item -W traditional
-@itemx -W compat
-@itemx --traditional
+@item -W compat
+@itemx -W traditional
@itemx --compat
+@itemx --traditional
@cindex @code{--compat} option
+@cindex command-line option, @code{--compat}
@cindex @code{--traditional} option
+@cindex command-line option, @code{--traditional}
@cindex compatibility mode
Specifies @dfn{compatibility mode}, in which the GNU extensions to
-the @code{awk} language are disabled, so that @code{gawk} behaves just
-like the Bell Labs research version of Unix @code{awk}.
-@samp{--traditional} is the preferred form of this option.
-@xref{POSIX/GNU, ,Extensions in @code{gawk} Not in POSIX @code{awk}},
+the @command{awk} language are disabled, so that @command{gawk} behaves just
+like the Bell Laboratories research version of Unix @command{awk}.
+@option{--traditional} is the preferred form of this option.
+@xref{POSIX/GNU, ,Extensions in @command{gawk} Not in POSIX @command{awk}},
which summarizes the extensions. Also see
@ref{Compatibility Mode, ,Downward Compatibility and Debugging}.
+@item -W copyright
+@itemx --copyright
+@cindex @code{--copyright} option
+@cindex command-line option, @code{--copyright}
+Print the short version of the General Public License and then exit.
+
@item -W copyleft
-@itemx -W copyright
@itemx --copyleft
-@itemx --copyright
@cindex @code{--copyleft} option
-@cindex @code{--copyright} option
-Print the short version of the General Public License, and then exit.
-This option may disappear in a future version of @code{gawk}.
+@cindex command-line option, @code{--copyleft}
+Just like @option{--copyright}.
+This option may disappear in a future version of @command{gawk}.
+
+@cindex @code{--dump-variables} option
+@cindex command-line option, @code{--dump-variables}
+@cindex @file{awkvars.out} global variable list output file
+@item -W dump-variables@r{[}=@var{file}@r{]}
+@itemx --dump-variables@r{[}=@var{file}@r{]}
+Print a sorted list of global variables, their types, and final values
+to @var{file}. If no @var{file} is provided, @command{gawk} prints this
+list to a file named @file{awkvars.out} in the current directory.
+
+@cindex common mistakes
+@cindex mistakes, common
+@cindex errors, common
+Having a list of all the global variables is a good way to look for
+typographical errors in your programs.
+You would also use this option if you have a large program with a lot of
+functions, and you want to be sure that your functions don't
+inadvertently use global variables that you meant to be local.
+(This is a particularly easy mistake to make with simple variable
+names like @code{i}, @code{j}, and so on.)
+
+@item -W gen-po
+@itemx --gen-po
+@cindex @code{--gen-po} option
+@cindex command-line option, @code{--gen-po}
+Analyze the source program and
+generate a GNU @code{gettext} Portable Object file on standard
+output for all string constants that have been marked for translation.
+@xref{Internationalization, ,Internationalization with @command{gawk}},
+for information about this option.
@item -W help
@itemx -W usage
@itemx --help
@itemx --usage
@cindex @code{--help} option
+@cindex command-line option, @code{--help}
@cindex @code{--usage} option
+@cindex command-line option, @code{--usage}
Print a ``usage'' message summarizing the short and long style options
-that @code{gawk} accepts, and then exit.
+that @command{gawk} accepts and then exit.
-@item -W lint
-@itemx --lint
+@item -W lint@r{[}=fatal@r{]}
+@itemx --lint@r{[}=fatal@r{]}
@cindex @code{--lint} option
+@cindex command-line option, @code{--lint}
+@cindex lint checks
+@cindex fatal errors
Warn about constructs that are dubious or non-portable to
-other @code{awk} implementations.
-Some warnings are issued when @code{gawk} first reads your program. Others
-are issued at run-time, as your program executes.
+other @command{awk} implementations.
+Some warnings are issued when @command{gawk} first reads your program. Others
+are issued at runtime, as your program executes.
+With an optional argument of @samp{fatal},
+lint warnings become fatal errors.
+This may be drastic but its use will certainly encourage the
+development of cleaner @command{awk} programs.
@item -W lint-old
@itemx --lint-old
@cindex @code{--lint-old} option
-Warn about constructs that are not available in
-the original Version 7 Unix version of @code{awk}
-(@pxref{V7/SVR3.1, , Major Changes between V7 and SVR3.1}).
+@cindex command-line option, @code{--lint-old}
+@cindex lint checks
+Warn about constructs that are not available in the original version of
+@command{awk} from Version 7 Unix
+(@pxref{V7/SVR3.1, ,Major Changes Between V7 and SVR3.1}).
+
+@item -W non-decimal-data
+@itemx --non-decimal-data
+@cindex @code{--non-decimal-data} option
+@cindex command-line option, @code{--non-decimal-data}
+Enable automatic interpretation of octal and hexadecimal
+values in input data
+(@pxref{Non-decimal Data, ,Allowing Non-Decimal Input Data}).
+
+@strong{Caution:} This option can severely break old programs.
+Use with care.
@item -W posix
@itemx --posix
@cindex @code{--posix} option
+@cindex command-line option, @code{--posix}
@cindex POSIX mode
-Operate in strict POSIX mode. This disables all @code{gawk}
-extensions (just like @samp{--traditional}), and adds the following additional
+Operate in strict POSIX mode. This disables all @command{gawk}
+extensions (just like @option{--traditional}) and adds the following additional
restrictions:
@c IMPORTANT! Keep this list in sync with the one in node POSIX
@@ -11517,147 +15137,182 @@ restrictions:
@item
Newlines do not act as whitespace to separate fields when @code{FS} is
-equal to a single space.
+equal to a single space
+(@pxref{Fields, , Examining Fields}).
+
+@item
+Newlines are not allowed after @samp{?} or @samp{:}
+(@pxref{Conditional Exp, ,Conditional Expressions}).
@item
The synonym @code{func} for the keyword @code{function} is not
recognized (@pxref{Definition Syntax, ,Function Definition Syntax}).
@item
-The operators @samp{**} and @samp{**=} cannot be used in
+The @samp{**} and @samp{**=} operators cannot be used in
place of @samp{^} and @samp{^=} (@pxref{Arithmetic Ops, ,Arithmetic Operators},
and also @pxref{Assignment Ops, ,Assignment Expressions}).
@item
-Specifying @samp{-Ft} on the command line does not set the value
+Specifying @samp{-Ft} on the command-line does not set the value
of @code{FS} to be a single tab character
-(@pxref{Field Separators, ,Specifying How Fields are Separated}).
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}).
@item
The @code{fflush} built-in function is not supported
-(@pxref{I/O Functions, , Built-in Functions for Input/Output}).
+(@pxref{I/O Functions, ,Input/Output Functions}).
@end itemize
-If you supply both @samp{--traditional} and @samp{--posix} on the
-command line, @samp{--posix} will take precedence. @code{gawk}
-will also issue a warning if both options are supplied.
+@cindex automatic warnings
+@cindex warnings, automatic
+If you supply both @option{--traditional} and @option{--posix} on the
+command-line, @option{--posix} takes precedence. @command{gawk}
+also issues a warning if both options are supplied.
+
+@item -W profile@r{[}=@var{file}@r{]}
+@itemx --profile@r{[}=@var{file}@r{]}
+@cindex @code{--profile} option
+@cindex command-line option, @code{--profile}
+Enable profiling of @command{awk} programs
+(@pxref{Profiling, ,Profiling Your @command{awk} Programs}).
+By default, profiles are created in a file named @file{awkprof.out}.
+The optional @var{file} argument allows you to specify a different
+@value{FN} for the profile file.
+
+When run with @command{gawk}, the profile is just a ``pretty printed'' version
+of the program. When run with @command{pgawk}, the profile contains execution
+counts for each statement in the program in the left margin, and function
+call counts for each function.
@item -W re-interval
@itemx --re-interval
+@cindex @code{--re-interval} option
+@cindex command-line option, @code{--re-interval}
Allow interval expressions
-(@pxref{Regexp Operators, , Regular Expression Operators}),
+(@pxref{Regexp Operators, , Regular Expression Operators})
in regexps.
-Because interval expressions were traditionally not available in @code{awk},
-@code{gawk} does not provide them by default. This prevents old @code{awk}
+Because interval expressions were traditionally not available in @command{awk},
+@command{gawk} does not provide them by default. This prevents old @command{awk}
programs from breaking.
@item -W source @var{program-text}
@itemx --source @var{program-text}
@cindex @code{--source} option
+@cindex command-line option, @code{--source}
Program source code is taken from the @var{program-text}. This option
allows you to mix source code in files with source
-code that you enter on the command line. This is particularly useful
-when you have library functions that you wish to use from your command line
-programs (@pxref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}).
+code that you enter on the command-line. This is particularly useful
+when you have library functions that you want to use from your command-line
+programs (@pxref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}).
@item -W version
@itemx --version
@cindex @code{--version} option
-Prints version information for this particular copy of @code{gawk}.
-This allows you to determine if your copy of @code{gawk} is up to date
+@cindex command-line option, @code{--version}
+Print version information for this particular copy of @command{gawk}.
+This allows you to determine if your copy of @command{gawk} is up to date
with respect to whatever the Free Software Foundation is currently
distributing.
It is also useful for bug reports
(@pxref{Bugs, , Reporting Problems and Bugs}).
@end table
-Any other options are flagged as invalid with a warning message, but
+As long as program text has been supplied,
+any other options are flagged as invalid with a warning message but
are otherwise ignored.
In compatibility mode, as a special case, if the value of @var{fs} supplied
-to the @samp{-F} option is @samp{t}, then @code{FS} is set to the tab
-character (@code{"\t"}). This is only true for @samp{--traditional}, and not
-for @samp{--posix}
-(@pxref{Field Separators, ,Specifying How Fields are Separated}).
+to the @option{-F} option is @samp{t}, then @code{FS} is set to the tab
+character (@code{"\t"}). This is only true for @option{--traditional} and not
+for @option{--posix}
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}).
-The @samp{-f} option may be used more than once on the command line.
-If it is, @code{awk} reads its program source from all of the named files, as
+The @option{-f} option may be used more than once on the command-line.
+If it is, @command{awk} reads its program source from all of the named files, as
if they had been concatenated together into one big file. This is
-useful for creating libraries of @code{awk} functions. Useful functions
-can be written once, and then retrieved from a standard place, instead
+useful for creating libraries of @command{awk} functions. These functions
+can be written once and then retrieved from a standard place, instead
of having to be included into each individual program.
+(As mentioned in
+@ref{Definition Syntax, ,Function Definition Syntax},
+function names must be unique.)
-You can type in a program at the terminal and still use library functions,
-by specifying @samp{-f /dev/tty}. @code{awk} will read a file from the terminal
-to use as part of the @code{awk} program. After typing your program,
-type @kbd{Control-d} (the end-of-file character) to terminate it.
+Library functions can still be used, even if the program is entered at the terminal,
+by specifying @samp{-f /dev/tty}. After typing your program,
+type @kbd{Ctrl-d} (the end-of-file character) to terminate it.
(You may also use @samp{-f -} to read program source from the standard
-input, but then you will not be able to also use the standard input as a
+input but then you will not be able to also use the standard input as a
source of data.)
-Because it is clumsy using the standard @code{awk} mechanisms to mix source
-file and command line @code{awk} programs, @code{gawk} provides the
-@samp{--source} option. This does not require you to pre-empt the standard
-input for your source code, and allows you to easily mix command line
+Because it is clumsy using the standard @command{awk} mechanisms to mix source
+file and command-line @command{awk} programs, @command{gawk} provides the
+@option{--source} option. This does not require you to pre-empt the standard
+input for your source code; it allows you to easily mix command-line
and library source code
-(@pxref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}).
+(@pxref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}).
-If no @samp{-f} or @samp{--source} option is specified, then @code{gawk}
-will use the first non-option command line argument as the text of the
+If no @option{-f} or @option{--source} option is specified, then @command{gawk}
+uses the first non-option command-line argument as the text of the
program source code.
@cindex @code{POSIXLY_CORRECT} environment variable
@cindex environment variable, @code{POSIXLY_CORRECT}
-If the environment variable @code{POSIXLY_CORRECT} exists,
-then @code{gawk} will behave in strict POSIX mode, exactly as if
-you had supplied the @samp{--posix} command line option.
+@cindex lint checks
+If the environment variable @env{POSIXLY_CORRECT} exists,
+then @command{gawk} behaves in strict POSIX mode, exactly as if
+you had supplied the @option{--posix} command-line option.
Many GNU programs look for this environment variable to turn on
-strict POSIX mode. If you supply @samp{--lint} on the command line,
-and @code{gawk} turns on POSIX mode because of @code{POSIXLY_CORRECT},
-then it will print a warning message indicating that POSIX
+strict POSIX mode. If @option{--lint} is supplied on the command-line
+and @command{gawk} turns on POSIX mode because of @env{POSIXLY_CORRECT},
+then it issues a warning message indicating that POSIX
mode is in effect.
-
You would typically set this variable in your shell's startup file.
-For a Bourne compatible shell (such as Bash), you would add these
-lines to the @file{.profile} file in your home directory.
+For a Bourne-compatible shell (such as @command{bash}), you would add these
+lines to the @file{.profile} file in your home directory:
@example
-@group
POSIXLY_CORRECT=true
export POSIXLY_CORRECT
-@end group
@end example
-For a @code{csh} compatible shell,@footnote{Not recommended.}
-you would add this line to the @file{.login} file in your home directory.
+@cindex @command{csh} utility
+For a @command{csh} compatible
+shell,@footnote{Not recommended.}
+you would add this line to the @file{.login} file in your home directory:
@example
setenv POSIXLY_CORRECT true
@end example
+Having @env{POSIXLY_CORRECT} set is not recommended for daily use,
+but it is good for testing the portability of your programs to other
+environments.
+
@node Other Arguments, AWKPATH Variable, Options, Invoking Gawk
-@section Other Command Line Arguments
+@section Other Command-Line Arguments
-Any additional arguments on the command line are normally treated as
+Any additional arguments on the command-line are normally treated as
input files to be processed in the order specified. However, an
argument that has the form @code{@var{var}=@var{value}}, assigns
the value @var{value} to the variable @var{var}---it does not specify a
file at all.
+(This was discussed earlier in
+@ref{Assignment Options, ,Assigning Variables on the Command Line}.)
-@vindex ARGIND
-@vindex ARGV
-All these arguments are made available to your @code{awk} program in the
-@code{ARGV} array (@pxref{Built-in Variables}). Command line options
+@cindex @code{ARGIND} variable
+@cindex @code{ARGV} variable
+All these arguments are made available to your @command{awk} program in the
+@code{ARGV} array (@pxref{Built-in Variables}). Command-line options
and the program text (if present) are omitted from @code{ARGV}.
All other arguments, including variable assignments, are
-included. As each element of @code{ARGV} is processed, @code{gawk}
+included. As each element of @code{ARGV} is processed, @command{gawk}
sets the variable @code{ARGIND} to the index in @code{ARGV} of the
current element.
-The distinction between file name arguments and variable-assignment
-arguments is made when @code{awk} is about to open the next input file.
-At that point in execution, it checks the ``file name'' to see whether
-it is really a variable assignment; if so, @code{awk} sets the variable
+The distinction between @value{FN} arguments and variable-assignment
+arguments is made when @command{awk} is about to open the next input file.
+At that point in execution, it checks the @value{FN} to see whether
+it is really a variable assignment; if so, @command{awk} sets the variable
instead of reading a file.
Therefore, the variables actually receive the given values after all
@@ -11665,26 +15320,27 @@ previously specified files have been read. In particular, the values of
variables assigned in this fashion are @emph{not} available inside a
@code{BEGIN} rule
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}),
-since such rules are run before @code{awk} begins scanning the argument list.
+because such rules are run before @command{awk} begins scanning the argument list.
@cindex dark corner
-The variable values given on the command line are processed for escape
-sequences (d.c.) (@pxref{Escape Sequences}).
-
-In some earlier implementations of @code{awk}, when a variable assignment
-occurred before any file names, the assignment would happen @emph{before}
-the @code{BEGIN} rule was executed. @code{awk}'s behavior was thus
-inconsistent; some command line assignments were available inside the
-@code{BEGIN} rule, while others were not. However,
+The variable values given on the command-line are processed for escape
+sequences (@pxref{Escape Sequences}).
+@value{DARKCORNER}
+
+In some earlier implementations of @command{awk}, when a variable assignment
+occurred before any @value{FN}s, the assignment would happen @emph{before}
+the @code{BEGIN} rule was executed. @command{awk}'s behavior was thus
+inconsistent; some command-line assignments were available inside the
+@code{BEGIN} rule, while others were not. Unfortunately,
some applications came to depend
-upon this ``feature.'' When @code{awk} was changed to be more consistent,
-the @samp{-v} option was added to accommodate applications that depended
+upon this ``feature.'' When @command{awk} was changed to be more consistent,
+the @option{-v} option was added to accommodate applications that depended
upon the old behavior.
The variable assignment feature is most useful for assigning to variables
such as @code{RS}, @code{OFS}, and @code{ORS}, which control input and
-output formats, before scanning the data files. It is also useful for
-controlling state if multiple passes are needed over a data file. For
+output formats before scanning the @value{DF}s. It is also useful for
+controlling state if multiple passes are needed over a @value{DF}. For
example:
@cindex multiple passes over data
@@ -11694,71 +15350,78 @@ awk 'pass == 1 @{ @var{pass 1 stuff} @}
pass == 2 @{ @var{pass 2 stuff} @}' pass=1 mydata pass=2 mydata
@end example
-Given the variable assignment feature, the @samp{-F} option for setting
+Given the variable assignment feature, the @option{-F} option for setting
the value of @code{FS} is not
strictly necessary. It remains for historical compatibility.
@node AWKPATH Variable, Obsolete, Other Arguments, Invoking Gawk
-@section The @code{AWKPATH} Environment Variable
-@cindex @code{AWKPATH} environment variable
-@cindex environment variable, @code{AWKPATH}
+@section The @env{AWKPATH} Environment Variable
+@cindex @env{AWKPATH} environment variable
+@cindex environment variable, @env{AWKPATH}
@cindex search path
@cindex directory search
@cindex path, search
-@cindex differences between @code{gawk} and @code{awk}
-
-The previous section described how @code{awk} program files can be named
-on the command line with the @samp{-f} option. In most @code{awk}
+@cindex search path, for source files
+@cindex differences between @command{gawk} and @command{awk}
+@ifinfo
+The previous @value{SECTION} described how @command{awk} program files can be named
+on the command-line with the @option{-f} option.
+@end ifinfo
+In most @command{awk}
implementations, you must supply a precise path name for each program
file, unless the file is in the current directory.
-
-@cindex search path, for source files
-But in @code{gawk}, if the file name supplied to the @samp{-f} option
-does not contain a @samp{/}, then @code{gawk} searches a list of
+But in @command{gawk}, if the @value{FN} supplied to the @option{-f} option
+does not contain a @samp{/}, then @command{gawk} searches a list of
directories (called the @dfn{search path}), one by one, looking for a
file with the specified name.
The search path is a string consisting of directory names
-separated by colons. @code{gawk} gets its search path from the
-@code{AWKPATH} environment variable. If that variable does not exist,
-@code{gawk} uses a default path, which is
-@samp{.:/usr/local/share/awk}.@footnote{Your version of @code{gawk}
+separated by colons. @command{gawk} gets its search path from the
+@env{AWKPATH} environment variable. If that variable does not exist,
+@command{gawk} uses a default path, which is
+@samp{.:/usr/local/share/awk}.@footnote{Your version of @command{gawk}
may use a different directory; it
-will depend upon how @code{gawk} was built and installed. The actual
-directory will be the value of @samp{$(datadir)} generated when
-@code{gawk} was configured. You probably don't need to worry about this
+will depend upon how @command{gawk} was built and installed. The actual
+directory is the value of @samp{$(datadir)} generated when
+@command{gawk} was configured. You probably don't need to worry about this
though.} (Programs written for use by
-system administrators should use an @code{AWKPATH} variable that
+system administrators should use an @env{AWKPATH} variable that
does not include the current directory, @file{.}.)
-The search path feature is particularly useful for building up libraries
-of useful @code{awk} functions. The library files can be placed in a
-standard directory that is in the default path, and then specified on
-the command line with a short file name. Otherwise, the full file name
+The search path feature is particularly useful for building libraries
+of useful @command{awk} functions. The library files can be placed in a
+standard directory in the default path and then specified on
+the command-line with a short @value{FN}. Otherwise, the full @value{FN}
would have to be typed for each file.
-By using both the @samp{--source} and @samp{-f} options, your command line
-@code{awk} programs can use facilities in @code{awk} library files.
-@xref{Library Functions, , A Library of @code{awk} Functions}.
+By using both the @option{--source} and @option{-f} options, your command-line
+@command{awk} programs can use facilities in @command{awk} library files.
+@xref{Library Functions, , A Library of @command{awk} Functions}.
+Path searching is not done if @command{gawk} is in compatibility mode.
+This is true for both @option{--traditional} and @option{--posix}.
+@xref{Options, ,Command-Line Options}.
-Path searching is not done if @code{gawk} is in compatibility mode.
-This is true for both @samp{--traditional} and @samp{--posix}.
-@xref{Options, ,Command Line Options}.
-
-@strong{Note:} if you want files in the current directory to be found,
+@strong{Note:} If you want files in the current directory to be found,
you must include the current directory in the path, either by including
-@file{.} explicitly in the path, or by writing a null entry in the
+@file{.} explicitly in the path or by writing a null entry in the
path. (A null entry is indicated by starting or ending the path with a
-colon, or by placing two colons next to each other (@samp{::}).) If the
+colon or by placing two colons next to each other (@samp{::}).) If the
current directory is not included in the path, then files cannot be
found in the current directory. This path search mechanism is identical
to the shell's.
@c someday, @cite{The Bourne Again Shell}....
-Starting with version 3.0, if @code{AWKPATH} is not defined in the
-environment, @code{gawk} will place its default search path into
+Starting with @value{PVERSION} 3.0, if @env{AWKPATH} is not defined in the
+environment, @command{gawk} places its default search path into
@code{ENVIRON["AWKPATH"]}. This makes it easy to determine
-the actual search path @code{gawk} will use.
+the actual search path that @command{gawk} will use
+from within an @command{awk} program.
+
+While you can change @code{ENVIRON["AWKPATH"]} within your @command{awk}
+program, this has no effect on the running program's behavior. This makes
+sense: the @env{AWKPATH} environment variable is used to find the program
+source files. Once your program is running, all the files have been
+found, and @command{gawk} no longer needs to use @env{AWKPATH}.
@node Obsolete, Undocumented, AWKPATH Variable, Invoking Gawk
@section Obsolete Options and/or Features
@@ -11767,72 +15430,78 @@ the actual search path @code{gawk} will use.
@cindex obsolete options
@cindex deprecated features
@cindex obsolete features
-This section describes features and/or command line options from
-previous releases of @code{gawk} that are either not available in the
-current version, or that are still supported but deprecated (meaning that
+This @value{SECTION} describes features and/or command-line options from
+previous releases of @command{gawk} that are either not available in the
+current version or that are still supported but deprecated (meaning that
they will @emph{not} be in the next release).
@c update this section for each release!
-For version @value{VERSION}.@value{PATCHLEVEL} of @code{gawk}, there are no
-command line options
-or other deprecated features from the previous version of @code{gawk}.
-@iftex
-This section
-@end iftex
-@ifinfo
-This node
-@end ifinfo
-is thus essentially a place holder,
-in case some option becomes obsolete in a future version of @code{gawk}.
+For @value{PVERSION} @value{VERSION} of @command{gawk}, there are no
+deprecated command-line options
+@c or other deprecated features
+from the previous version of @command{gawk}.
+The use of @samp{next file} (two words) for @code{nextfile} was deprecated
+in @command{gawk} 3.0 but still worked. Starting with @value{PVERSION} 3.1, the
+two word usage is no longer accepted.
+
+The process-related special files described in
+@ref{Special Process, ,Special Files for Process-Related Information},
+work as described, but
+are now considered deprecated.
+@command{gawk} prints a warning message every time they are used.
+(Use @code{PROCINFO} instead; see
+@ref{Auto-set, ,Built-in Variables That Convey Information}.)
+They will be removed from the next release of @command{gawk}.
@ignore
-@c This is pretty old news...
-The public-domain version of @code{strftime} that is distributed with
-@code{gawk} changed for the 2.14 release. The @samp{%V} conversion specifier
-that used to generate the date in VMS format was changed to @samp{%v}.
-This is because the POSIX standard for the @code{date} utility now
-specifies a @samp{%V} conversion specifier.
-@xref{Time Functions, ,Functions for Dealing with Time Stamps}, for details.
+This @value{SECTION}
+is thus essentially a place holder,
+in case some option becomes obsolete in a future version of @command{gawk}.
@end ignore
@node Undocumented, Known Bugs, Obsolete, Invoking Gawk
@section Undocumented Options and Features
@cindex undocumented features
-@display
-@i{Use the Source, Luke!}
+@cindex features, undocumented
+@cindex Skywalker, Luke
+@cindex Kenobi, Obi-Wan
+@cindex Jedi knights
+@cindex Knights, jedi
+@quotation
+@i{Use the Source, Luke!}@*
Obi-Wan
-@end display
-@sp 1
-
-This section intentionally left blank.
+@end quotation
-@c Read The Source, Luke!
+This @value{SECTION} intentionally left
+blank.
@ignore
@c If these came out in the Info file or TeX document, then they wouldn't
@c be undocumented, would they?
-@code{gawk} has one undocumented option:
+@command{gawk} has one undocumented option:
@table @code
@item -W nostalgia
@itemx --nostalgia
Print the message @code{"awk: bailing out near line 1"} and dump core.
This option was inspired by the common behavior of very early versions of
-Unix @code{awk}, and by a t--shirt.
+Unix @command{awk} and by a t--shirt.
+The message is @emph{not} subject to translation in non-English locales.
+@c so there! nyah, nyah.
@end table
-Early versions of @code{awk} used to not require any separator (either
-a newline or @samp{;}) between the rules in @code{awk} programs. Thus,
+Early versions of @command{awk} used to not require any separator (either
+a newline or @samp{;}) between the rules in @command{awk} programs. Thus,
it was common to see one-line programs like:
@example
awk '@{ sum += $1 @} END @{ print sum @}'
@end example
-@code{gawk} actually supports this, but it is purposely undocumented
-since it is considered bad style. The correct way to write such a program
+@command{gawk} actually supports this but it is purposely undocumented
+because it is considered bad style. The correct way to write such a program
is either
@example
@@ -11848,109 +15517,123 @@ awk '@{ sum += $1 @}
@end example
@noindent
-@xref{Statements/Lines, ,@code{awk} Statements Versus Lines}, for a fuller
+@xref{Statements/Lines, ,@command{awk} Statements Versus Lines}, for a fuller
explanation.
+You can insert newlines after the @samp{;} in @code{for} loops.
+This seems to have been a long-undocumented feature in Unix @command{awk}.
+
+If the environment variable @env{WHINY_USERS} exists
+when @command{gawk} is run,
+then the associative @code{for} loop will go through the array
+indices in sorted order.
+The comparison used for sorting is simple string comparison;
+any non-English or non-ASCII locales are not taken into account.
+@code{IGNORECASE} does not affect the comparison either.
+
@end ignore
@node Known Bugs, , Undocumented, Invoking Gawk
-@section Known Bugs in @code{gawk}
-@cindex bugs, known in @code{gawk}
+@section Known Bugs in @command{gawk}
+@cindex bugs, known in @command{gawk}
@cindex known bugs
@itemize @bullet
@item
-The @samp{-F} option for changing the value of @code{FS}
-(@pxref{Options, ,Command Line Options})
-is not necessary given the command line variable
+The @option{-F} option for changing the value of @code{FS}
+(@pxref{Options, ,Command-Line Options})
+is not necessary given the command-line variable
assignment feature; it remains only for backwards compatibility.
@item
-If your system actually has support for @file{/dev/fd} and the
-associated @file{/dev/stdin}, @file{/dev/stdout}, and
-@file{/dev/stderr} files, you may get different output from @code{gawk}
-than you would get on a system without those files. When @code{gawk}
-interprets these files internally, it synchronizes output to the
-standard output with output to @file{/dev/stdout}, while on a system
-with those files, the output is actually to different open files
-(@pxref{Special Files, ,Special File Names in @code{gawk}}).
-
-@item
Syntactically invalid single character programs tend to overflow
the parse stack, generating a rather unhelpful message. Such programs
-are surprisingly difficult to diagnose in the completely general case,
+are surprisingly difficult to diagnose in the completely general case
and the effort to do so really is not worth it.
@end itemize
+@ignore
+@c Try this
+@iftex
+@page
+@headings off
+@majorheading II@ @ @ Using @command{awk} and @command{gawk}
+Part II shows how to use @command{awk} and @command{gawk} for problem solving.
+There is lots of code here for you to read and learn from.
+It contains the following chapters:
+
+@itemize @bullet
+@item
+@ref{Library Functions, ,A Library of @command{awk} Functions}.
+
+@item
+@ref{Sample Programs, ,Practical @command{awk} Programs}.
+
+@end itemize
+
+@page
+@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
+@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
+@end iftex
+@end ignore
+
@node Library Functions, Sample Programs, Invoking Gawk, Top
-@chapter A Library of @code{awk} Functions
+@chapter A Library of @command{awk} Functions
+
+@ref{User-defined, ,User-Defined Functions}, describes how to write
+your own @command{awk} functions. Writing functions is important, because
+it allows you to encapsulate algorithms and program tasks in a single
+place. It simplifies programming, making program development more
+manageable, and making programs more readable.
+
+One valuable way to learn a new programming language is to @emph{read}
+programs in that language. To that end, this @value{CHAPTER}
+and @ref{Sample Programs, ,Practical @command{awk} Programs},
+provide a good-sized body of code for you to read,
+and hopefully, to learn from.
@c 2e: USE TEXINFO-2 FUNCTION DEFINITION STUFF!!!!!!!!!!!!!
-This chapter presents a library of useful @code{awk} functions. The
-sample programs presented later
-(@pxref{Sample Programs, ,Practical @code{awk} Programs})
+This @value{CHAPTER} presents a library of useful @command{awk} functions.
+Many of the sample programs presented later in this @value{DOCUMENT}
use these functions.
The functions are presented here in a progression from simple to complex.
+@cindex Texinfo
@ref{Extract Program, ,Extracting Programs from Texinfo Source Files},
presents a program that you can use to extract the source code for
these example library functions and programs from the Texinfo source
for this @value{DOCUMENT}.
-(This has already been done as part of the @code{gawk} distribution.)
+(This has already been done as part of the @command{gawk} distribution.)
-If you have written one or more useful, general purpose @code{awk} functions,
-and would like to contribute them for a subsequent edition of this @value{DOCUMENT},
-please contact the author. @xref{Bugs, ,Reporting Problems and Bugs},
-for information on doing this. Don't just send code, as you will be
-required to either place your code in the public domain,
-publish it under the GPL (@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE}),
-or assign the copyright in it to the Free Software Foundation.
-
-@menu
-* Portability Notes:: What to do if you don't have @code{gawk}.
-* Nextfile Function:: Two implementations of a @code{nextfile}
- function.
-* Assert Function:: A function for assertions in @code{awk}
- programs.
-* Round Function:: A function for rounding if @code{sprintf} does
- not do it correctly.
-* Ordinal Functions:: Functions for using characters as numbers and
- vice versa.
-* Join Function:: A function to join an array into a string.
-* Mktime Function:: A function to turn a date into a timestamp.
-* Gettimeofday Function:: A function to get formatted times.
-* Filetrans Function:: A function for handling data file transitions.
-* Getopt Function:: A function for processing command line
- arguments.
-* Passwd Functions:: Functions for getting user information.
-* Group Functions:: Functions for getting group information.
-* Library Names:: How to best name private global variables in
- library functions.
-@end menu
+If you have written one or more useful, general purpose @command{awk} functions
+and would like to contribute them to the author's collection of @command{awk}
+programs, see
+@ref{How To Contribute, ,How to Contribute}, for more information.
-@node Portability Notes, Nextfile Function, Library Functions, Library Functions
-@section Simulating @code{gawk}-specific Features
@cindex portability issues
-
-The programs in this chapter and in
-@ref{Sample Programs, ,Practical @code{awk} Programs},
-freely use features that are specific to @code{gawk}.
-This section briefly discusses how you can rewrite these programs for
-different implementations of @code{awk}.
+The programs in this @value{CHAPTER} and in
+@ref{Sample Programs, ,Practical @command{awk} Programs},
+freely use features that are @command{gawk}-specific.
+It is straightforward to rewrite these programs for
+different implementations of @command{awk}.
Diagnostic error messages are sent to @file{/dev/stderr}.
Use @samp{| "cat 1>&2"} instead of @samp{> "/dev/stderr"}, if your system
-does not have a @file{/dev/stderr}, or if you cannot use @code{gawk}.
+does not have a @file{/dev/stderr} or if you cannot use @command{gawk}.
A number of programs use @code{nextfile}
-(@pxref{Nextfile Statement, ,The @code{nextfile} Statement}),
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement})
to skip any remaining input in the input file.
@ref{Nextfile Function, ,Implementing @code{nextfile} as a Function},
-shows you how to write a function that will do the same thing.
-
-Finally, some of the programs choose to ignore upper-case and lower-case
-distinctions in their input. They do this by assigning one to @code{IGNORECASE}.
-You can achieve the same effect by adding the following rule to the
+shows you how to write a function that does the same thing.
+
+@c 12/2000: Thanks to Nelson Beebe for pointing out the output issue.
+Finally, some of the programs choose to ignore upper- and lowercase
+distinctions in their input. They do so by assigning one to @code{IGNORECASE}.
+You can achieve almost the same effect@footnote{The effects are
+not identical. Output of the transformed
+record will be in all lowercase, while @code{IGNORECASE} preserves the original
+contents of the input record.} by adding the following rule to the
beginning of the program:
@example
@@ -11960,174 +15643,302 @@ beginning of the program:
@noindent
Also, verify that all regexp and string constants used in
-comparisons only use lower-case letters.
+comparisons only use lowercase letters.
+
+@menu
+* Library Names:: How to best name private global variables in
+ library functions.
+* General Functions:: Functions that are of general use.
+* Data File Management:: Functions for managing command-line data
+ files.
+* Getopt Function:: A function for processing command-line
+ arguments.
+* Passwd Functions:: Functions for getting user information.
+* Group Functions:: Functions for getting group information.
+@end menu
+
+@node Library Names, General Functions, Library Functions, Library Functions
+@section Naming Library Function Global Variables
+
+@cindex names, use of
+@cindex namespace issues in @command{awk}
+@cindex documenting @command{awk} programs
+@cindex programs, documenting
+Due to the way the @command{awk} language evolved, variables are either
+@dfn{global} (usable by the entire program) or @dfn{local} (usable just by
+a specific function). There is no intermediate state analogous to
+@code{static} variables in C.
+
+Library functions often need to have global variables that they can use to
+preserve state information between calls to the function---for example,
+@code{getopt}'s variable @code{_opti}
+(@pxref{Getopt Function, ,Processing Command-Line Options}).
+Such variables are called @dfn{private}, since the only functions that need to
+use them are the ones in the library.
+
+When writing a library function, you should try to choose names for your
+private variables that will not conflict with any variables used by
+either another library function or a user's main program. For example, a
+name like @samp{i} or @samp{j} is not a good choice, because user programs
+often use variable names like these for their own purposes.
+
+@cindex conventions, programming
+@cindex programming conventions
+The example programs shown in this @value{CHAPTER} all start the names of their
+private variables with an underscore (@samp{_}). Users generally don't use
+leading underscores in their variable names, so this convention immediately
+decreases the chances that the variable name will be accidentally shared
+with the user's program.
+
+In addition, several of the library functions use a prefix that helps
+indicate what function or set of functions use the variables---for example,
+@code{_pw_byname} in the user database routines
+(@pxref{Passwd Functions, ,Reading the User Database}).
+This convention is recommended, since it even further decreases the
+chance of inadvertent conflict among variable names. Note that this
+convention is used equally well for variable names and for private
+function names as well.@footnote{While all the library routines could have
+been rewritten to use this convention, this was not done, in order to
+show how my own @command{awk} programming style has evolved, and to
+provide some basis for this discussion.}
+
+As a final note on variable naming, if a function makes global variables
+available for use by a main program, it is a good convention to start that
+variable's name with a capital letter---for
+example, @code{getopt}'s @code{Opterr} and @code{Optind} variables
+(@pxref{Getopt Function, ,Processing Command-Line Options}).
+The leading capital letter indicates that it is global, while the fact that
+the variable name is not all capital letters indicates that the variable is
+not one of @command{awk}'s built-in variables, such as @code{FS}.
+
+It is also important that @emph{all} variables in library
+functions that do not need to save state are, in fact, declared
+local.@footnote{@command{gawk}'s @option{--dump-variables} command-line
+option is useful for verifying this.} If this is not done, the variable
+could accidentally be used in the user's program, leading to bugs that
+are very difficult to track down:
+
+@example
+function lib_func(x, y, l1, l2)
+@{
+ @dots{}
+ @var{use variable} some_var # some_var should be local
+ @dots{} # but is not by oversight
+@}
+@end example
+
+@cindex Tcl
+A different convention, common in the Tcl community, is to use a single
+associative array to hold the values needed by the library function(s), or
+``package.'' This significantly decreases the number of actual global names
+in use. For example, the functions described in
+@ref{Passwd Functions, , Reading the User Database},
+might have used array elements @code{@w{PW_data["inited"]}}, @code{@w{PW_data["total"]}},
+@code{@w{PW_data["count"]}}, and @code{@w{PW_data["awklib"]}}, instead of
+@code{@w{_pw_inited}}, @code{@w{_pw_awklib}}, @code{@w{_pw_total}},
+and @code{@w{_pw_count}}.
+
+The conventions presented in this @value{SECTION} are exactly
+that: conventions. You are not required to write your programs this
+way---we merely recommend that you do so.
+
+@node General Functions, Data File Management, Library Names, Library Functions
+@section General Programming
+
+This @value{SECTION} presents a number of functions that are of general
+programming use.
+
+@menu
+* Nextfile Function:: Two implementations of a @code{nextfile}
+ function.
+* Assert Function:: A function for assertions in @command{awk}
+ programs.
+* Round Function:: A function for rounding if @code{sprintf} does
+ not do it correctly.
+* Cliff Random Function:: The Cliff Random Number Generator.
+* Ordinal Functions:: Functions for using characters as numbers and
+ vice versa.
+* Join Function:: A function to join an array into a string.
+* Gettimeofday Function:: A function to get formatted times.
+@end menu
-@node Nextfile Function, Assert Function, Portability Notes, Library Functions
-@section Implementing @code{nextfile} as a Function
+@node Nextfile Function, Assert Function, General Functions, General Functions
+@subsection Implementing @code{nextfile} as a Function
@cindex skipping input files
@cindex input files, skipping
The @code{nextfile} statement presented in
-@ref{Nextfile Statement, ,The @code{nextfile} Statement},
-is a @code{gawk}-specific extension. It is not available in other
-implementations of @code{awk}. This section shows two versions of a
-@code{nextfile} function that you can use to simulate @code{gawk}'s
-@code{nextfile} statement if you cannot use @code{gawk}.
+@ref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement},
+is a @command{gawk}-specific extension---it is not available in most other
+implementations of @command{awk}. This @value{SECTION} shows two versions of a
+@code{nextfile} function that you can use to simulate @command{gawk}'s
+@code{nextfile} statement if you cannot use @command{gawk}.
-Here is a first attempt at writing a @code{nextfile} function.
+A first attempt at writing a @code{nextfile} function is as follows:
@example
-@group
# nextfile --- skip remaining records in current file
-
# this should be read in before the "main" awk program
function nextfile() @{ _abandon_ = FILENAME; next @}
-
_abandon_ == FILENAME @{ next @}
-@end group
@end example
-This file should be included before the main program, because it supplies
-a rule that must be executed first. This rule compares the current data
-file's name (which is always in the @code{FILENAME} variable) to a private
-variable named @code{_abandon_}. If the file name matches, then the action
-part of the rule executes a @code{next} statement, to go on to the next
-record. (The use of @samp{_} in the variable name is a convention.
-It is discussed more fully in
+@cindex conventions, programming
+@cindex programming conventions
+Because it supplies a rule that must be executed first, this file should
+be included before the main program. This rule compares the current
+@value{DF}'s name (which is always in the @code{FILENAME} variable) to
+a private variable named @code{_abandon_}. If the @value{FN} matches,
+then the action part of the rule executes a @code{next} statement to
+go on to the next record. (The use of @samp{_} in the variable name is
+a convention. It is discussed more fully in
@ref{Library Names, , Naming Library Function Global Variables}.)
The use of the @code{next} statement effectively creates a loop that reads
-all the records from the current data file.
-Eventually, the end of the file is reached, and
-a new data file is opened, changing the value of @code{FILENAME}.
+all the records from the current @value{DF}.
+The end of the file is eventually reached and
+a new @value{DF} is opened, changing the value of @code{FILENAME}.
Once this happens, the comparison of @code{_abandon_} to @code{FILENAME}
-fails, and execution continues with the first rule of the ``real'' program.
+fails and execution continues with the first rule of the ``real'' program.
The @code{nextfile} function itself simply sets the value of @code{_abandon_}
-and then executes a @code{next} statement to start the loop
-going.@footnote{Some implementations of @code{awk} do not allow you to
-execute @code{next} from within a function body. Some other work-around
-will be necessary if you use such a version.}
-@c mawk is what we're talking about.
-
-This initial version has a subtle problem. What happens if the same data
-file is listed @emph{twice} on the command line, one right after the other,
-or even with just a variable assignment between the two occurrences of
-the file name?
-
-@c @findex nextfile
-@c do it this way, since all the indices are merged
-@cindex @code{nextfile} function
-In such a case,
-this code will skip right through the file, a second time, even though
+and then executes a @code{next} statement to start the
+loop.
+@ignore
+@c If the function can't be used on other versions of awk, this whole
+@c section is pointless, no? Sigh.
+@footnote{@command{gawk} is the only known @command{awk} implementation
+that allows you to
+execute @code{next} from within a function body. Some other workaround
+is necessary if you are not using @command{gawk}.}
+@end ignore
+
+@cindex @code{nextfile} user-defined function
+This initial version has a subtle problem.
+If the same @value{DF} is listed @emph{twice} on the commandline,
+one right after the other
+or even with just a variable assignment between them,
+this code skips right through the file, a second time, even though
it should stop when it gets to the end of the first occurrence.
-Here is a second version of @code{nextfile} that remedies this problem.
+A second version of @code{nextfile} that remedies this problem
+is shown here:
@example
@c file eg/lib/nextfile.awk
# nextfile --- skip remaining records in current file
# correctly handle successive occurrences of the same file
+@c endfile
+@ignore
+@c file eg/lib/nextfile.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May, 1993
+@c endfile
+@end ignore
+@c file eg/lib/nextfile.awk
# this should be read in before the "main" awk program
function nextfile() @{ _abandon_ = FILENAME; next @}
-@group
_abandon_ == FILENAME @{
if (FNR == 1)
_abandon_ = ""
else
next
@}
-@end group
@c endfile
@end example
-The @code{nextfile} function has not changed. It sets @code{_abandon_}
-equal to the current file name and then executes a @code{next} satement.
-The @code{next} statement reads the next record and increments @code{FNR},
-so @code{FNR} is guaranteed to have a value of at least two.
+The @code{nextfile} function has not changed. It makes @code{_abandon_}
+equal to the current @value{FN} and then executes a @code{next} statement.
+The @code{next} statement reads the next record and increments @code{FNR}
+so that @code{FNR} is guaranteed to have a value of at least two.
However, if @code{nextfile} is called for the last record in the file,
-then @code{awk} will close the current data file and move on to the next
-one. Upon doing so, @code{FILENAME} will be set to the name of the new file,
-and @code{FNR} will be reset to one. If this next file is the same as
-the previous one, @code{_abandon_} will still be equal to @code{FILENAME}.
-However, @code{FNR} will be equal to one, telling us that this is a new
-occurrence of the file, and not the one we were reading when the
+then @command{awk} closes the current @value{DF} and moves on to the next
+one. Upon doing so, @code{FILENAME} is set to the name of the new file
+and @code{FNR} is reset to one. If this next file is the same as
+the previous one, @code{_abandon_} is still equal to @code{FILENAME}.
+However, @code{FNR} is equal to one, telling us that this is a new
+occurrence of the file and not the one we were reading when the
@code{nextfile} function was executed. In that case, @code{_abandon_}
is reset to the empty string, so that further executions of this rule
-will fail (until the next time that @code{nextfile} is called).
+fail (until the next time that @code{nextfile} is called).
-If @code{FNR} is not one, then we are still in the original data file,
+If @code{FNR} is not one, then we are still in the original @value{DF}
and the program executes a @code{next} statement to skip through it.
-An important question to ask at this point is: ``Given that the
+An important question to ask at this point is: given that the
functionality of @code{nextfile} can be provided with a library file,
-why is it built into @code{gawk}?'' This is an important question. Adding
+why is it built into @command{gawk}? Adding
features for little reason leads to larger, slower programs that are
harder to maintain.
-
-The answer is that building @code{nextfile} into @code{gawk} provides
+The answer is that building @code{nextfile} into @command{gawk} provides
significant gains in efficiency. If the @code{nextfile} function is executed
-at the beginning of a large data file, @code{awk} still has to scan the entire
-file, splitting it up into records, just to skip over it. The built-in
+at the beginning of a large @value{DF}, @command{awk} still has to scan the entire
+file, splitting it up into records,
+@c at least conceptually
+just to skip over it. The built-in
@code{nextfile} can simply close the file immediately and proceed to the
-next one, saving a lot of time. This is particularly important in
-@code{awk}, since @code{awk} programs are generally I/O bound (i.e.@:
+next one, which saves a lot of time. This is particularly important in
+@command{awk}, because @command{awk} programs are generally I/O-bound (i.e.,
they spend most of their time doing input and output, instead of performing
computations).
-@node Assert Function, Round Function, Nextfile Function, Library Functions
-@section Assertions
+@node Assert Function, Round Function, Nextfile Function, General Functions
+@subsection Assertions
@cindex assertions
-@cindex @code{assert}, C version
-When writing large programs, it is often useful to be able to know
+@cindex @code{assert} C library function
+When writing large programs, it is often useful to know
that a condition or set of conditions is true. Before proceeding with a
particular computation, you make a statement about what you believe to be
the case. Such a statement is known as an
-``assertion.'' The C language provides an @code{<assert.h>} header file
+@dfn{assertion}. The C language provides an @code{<assert.h>} header file
and corresponding @code{assert} macro that the programmer can use to make
assertions. If an assertion fails, the @code{assert} macro arranges to
print a diagnostic message describing the condition that should have
been true but was not, and then it kills the program. In C, using
@code{assert} looks this:
-@c NEEDED
-@page
@example
#include <assert.h>
int myfunc(int a, double b)
@{
- assert(a <= 5 && b >= 17);
+ assert(a <= 5 && b >= 17.1);
@dots{}
@}
@end example
-If the assertion failed, the program would print a message similar to
-this:
+If the assertion fails, the program prints a message similar to this:
@example
-prog.c:5: assertion failed: a <= 5 && b >= 17
+prog.c:5: assertion failed: a <= 5 && b >= 17.1
@end example
-@findex assert
-The ANSI C language makes it possible to turn the condition into a string for use
-in printing the diagnostic message. This is not possible in @code{awk}, so
+@cindex @code{assert} user-defined function
+The C language makes it possible to turn the condition into a string for use
+in printing the diagnostic message. This is not possible in @command{awk}, so
this @code{assert} function also requires a string version of the condition
that is being tested.
+Following is the function:
@example
-@c @group
@c file eg/lib/assert.awk
# assert --- assert that a condition is true. Otherwise exit.
+@c endfile
+@ignore
+@c file eg/lib/assert.awk
+
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May, 1993
+@c endfile
+@end ignore
+@c file eg/lib/assert.awk
function assert(condition, string)
@{
if (! condition) @{
@@ -12138,85 +15949,90 @@ function assert(condition, string)
@}
@}
+@group
END @{
if (_assert_exit)
exit 1
@}
+@end group
@c endfile
-@c @end group
@end example
The @code{assert} function tests the @code{condition} parameter. If it
is false, it prints a message to standard error, using the @code{string}
parameter to describe the failed condition. It then sets the variable
-@code{_assert_exit} to one, and executes the @code{exit} statement.
+@code{_assert_exit} to one and executes the @code{exit} statement.
The @code{exit} statement jumps to the @code{END} rule. If the @code{END}
-rules finds @code{_assert_exit} to be true, then it exits immediately.
+rules finds @code{_assert_exit} to be true, it then exits immediately.
-The purpose of the @code{END} rule with its test is to
+The purpose of the test in the @code{END} rule is to
keep any other @code{END} rules from running. When an assertion fails, the
program should exit immediately.
-If no assertions fail, then @code{_assert_exit} will still be
+If no assertions fail, then @code{_assert_exit} is still
false when the @code{END} rule is run normally, and the rest of the
-program's @code{END} rules will execute.
+program's @code{END} rules execute.
For all of this to work correctly, @file{assert.awk} must be the
-first source file read by @code{awk}.
-
-@c NEEDED
-@page
-You would use this function in your programs this way:
+first source file read by @command{awk}.
+The function can be used in a program in the following way:
@example
function myfunc(a, b)
@{
- assert(a <= 5 && b >= 17, "a <= 5 && b >= 17")
+ assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1")
@dots{}
@}
@end example
@noindent
-If the assertion failed, you would see a message like this:
+If the assertion fails, you see a message similar to the following:
@example
-mydata:1357: assertion failed: a <= 5 && b >= 17
+mydata:1357: assertion failed: a <= 5 && b >= 17.1
@end example
-There is a problem with this version of @code{assert}, that it may not
-be possible to work around with standard @code{awk}.
+There is a small problem with this version of @code{assert}.
An @code{END} rule is automatically added
to the program calling @code{assert}. Normally, if a program consists
of just a @code{BEGIN} rule, the input files and/or standard input are
-not read. However, now that the program has an @code{END} rule, @code{awk}
-will attempt to read the input data files, or standard input
+not read. However, now that the program has an @code{END} rule, @command{awk}
+attempts to read the input @value{DF}s or standard input
(@pxref{Using BEGIN/END, , Startup and Cleanup Actions}),
-most likely causing the program to hang, waiting for input.
+most likely causing the program to hang as it waits for input.
-@node Round Function, Ordinal Functions, Assert Function, Library Functions
-@section Rounding Numbers
+There is a simple workaround to this:
+make sure the @code{BEGIN} rule always ends
+with an @code{exit} statement.
+
+@node Round Function, Cliff Random Function, Assert Function, General Functions
+@subsection Rounding Numbers
@cindex rounding
The way @code{printf} and @code{sprintf}
(@pxref{Printf, , Using @code{printf} Statements for Fancier Printing})
-do rounding will often depend
-upon the system's C @code{sprintf} subroutine.
-On many machines,
-@code{sprintf} rounding is ``unbiased,'' which means it doesn't always
-round a trailing @samp{.5} up, contrary to naive expectations. In unbiased
-rounding, @samp{.5} rounds to even, rather than always up, so 1.5 rounds to
-2 but 4.5 rounds to 4.
-The result is that if you are using a format that does
-rounding (e.g., @code{"%.0f"}) you should check what your system does.
-The following function does traditional rounding;
-it might be useful if your awk's @code{printf} does unbiased rounding.
-
-@findex round
+perform rounding often depends upon the system's C @code{sprintf}
+subroutine. On many machines, @code{sprintf} rounding is ``unbiased,''
+which means it doesn't always round a trailing @samp{.5} up, contrary
+to naive expectations. In unbiased rounding, @samp{.5} rounds to even,
+rather than always up, so 1.5 rounds to 2 but 4.5 rounds to 4. This means
+that if you are using a format that does rounding (e.g., @code{"%.0f"}),
+you should check what your system does. The following function does
+traditional rounding; it might be useful if your awk's @code{printf}
+does unbiased rounding:
+
+@cindex @code{round} user-defined function
@example
@c file eg/lib/round.awk
# round --- do normal rounding
+@c endfile
+@ignore
+@c file eg/lib/round.awk
#
-# Arnold Robbins, arnold@@gnu.org, August, 1996
-# Public Domain
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# August, 1996
+@c endfile
+@end ignore
+@c file eg/lib/round.awk
function round(x, ival, aval, fraction)
@{
ival = int(x) # integer part, int() truncates
@@ -12229,12 +16045,10 @@ function round(x, ival, aval, fraction)
aval = -x # absolute value
ival = int(aval)
fraction = aval - ival
-@group
if (fraction >= .5)
return int(x) - 1 # -2.5 --> -3
else
return int(x) # -2.3 --> -2
-@end group
@} else @{
fraction = x - ival
if (fraction >= .5)
@@ -12249,45 +16063,86 @@ function round(x, ival, aval, fraction)
@c endfile
@end example
-@node Ordinal Functions, Join Function, Round Function, Library Functions
-@section Translating Between Characters and Numbers
+@node Cliff Random Function, Ordinal Functions, Round Function, General Functions
+@subsection The Cliff Random Number Generator
+@cindex random numbers, Cliff
+@cindex Cliff random numbers
+
+The Cliff random number
+generator@footnote{@uref{http://mathworld.wolfram.com/CliffRandomNumberGenerator.hmtl}}
+is a very simple random number generator that ``passes the noise sphere test
+for randomness by showing no structure.''
+It is easily programmed, in less than 10 lines of @command{awk} code:
+
+@cindex @code{cliff_rand} user-defined function
+@example
+@c file eg/lib/cliff_rand.awk
+# cliff_rand.awk --- generate Cliff random numbers
+@c endfile
+@ignore
+@c file eg/lib/cliff_rand.awk
+#
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# December 2000
+
+@c endfile
+@end ignore
+@c file eg/lib/cliff_rand.awk
+BEGIN @{ _cliff_seed = 0.1 @}
+
+function cliff_rand()
+@{
+ _cliff_seed = (100 * log(_cliff_seed)) % 1
+ if (_cliff_seed < 0)
+ _cliff_seed = - _cliff_seed
+ return _cliff_seed
+@}
+@c endfile
+@end example
+
+This algorithm requires an initial ``seed'' of 0.1. Each new value
+uses the current seed as input for the calculation.
+If the built-in @code{rand} function
+(@pxref{Numeric Functions})
+isn't random enough, you might try using this function instead.
+
+@node Ordinal Functions, Join Function, Cliff Random Function, General Functions
+@subsection Translating Between Characters and Numbers
@cindex numeric character values
@cindex values of characters as numbers
-One commercial implementation of @code{awk} supplies a built-in function,
+One commercial implementation of @command{awk} supplies a built-in function,
@code{ord}, which takes a character and returns the numeric value for that
character in the machine's character set. If the string passed to
@code{ord} has more than one character, only the first one is used.
The inverse of this function is @code{chr} (from the function of the same
name in Pascal), which takes a number and returns the corresponding character.
+Both functions are written very nicely in @command{awk}; there is no real
+reason to build them into the @command{awk} interpreter:
-Both functions can be written very nicely in @code{awk}; there is no real
-reason to build them into the @code{awk} interpreter.
-
-@findex ord
-@findex chr
+@cindex @code{ord} user-defined function
+@cindex @code{chr} user-defined function
@example
-@group
@c file eg/lib/ord.awk
# ord.awk --- do ord and chr
-#
+
# Global identifiers:
# _ord_: numerical values indexed by characters
# _ord_init: function to initialize _ord_
+@c endfile
+@ignore
+@c file eg/lib/ord.awk
#
-# Arnold Robbins
-# arnold@@gnu.org
-# Public Domain
+# Arnold Robbins, arnold@@gnu.org, Public Domain
# 16 January, 1992
# 20 July, 1992, revised
-BEGIN @{ _ord_init() @}
@c endfile
-@end group
-
-@c @group
+@end ignore
@c file eg/lib/ord.awk
+BEGIN @{ _ord_init() @}
+
function _ord_init( low, high, i, t)
@{
low = sprintf("%c", 7) # BEL is ascii 7
@@ -12309,33 +16164,32 @@ function _ord_init( low, high, i, t)
@}
@}
@c endfile
-@c @end group
@end example
-@cindex character sets
+@cindex character sets (machine character encodings)
@cindex character encodings
@cindex ASCII
@cindex EBCDIC
@cindex mark parity
Some explanation of the numbers used by @code{chr} is worthwhile.
The most prominent character set in use today is ASCII. Although an
-eight-bit byte can hold 256 distinct values (from zero to 255), ASCII only
-defines characters that use the values from zero to 127.@footnote{ASCII
+eight-bit byte can hold 256 distinct values (from 0 to 255), ASCII only
+defines characters that use the values from 0 to 127.@footnote{ASCII
has been extended in many countries to use the values from 128 to 255
for country-specific characters. If your system uses these extensions,
-you can simplify @code{_ord_init} to simply loop from zero to 255.}
-At least one computer manufacturer that we know of
+you can simplify @code{_ord_init} to simply loop from 0 to 255.}
+In the now distant past,
+at least one minicomputer manufacturer
@c Pr1me, blech
-uses ASCII, but with mark parity, meaning that the leftmost bit in the byte
-is always one. What this means is that on those systems, characters
+used ASCII, but with mark parity, meaning that the leftmost bit in the byte
+is always 1. This means that on those systems, characters
have numeric values from 128 to 255.
Finally, large mainframe systems use the EBCDIC character set, which
uses all 256 values.
While there are other character sets in use on some older systems,
-they are not really worth worrying about.
+they are not really worth worrying about:
@example
-@group
@c file eg/lib/ord.awk
function ord(str, c)
@{
@@ -12343,21 +16197,14 @@ function ord(str, c)
c = substr(str, 1, 1)
return _ord_[c]
@}
-@c endfile
-@end group
-@group
-@c file eg/lib/ord.awk
function chr(c)
@{
# force c to be numeric by adding 0
return sprintf("%c", c + 0)
@}
@c endfile
-@end group
-@group
-@c file eg/lib/ord.awk
#### test code ####
# BEGIN \
# @{
@@ -12369,41 +16216,45 @@ function chr(c)
# @}
# @}
@c endfile
-@end group
@end example
-An obvious improvement to these functions would be to move the code for the
+An obvious improvement to these functions is to move the code for the
@code{@w{_ord_init}} function into the body of the @code{BEGIN} rule. It was
written this way initially for ease of development.
-
-There is a ``test program'' in a @code{BEGIN} rule, for testing the
+There is a ``test program'' in a @code{BEGIN} rule, to test the
function. It is commented out for production use.
-@node Join Function, Mktime Function, Ordinal Functions, Library Functions
-@section Merging an Array Into a String
+@node Join Function, Gettimeofday Function, Ordinal Functions, General Functions
+@subsection Merging an Array into a String
@cindex merging strings
When doing string processing, it is often useful to be able to join
all the strings in an array into one long string. The following function,
@code{join}, accomplishes this task. It is used later in several of
the application programs
-(@pxref{Sample Programs, ,Practical @code{awk} Programs}).
+(@pxref{Sample Programs, ,Practical @command{awk} Programs}).
-Good function design is important; this function needs to be general, but it
+Good function design is important; this function needs to be general but it
should also have a reasonable default behavior. It is called with an array
-and the beginning and ending indices of the elements in the array to be
+as well as the beginning and ending indices of the elements in the array to be
merged. This assumes that the array indices are numeric---a reasonable
assumption since the array was likely created with @code{split}
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}):
-@findex join
+@cindex @code{join} user-defined function
@example
-@group
@c file eg/lib/join.awk
# join.awk --- join an array into a string
+@c endfile
+@ignore
+@c file eg/lib/join.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/lib/join.awk
function join(array, start, end, sep, result, i)
@{
if (sep == "")
@@ -12416,368 +16267,50 @@ function join(array, start, end, sep, result, i)
return result
@}
@c endfile
-@end group
@end example
An optional additional argument is the separator to use when joining the
strings back together. If the caller supplies a non-empty value,
-@code{join} uses it. If it is not supplied, it will have a null
+@code{join} uses it; if it is not supplied, it has a null
value. In this case, @code{join} uses a single blank as a default
separator for the strings. If the value is equal to @code{SUBSEP},
then @code{join} joins the strings with no separator between them.
@code{SUBSEP} serves as a ``magic'' value to indicate that there should
-be no separation between the component strings.
-
-It would be nice if @code{awk} had an assignment operator for concatenation.
+be no separation between the component strings.@footnote{It would
+be nice if @command{awk} had an assignment operator for concatenation.
The lack of an explicit operator for concatenation makes string operations
-more difficult than they really need to be.
-
-@node Mktime Function, Gettimeofday Function, Join Function, Library Functions
-@section Turning Dates Into Timestamps
-
-The @code{systime} function built in to @code{gawk}
-returns the current time of day as
-a timestamp in ``seconds since the Epoch.'' This timestamp
-can be converted into a printable date of almost infinitely variable
-format using the built-in @code{strftime} function.
-(For more information on @code{systime} and @code{strftime},
-@pxref{Time Functions, ,Functions for Dealing with Time Stamps}.)
-
-@cindex converting dates to timestamps
-@cindex dates, converting to timestamps
-@cindex timestamps, converting from dates
-An interesting but difficult problem is to convert a readable representation
-of a date back into a timestamp. The ANSI C library provides a @code{mktime}
-function that does the basic job, converting a canonical representation of a
-date into a timestamp.
-
-It would appear at first glance that @code{gawk} would have to supply a
-@code{mktime} built-in function that was simply a ``hook'' to the C language
-version. In fact though, @code{mktime} can be implemented entirely in
-@code{awk}.@footnote{@value{UPDATE-MONTH}: Actually, I was mistaken when
-I wrote this. The version presented here doesn't always work correctly,
-and the next major version of @code{gawk} will provide @code{mktime}
-as a built-in function.}
-@c sigh.
-
-Here is a version of @code{mktime} for @code{awk}. It takes a simple
-representation of the date and time, and converts it into a timestamp.
-
-The code is presented here intermixed with explanatory prose. In
-@ref{Extract Program, ,Extracting Programs from Texinfo Source Files},
-you will see how the Texinfo source file for this @value{DOCUMENT}
-can be processed to extract the code into a single source file.
-
-The program begins with a descriptive comment and a @code{BEGIN} rule
-that initializes a table @code{_tm_months}. This table is a two-dimensional
-array that has the lengths of the months. The first index is zero for
-regular years, and one for leap years. The values are the same for all the
-months in both kinds of years, except for February; thus the use of multiple
-assignment.
-
-@example
-@c @group
-@c file eg/lib/mktime.awk
-# mktime.awk --- convert a canonical date representation
-# into a timestamp
-# Arnold Robbins, arnold@@gnu.org, Public Domain
-# May 1993
-
-BEGIN \
-@{
- # Initialize table of month lengths
- _tm_months[0,1] = _tm_months[1,1] = 31
- _tm_months[0,2] = 28; _tm_months[1,2] = 29
- _tm_months[0,3] = _tm_months[1,3] = 31
- _tm_months[0,4] = _tm_months[1,4] = 30
- _tm_months[0,5] = _tm_months[1,5] = 31
- _tm_months[0,6] = _tm_months[1,6] = 30
- _tm_months[0,7] = _tm_months[1,7] = 31
- _tm_months[0,8] = _tm_months[1,8] = 31
- _tm_months[0,9] = _tm_months[1,9] = 30
- _tm_months[0,10] = _tm_months[1,10] = 31
- _tm_months[0,11] = _tm_months[1,11] = 30
- _tm_months[0,12] = _tm_months[1,12] = 31
-@}
-@c endfile
-@c @end group
-@end example
-
-The benefit of merging multiple @code{BEGIN} rules
-(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns})
-is particularly clear when writing library files. Functions in library
-files can cleanly initialize their own private data and also provide clean-up
-actions in private @code{END} rules.
-
-The next function is a simple one that computes whether a given year is or
-is not a leap year. If a year is evenly divisible by four, but not evenly
-divisible by 100, or if it is evenly divisible by 400, then it is a leap
-year. Thus, 1904 was a leap year, 1900 was not, but 2000 will be.
-@c Change this after the year 2000 to ``2000 was'' (:-)
-
-@findex _tm_isleap
-@example
-@group
-@c file eg/lib/mktime.awk
-# decide if a year is a leap year
-function _tm_isleap(year, ret)
-@{
- ret = (year % 4 == 0 && year % 100 != 0) ||
- (year % 400 == 0)
-
- return ret
-@}
-@c endfile
-@end group
-@end example
-
-This function is only used a few times in this file, and its computation
-could have been written @dfn{in-line} (at the point where it's used).
-Making it a separate function made the original development easier, and also
-avoids the possibility of typing errors when duplicating the code in
-multiple places.
-
-The next function is more interesting. It does most of the work of
-generating a timestamp, which is converting a date and time into some number
-of seconds since the Epoch. The caller passes an array (rather
-imaginatively named @code{a}) containing six
-values: the year including century, the month as a number between one and 12,
-the day of the month, the hour as a number between zero and 23, the minute in
-the hour, and the seconds within the minute.
-
-The function uses several local variables to precompute the number of
-seconds in an hour, seconds in a day, and seconds in a year. Often,
-similar C code simply writes out the expression in-line, expecting the
-compiler to do @dfn{constant folding}. E.g., most C compilers would
-turn @samp{60 * 60} into @samp{3600} at compile time, instead of recomputing
-it every time at run time. Precomputing these values makes the
-function more efficient.
-
-@findex _tm_addup
-@example
-@c @group
-@c file eg/lib/mktime.awk
-# convert a date into seconds
-function _tm_addup(a, total, yearsecs, daysecs,
- hoursecs, i, j)
-@{
- hoursecs = 60 * 60
- daysecs = 24 * hoursecs
- yearsecs = 365 * daysecs
-
- total = (a[1] - 1970) * yearsecs
-
-@group
- # extra day for leap years
- for (i = 1970; i < a[1]; i++)
- if (_tm_isleap(i))
- total += daysecs
-@end group
-
-@group
- j = _tm_isleap(a[1])
- for (i = 1; i < a[2]; i++)
- total += _tm_months[j, i] * daysecs
-@end group
-
- total += (a[3] - 1) * daysecs
- total += a[4] * hoursecs
- total += a[5] * 60
- total += a[6]
-
- return total
-@}
-@c endfile
-@c @end group
-@end example
-
-The function starts with a first approximation of all the seconds between
-Midnight, January 1, 1970,@footnote{This is the Epoch on POSIX systems.
-It may be different on other systems.} and the beginning of the current
-year. It then goes through all those years, and for every leap year,
-adds an additional day's worth of seconds.
-
-The variable @code{j} holds either one or zero, if the current year is or is not
-a leap year.
-For every month in the current year prior to the current month, it adds
-the number of seconds in the month, using the appropriate entry in the
-@code{_tm_months} array.
-
-Finally, it adds in the seconds for the number of days prior to the current
-day, and the number of hours, minutes, and seconds in the current day.
-
-The result is a count of seconds since January 1, 1970. This value is not
-yet what is needed though. The reason why is described shortly.
-
-The main @code{mktime} function takes a single character string argument.
-This string is a representation of a date and time in a ``canonical''
-(fixed) form. This string should be
-@code{"@var{year} @var{month} @var{day} @var{hour} @var{minute} @var{second}"}.
-
-@findex mktime
-@example
-@c @group
-@c file eg/lib/mktime.awk
-# mktime --- convert a date into seconds,
-# compensate for time zone
-
-function mktime(str, res1, res2, a, b, i, j, t, diff)
-@{
- i = split(str, a, " ") # don't rely on FS
-
- if (i != 6)
- return -1
-
- # force numeric
- for (j in a)
- a[j] += 0
-
-@group
- # validate
- if (a[1] < 1970 ||
- a[2] < 1 || a[2] > 12 ||
- a[3] < 1 || a[3] > 31 ||
- a[4] < 0 || a[4] > 23 ||
- a[5] < 0 || a[5] > 59 ||
- a[6] < 0 || a[6] > 60 )
- return -1
-@end group
-
- res1 = _tm_addup(a)
- t = strftime("%Y %m %d %H %M %S", res1)
-
- if (_tm_debug)
- printf("(%s) -> (%s)\n", str, t) > "/dev/stderr"
+more difficult than they really need to be.}
- split(t, b, " ")
- res2 = _tm_addup(b)
-
- diff = res1 - res2
-
- if (_tm_debug)
- printf("diff = %d seconds\n", diff) > "/dev/stderr"
-
- res1 += diff
-
- return res1
-@}
-@c endfile
-@c @end group
-@end example
-
-The function first splits the string into an array, using spaces and tabs as
-separators. If there are not six elements in the array, it returns an
-error, signaled as the value @minus{}1.
-Next, it forces each element of the array to be numeric, by adding zero to it.
-The following @samp{if} statement then makes sure that each element is
-within an allowable range. (This checking could be extended further, e.g.,
-to make sure that the day of the month is within the correct range for the
-particular month supplied.) All of this is essentially preliminary set-up
-and error checking.
-
-Recall that @code{_tm_addup} generated a value in seconds since Midnight,
-January 1, 1970. This value is not directly usable as the result we want,
-@emph{since the calculation does not account for the local timezone}. In other
-words, the value represents the count in seconds since the Epoch, but only
-for UTC (Universal Coordinated Time). If the local timezone is east or west
-of UTC, then some number of hours should be either added to, or subtracted from
-the resulting timestamp.
-
-For example, 6:23 p.m. in Atlanta, Georgia (USA), is normally five hours west
-of (behind) UTC. It is only four hours behind UTC if daylight savings
-time is in effect.
-If you are calling @code{mktime} in Atlanta, with the argument
-@code{@w{"1993 5 23 18 23 12"}}, the result from @code{_tm_addup} will be
-for 6:23 p.m. UTC, which is only 2:23 p.m. in Atlanta. It is necessary to
-add another four hours worth of seconds to the result.
-
-How can @code{mktime} determine how far away it is from UTC? This is
-surprisingly easy. The returned timestamp represents the time passed to
-@code{mktime} @emph{as UTC}. This timestamp can be fed back to
-@code{strftime}, which will format it as a @emph{local} time; i.e.@: as
-if it already had the UTC difference added in to it. This is done by
-giving @code{@w{"%Y %m %d %H %M %S"}} to @code{strftime} as the format
-argument. It returns the computed timestamp in the original string
-format. The result represents a time that accounts for the UTC
-difference. When the new time is converted back to a timestamp, the
-difference between the two timestamps is the difference (in seconds)
-between the local timezone and UTC. This difference is then added back
-to the original result. An example demonstrating this is presented below.
-
-Finally, there is a ``main'' program for testing the function.
-
-@example
-@c there used to be a blank line after the getline,
-@c squished out for page formatting reasons
-@c @group
-@c file eg/lib/mktime.awk
-BEGIN @{
- if (_tm_test) @{
- printf "Enter date as yyyy mm dd hh mm ss: "
- getline _tm_test_date
- t = mktime(_tm_test_date)
- r = strftime("%Y %m %d %H %M %S", t)
- printf "Got back (%s)\n", r
- @}
-@}
-@c endfile
-@c @end group
-@end example
-
-The entire program uses two variables that can be set on the command
-line to control debugging output and to enable the test in the final
-@code{BEGIN} rule. Here is the result of a test run. (Note that debugging
-output is to standard error, and test output is to standard output.)
-
-@example
-@c @group
-$ gawk -f mktime.awk -v _tm_test=1 -v _tm_debug=1
-@print{} Enter date as yyyy mm dd hh mm ss: 1993 5 23 15 35 10
-@error{} (1993 5 23 15 35 10) -> (1993 05 23 11 35 10)
-@error{} diff = 14400 seconds
-@print{} Got back (1993 05 23 15 35 10)
-@c @end group
-@end example
-
-The time entered was 3:35 p.m. (15:35 on a 24-hour clock), on May 23, 1993.
-The first line
-of debugging output shows the resulting time as UTC---four hours ahead of
-the local time zone. The second line shows that the difference is 14400
-seconds, which is four hours. (The difference is only four hours, since
-daylight savings time is in effect during May.)
-The final line of test output shows that the timezone compensation
-algorithm works; the returned time is the same as the entered time.
-
-This program does not solve the general problem of turning an arbitrary date
-representation into a timestamp. That problem is very involved. However,
-the @code{mktime} function provides a foundation upon which to build. Other
-software can convert month names into numeric months, and AM/PM times into
-24-hour clocks, to generate the ``canonical'' format that @code{mktime}
-requires.
-
-@node Gettimeofday Function, Filetrans Function, Mktime Function, Library Functions
-@section Managing the Time of Day
+@node Gettimeofday Function, , Join Function, General Functions
+@subsection Managing the Time of Day
@cindex formatted timestamps
@cindex timestamps, formatted
The @code{systime} and @code{strftime} functions described in
-@ref{Time Functions, ,Functions for Dealing with Time Stamps},
+@ref{Time Functions, ,Using @command{gawk}'s Timestamp Functions},
provide the minimum functionality necessary for dealing with the time of day
in human readable form. While @code{strftime} is extensive, the control
formats are not necessarily easy to remember or intuitively obvious when
reading a program.
The following function, @code{gettimeofday}, populates a user-supplied array
-with pre-formatted time information. It returns a string with the current
-time formatted in the same way as the @code{date} utility.
+with preformatted time information. It returns a string with the current
+time formatted in the same way as the @command{date} utility:
-@findex gettimeofday
+@cindex @code{gettimeofday} user-defined function
@example
-@c @group
@c file eg/lib/gettime.awk
-# gettimeofday --- get the time of day in a usable format
+# gettimeofday.awk --- get the time of day in a usable format
+@c endfile
+@ignore
+@c file eg/lib/gettime.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain, May 1993
#
+@c endfile
+@end ignore
+@c file eg/lib/gettime.awk
+
# Returns a string in the format of output of date(1)
# Populates the array argument time with individual values:
# time["second"] -- seconds (0 - 59)
@@ -12788,17 +16321,17 @@ time formatted in the same way as the @code{date} utility.
# time["month"] -- month of year (1 - 12)
# time["monthname"] -- name of the month
# time["shortmonth"] -- short name of the month
-# time["year"] -- year within century (0 - 99)
-# time["fullyear"] -- year with century (19xx or 20xx)
+# time["year"] -- year modulo 100 (0 - 99)
+# time["fullyear"] -- full year
# time["weekday"] -- day of week (Sunday = 0)
# time["altweekday"] -- day of week (Monday = 0)
-# time["weeknum"] -- week number, Sunday first day
-# time["altweeknum"] -- week number, Monday first day
# time["dayname"] -- name of weekday
# time["shortdayname"] -- short name of weekday
# time["yearday"] -- day of year (0 - 365)
# time["timezone"] -- abbreviation of timezone name
# time["ampm"] -- AM or PM designation
+# time["weeknum"] -- week number, Sunday first day
+# time["altweeknum"] -- week number, Monday first day
function gettimeofday(time, ret, now, i)
@{
@@ -12809,8 +16342,7 @@ function gettimeofday(time, ret, now, i)
ret = strftime("%a %b %d %H:%M:%S %Z %Y", now)
# clear out target array
- for (i in time)
- delete time[i]
+ delete time
# fill in values, force numeric values to be
# numeric by adding 0
@@ -12843,35 +16375,46 @@ The string indices are easier to use and read than the various formats
required by @code{strftime}. The @code{alarm} program presented in
@ref{Alarm Program, ,An Alarm Clock Program},
uses this function.
+A more general design for the @code{gettimeofday} function would have
+allowed the user to supply an optional timestamp value to use instead
+of the current time.
-@c exercise!!!
-The @code{gettimeofday} function is presented above as it was written. A
-more general design for this function would have allowed the user to supply
-an optional timestamp value that would have been used instead of the current
-time.
+@node Data File Management, Getopt Function, General Functions, Library Functions
+@section @value{DDF} Management
+
+This @value{SECTION} presents functions that are useful for managing
+command-line datafiles.
-@node Filetrans Function, Getopt Function, Gettimeofday Function, Library Functions
-@section Noting Data File Boundaries
+@menu
+* Filetrans Function:: A function for handling data file transitions.
+* Rewind Function:: A function for rereading the current file.
+* File Checking:: Checking that data files are readable.
+* Ignoring Assigns:: Treating assignments as file names.
+@end menu
-@cindex per file initialization and clean-up
+@node Filetrans Function, Rewind Function, Data File Management, Data File Management
+@subsection Noting @value{DDF} Boundaries
+
+@cindex per file initialization and cleanup
The @code{BEGIN} and @code{END} rules are each executed exactly once, at
-the beginning and end respectively of your @code{awk} program
+the beginning and end of your @command{awk} program, respectively
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
-We (the @code{gawk} authors) once had a user who mistakenly thought that the
-@code{BEGIN} rule was executed at the beginning of each data file and the
-@code{END} rule was executed at the end of each data file. When informed
+We (the @command{gawk} authors) once had a user who mistakenly thought that the
+@code{BEGIN} rule is executed at the beginning of each @value{DF} and the
+@code{END} rule is executed at the end of each @value{DF}. When informed
that this was not the case, the user requested that we add new special
-patterns to @code{gawk}, named @code{BEGIN_FILE} and @code{END_FILE}, that
+patterns to @command{gawk}, named @code{BEGIN_FILE} and @code{END_FILE}, that
would have the desired behavior. He even supplied us the code to do so.
-However, after a little thought, I came up with the following library program.
+Adding these special patterns to @command{gawk} wasn't necessary;
+the job can be done cleanly in @command{awk} itself, as illustrated
+by the following library program.
It arranges to call two user-supplied functions, @code{beginfile} and
-@code{endfile}, at the beginning and end of each data file.
+@code{endfile}, at the beginning and end of each @value{DF}.
Besides solving the problem in only nine(!) lines of code, it does so
-@emph{portably}; this will work with any implementation of @code{awk}.
+@emph{portably}; this works with any implementation of @command{awk}:
@example
-@c @group
# transfile.awk
#
# Give the user a hook for filename transitions
@@ -12879,9 +16422,9 @@ Besides solving the problem in only nine(!) lines of code, it does so
# The user must supply functions beginfile() and endfile()
# that each take the name of the file being started or
# finished, respectively.
-#
-# Arnold Robbins, arnold@@gnu.org, January 1992
-# Public Domain
+@c #
+@c # Arnold Robbins, arnold@@gnu.org, Public Domain
+@c # January 1992
FILENAME != _oldfilename \
@{
@@ -12892,49 +16435,53 @@ FILENAME != _oldfilename \
@}
END @{ endfile(FILENAME) @}
-@c @end group
@end example
This file must be loaded before the user's ``main'' program, so that the
-rule it supplies will be executed first.
+rule it supplies is executed first.
-This rule relies on @code{awk}'s @code{FILENAME} variable that
-automatically changes for each new data file. The current file name is
+This rule relies on @command{awk}'s @code{FILENAME} variable that
+automatically changes for each new @value{DF}. The current @value{FN} is
saved in a private variable, @code{_oldfilename}. If @code{FILENAME} does
-not equal @code{_oldfilename}, then a new data file is being processed, and
-it is necessary to call @code{endfile} for the old file. Since
+not equal @code{_oldfilename}, then a new @value{DF} is being processed and
+it is necessary to call @code{endfile} for the old file. Because
@code{endfile} should only be called if a file has been processed, the
program first checks to make sure that @code{_oldfilename} is not the null
-string. The program then assigns the current file name to
-@code{_oldfilename}, and calls @code{beginfile} for the file.
-Since, like all @code{awk} variables, @code{_oldfilename} will be
+string. The program then assigns the current @value{FN} to
+@code{_oldfilename} and calls @code{beginfile} for the file.
+Because, like all @command{awk} variables, @code{_oldfilename} is
initialized to the null string, this rule executes correctly even for the
-first data file.
+first @value{DF}.
-The program also supplies an @code{END} rule, to do the final processing for
-the last file. Since this @code{END} rule comes before any @code{END} rules
-supplied in the ``main'' program, @code{endfile} will be called first. Once
+The program also supplies an @code{END} rule to do the final processing for
+the last file. Because this @code{END} rule comes before any @code{END} rules
+supplied in the ``main'' program, @code{endfile} is called first. Once
again the value of multiple @code{BEGIN} and @code{END} rules should be clear.
-@findex beginfile
-@findex endfile
+@cindex @code{beginfile} user-defined function
+@cindex @code{endfile} user-defined function
This version has same problem as the first version of @code{nextfile}
(@pxref{Nextfile Function, ,Implementing @code{nextfile} as a Function}).
-If the same data file occurs twice in a row on command line, then
-@code{endfile} and @code{beginfile} will not be executed at the end of the
+If the same @value{DF} occurs twice in a row on the command line, then
+@code{endfile} and @code{beginfile} are not executed at the end of the
first pass and at the beginning of the second pass.
-This version solves the problem.
+The following version solves the problem:
@example
-@c @group
@c file eg/lib/ftrans.awk
# ftrans.awk --- handle data file transitions
#
# user supplies beginfile() and endfile() functions
+@c endfile
+@ignore
+@c file eg/lib/ftrans.awk
#
-# Arnold Robbins, arnold@@gnu.org, November 1992
-# Public Domain
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# November 1992
+@c endfile
+@end ignore
+@c file eg/lib/ftrans.awk
FNR == 1 @{
if (_filename_ != "")
endfile(_filename_)
@@ -12944,69 +16491,239 @@ FNR == 1 @{
END @{ endfile(_filename_) @}
@c endfile
-@c @end group
@end example
-In @ref{Wc Program, ,Counting Things},
-you will see how this library function can be used, and
+@ref{Wc Program, ,Counting Things},
+shows how this library function can be used and
how it simplifies writing the main program.
-@node Getopt Function, Passwd Functions, Filetrans Function, Library Functions
-@section Processing Command Line Options
+@node Rewind Function, File Checking, Filetrans Function, Data File Management
+@subsection Rereading the Current File
+
+Another request for a new built-in function was for a @code{rewind}
+function that would make it possible to reread the current file.
+The requesting user didn't want to have to use @code{getline}
+(@pxref{Getline, , Explicit Input with @code{getline}})
+inside a loop.
+
+However, as long as you are not in the @code{END} rule, it is
+quite easy to arrange to immediately close the current input file
+and then start over with it from the top.
+For lack of a better name, we'll call it @code{rewind}:
+
+@cindex @code{rewind} user-defined function
+@example
+@c file eg/lib/rewind.awk
+# rewind.awk --- rewind the current file and start over
+@c endfile
+@ignore
+@c file eg/lib/rewind.awk
+#
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# September 2000
+
+@c endfile
+@end ignore
+@c file eg/lib/rewind.awk
+function rewind( i)
+@{
+ # shift remaining arguments up
+ for (i = ARGC; i > ARGIND; i--)
+ ARGV[i] = ARGV[i-1]
+
+ # make sure gawk knows to keep going
+ ARGC++
+
+ # make current file next to get done
+ ARGV[ARGIND+1] = FILENAME
-@cindex @code{getopt}, C version
+ # do it
+ nextfile
+@}
+@c endfile
+@end example
+
+This code relies on the @code{ARGIND} variable
+(@pxref{Auto-set, ,Built-in Variables That Convey Information}),
+which is specific to @command{gawk}.
+If you are not using
+@command{gawk}, you can use ideas presented in
+@iftex
+the previous @value{SECTION}
+@end iftex
+@ifnottex
+@ref{Filetrans Function, ,Noting @value{DDF} Boundaries},
+@end ifnottex
+to either update @code{ARGIND} on your own
+or modify this code as appropriate.
+
+The @code{rewind} function also relies on the @code{nextfile} keyword
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
+@xref{Nextfile Function, ,Implementing @code{nextfile} as a Function},
+for a function version of @code{nextfile}.
+
+@node File Checking, Ignoring Assigns, Rewind Function, Data File Management
+@subsection Checking for Readable @value{DDF}s
+
+@cindex fatal errors
+@cindex readable @value{DF}s, checking
+@cindex non-readable @value{DF}s, skipping
+@cindex @value{DF}s, non-readable, skipping
+@cindex @value{DF}s, readable, checking
+Normally, if you give @command{awk} a @value{DF} that isn't readable,
+it stops with a fatal error. There are times when you
+might want to just ignore such files and keep going. You can
+do this by prepending the following program to your @command{awk}
+program:
+
+@cindex @code{readable.awk} program
+@example
+@c file eg/lib/readable.awk
+# readable.awk --- library file to skip over unreadable files
+@c endfile
+@ignore
+@c file eg/lib/readable.awk
+#
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# October 2000
+
+@c endfile
+@end ignore
+@c file eg/lib/readable.awk
+BEGIN @{
+ for (i = 1; i < ARGC; i++) @{
+ if (ARGV[i] ~ /^[A-Za-z_][A-Za-z0-9_]*=.*/ \
+ || ARGV[i] == "-")
+ continue # assignment or standard input
+ else if ((getline junk < ARGV[i]) < 0) # unreadable
+ delete ARGV[i]
+ else
+ close(ARGV[i])
+ @}
+@}
+@c endfile
+@end example
+
+@cindex fatal errors
+In @command{gawk}, the @code{getline} won't be fatal (unless
+@option{--posix} is in force).
+Removing the element from @code{ARGV} with @code{delete}
+skips the file (since it's no longer in the list).
+
+@c This doesn't handle /dev/stdin etc. Not worth the hassle to mention or fix.
+
+@node Ignoring Assigns, , File Checking, Data File Management
+@subsection Treating Assignments as @value{FFN}s
+
+Occasionally, you might not want @command{awk} to process command-line
+variable assignments
+(@pxref{Assignment Options, ,Assigning Variables on the Command Line}).
+In particular, if you have @value{FN}s that contain an @samp{=} character,
+@command{awk} treats the @value{FN} as an assignment, and does not process it.
+
+Some users have suggested an additional command-line option for @command{gawk}
+to disable command-line assignments. However, some simple programming with
+a library file does the trick:
+
+@cindex @code{noassign.awk} program
+@example
+@c file eg/lib/noassign.awk
+# noassign.awk --- library file to avoid the need for a
+# special option that disables command-line assignments
+@c endfile
+@ignore
+@c file eg/lib/noassign.awk
+#
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# October 1999
+
+@c endfile
+@end ignore
+@c file eg/lib/noassign.awk
+function disable_assigns(argc, argv, i)
+@{
+ for (i = 1; i < argc; i++)
+ if (argv[i] ~ /^[A-Za-z_][A-Za-z_0-9]*=.*/)
+ argv[i] = ("./" argv[i])
+@}
+
+BEGIN @{
+ if (No_command_assign)
+ disable_assigns(ARGC, ARGV)
+@}
+@c endfile
+@end example
+
+You then run your program this way:
+
+@example
+awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk *
+@end example
+
+The function works by looping through the arguments.
+It prepends @samp{./} to
+any argument that matches the form
+of a variable assignment, turning that argument into a @value{FN}.
+
+The use of @code{No_command_assign} allows you to disable command-line
+assignments at invocation time, by giving the variable a true value.
+When not set, it is initially zero (i.e., false), so the command-line arguments
+are left alone.
+
+@node Getopt Function, Passwd Functions, Data File Management, Library Functions
+@section Processing Command-Line Options
+
+@cindex @code{getopt} C library function
@cindex processing arguments
@cindex argument processing
-Most utilities on POSIX compatible systems take options or ``switches'' on
+Most utilities on POSIX compatible systems take options, or ``switches,'' on
the command line that can be used to change the way a program behaves.
-@code{awk} is an example of such a program
-(@pxref{Options, ,Command Line Options}).
-Often, options take @dfn{arguments}, data that the program needs to
-correctly obey the command line option. For example, @code{awk}'s
-@samp{-F} option requires a string to use as the field separator.
-The first occurrence on the command line of either @samp{--} or a
+@command{awk} is an example of such a program
+(@pxref{Options, ,Command-Line Options}).
+Often, options take @dfn{arguments}; i.e., data that the program needs to
+correctly obey the command-line option. For example, @command{awk}'s
+@option{-F} option requires a string to use as the field separator.
+The first occurrence on the command line of either @option{--} or a
string that does not begin with @samp{-} ends the options.
-Most Unix systems provide a C function named @code{getopt} for processing
-command line arguments. The programmer provides a string describing the one
-letter options. If an option requires an argument, it is followed in the
+Modern Unix systems provide a C function named @code{getopt} for processing
+command-line arguments. The programmer provides a string describing the
+one-letter options. If an option requires an argument, it is followed in the
string with a colon. @code{getopt} is also passed the
-count and values of the command line arguments, and is called in a loop.
-@code{getopt} processes the command line arguments for option letters.
+count and values of the command-line arguments and is called in a loop.
+@code{getopt} processes the command-line arguments for option letters.
Each time around the loop, it returns a single character representing the
-next option letter that it found, or @samp{?} if it found an invalid option.
+next option letter that it finds, or @samp{?} if it finds an invalid option.
When it returns @minus{}1, there are no options left on the command line.
When using @code{getopt}, options that do not take arguments can be
grouped together. Furthermore, options that take arguments require that the
-argument be present. The argument can immediately follow the option letter,
-or it can be a separate command line argument.
+argument is present. The argument can immediately follow the option letter
+or it can be a separate command-line argument.
Given a hypothetical program that takes
-three command line options, @samp{-a}, @samp{-b}, and @samp{-c}, and
-@samp{-b} requires an argument, all of the following are valid ways of
+three command-line options, @option{-a}, @option{-b}, and @option{-c}, where
+@option{-b} requires an argument, all of the following are valid ways of
invoking the program:
@example
-@c @group
prog -a -b foo -c data1 data2 data3
prog -ac -bfoo -- data1 data2 data3
prog -acbfoo data1 data2 data3
-@c @end group
@end example
Notice that when the argument is grouped with its option, the rest of
-the command line argument is considered to be the option's argument.
-In the above example, @samp{-acbfoo} indicates that all of the
-@samp{-a}, @samp{-b}, and @samp{-c} options were supplied,
-and that @samp{foo} is the argument to the @samp{-b} option.
+the argument is considered to be the option's argument.
+In this example, @option{-acbfoo} indicates that all of the
+@option{-a}, @option{-b}, and @option{-c} options were supplied,
+and that @samp{foo} is the argument to the @option{-b} option.
-@code{getopt} provides four external variables that the programmer can use.
+@code{getopt} provides four external variables that the programmer can use:
@table @code
@item optind
The index in the argument value array (@code{argv}) where the first
-non-option command line argument can be found.
+non-option command-line argument can be found.
@item optarg
The string value of the argument to an option.
@@ -13014,26 +16731,23 @@ The string value of the argument to an option.
@item opterr
Usually @code{getopt} prints an error message when it finds an invalid
option. Setting @code{opterr} to zero disables this feature. (An
-application might wish to print its own error message.)
+application might want to print its own error message.)
@item optopt
-The letter representing the command line option.
-While not usually documented, most versions supply this variable.
+The letter representing the command-line option.
+@c While not usually documented, most versions supply this variable.
@end table
-The following C fragment shows how @code{getopt} might process command line
-arguments for @code{awk}.
+The following C fragment shows how @code{getopt} might process command-line
+arguments for @command{awk}:
@example
-@group
int
main(int argc, char *argv[])
@{
@dots{}
/* print our own message */
opterr = 0;
-@end group
-@group
while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) @{
switch (c) @{
case 'f': /* file */
@@ -13056,98 +16770,100 @@ main(int argc, char *argv[])
@}
@dots{}
@}
-@end group
@end example
-As a side point, @code{gawk} actually uses the GNU @code{getopt_long}
+As a side point, @command{gawk} actually uses the GNU @code{getopt_long}
function to process both normal and GNU-style long options
-(@pxref{Options, ,Command Line Options}).
+(@pxref{Options, ,Command-Line Options}).
-The abstraction provided by @code{getopt} is very useful, and would be quite
-handy in @code{awk} programs as well. Here is an @code{awk} version of
-@code{getopt}. This function highlights one of the greatest weaknesses in
-@code{awk}, which is that it is very poor at manipulating single characters.
-Repeated calls to @code{substr} are necessary for accessing individual
-characters (@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+The abstraction provided by @code{getopt} is very useful and is quite
+handy in @command{awk} programs as well. Following is an @command{awk}
+version of @code{getopt}. This function highlights one of the
+greatest weaknesses in @command{awk}, which is that it is very poor at
+manipulating single characters. Repeated calls to @code{substr} are
+necessary for accessing individual characters
+(@pxref{String Functions, ,String Manipulation Functions}).@footnote{This
+function was written before @command{gawk} acquired the ability to
+split strings into single characters using @code{""} as the separator.
+We have left it alone, since using @code{substr} is more portable.}
-The discussion walks through the code a bit at a time.
+The discussion that follows walks through the code a bit at a time:
@example
-@c @group
@c file eg/lib/getopt.awk
-# getopt --- do C library getopt(3) function in awk
+# getopt.awk --- do C library getopt(3) function in awk
+@c endfile
+@ignore
+@c file eg/lib/getopt.awk
#
-# arnold@@gnu.org
-# Public domain
+# Arnold Robbins, arnold@@gnu.org, Public Domain
#
# Initial version: March, 1991
# Revised: May, 1993
-@group
+@c endfile
+@end ignore
+@c file eg/lib/getopt.awk
# External variables:
-# Optind -- index of ARGV for first non-option argument
+# Optind -- index in ARGV of first non-option argument
# Optarg -- string value of argument to current option
-# Opterr -- if non-zero, print our own diagnostic
+# Opterr -- if nonzero, print our own diagnostic
# Optopt -- current option letter
-@end group
-# Returns
+# Returns:
# -1 at end of options
# ? for unrecognized option
# <c> a character representing the current option
-# Private Data
-# _opti index in multi-flag option, e.g., -abc
+# Private Data:
+# _opti -- index in multi-flag option, e.g., -abc
@c endfile
-@c @end group
@end example
-The function starts out with some documentation: who wrote the code,
-and when it was revised, followed by a list of the global variables it uses,
-what the return values are and what they mean, and any global variables that
+The function starts out with
+a list of the global variables it uses,
+what the return values are, what they mean, and any global variables that
are ``private'' to this library function. Such documentation is essential
for any program, and particularly for library functions.
-@findex getopt
+The @code{getopt} function first checks that it was indeed called with a string of options
+(the @code{options} parameter). If @code{options} has a zero length,
+@code{getopt} immediately returns @minus{}1:
+
+@cindex @code{getopt} user-defined function
@example
-@c @group
@c file eg/lib/getopt.awk
-function getopt(argc, argv, options, optl, thisopt, i)
+function getopt(argc, argv, options, thisopt, i)
@{
- optl = length(options)
- if (optl == 0) # no options given
+ if (length(options) == 0) # no options given
return -1
+@group
if (argv[Optind] == "--") @{ # all done
Optind++
_opti = 0
return -1
+@end group
@} else if (argv[Optind] !~ /^-[^: \t\n\f\r\v\b]/) @{
_opti = 0
return -1
@}
@c endfile
-@c @end group
@end example
-The function first checks that it was indeed called with a string of options
-(the @code{options} parameter). If @code{options} has a zero length,
-@code{getopt} immediately returns @minus{}1.
+The next thing to check for is the end of the options. A @option{--}
+ends the command-line options, as does any command-line argument that
+does not begin with a @samp{-}. @code{Optind} is used to step through
+the array of command-line arguments; it retains its value across calls
+to @code{getopt}, because it is a global variable.
-The next thing to check for is the end of the options. A @samp{--} ends the
-command line options, as does any command line argument that does not begin
-with a @samp{-}. @code{Optind} is used to step through the array of command
-line arguments; it retains its value across calls to @code{getopt}, since it
-is a global variable.
-
-The regexp used, @code{@w{/^-[^: \t\n\f\r\v\b]/}}, is
+The regular expression that is used, @code{@w{/^-[^: \t\n\f\r\v\b]/}}, is
perhaps a bit of overkill; it checks for a @samp{-} followed by anything
that is not whitespace and not a colon.
-If the current command line argument does not match this pattern,
+If the current command-line argument does not match this pattern,
it is not an option, and it ends option processing.
@example
-@group
@c file eg/lib/getopt.awk
if (_opti == 0)
_opti = 2
@@ -13166,37 +16882,36 @@ it is not an option, and it ends option processing.
return "?"
@}
@c endfile
-@end group
@end example
-The @code{_opti} variable tracks the position in the current command line
-argument (@code{argv[Optind]}). In the case that multiple options were
-grouped together with one @samp{-} (e.g., @samp{-abx}), it is necessary
+The @code{_opti} variable tracks the position in the current command-line
+argument (@code{argv[Optind]}). If multiple options are
+grouped together with one @samp{-} (e.g., @option{-abx}), it is necessary
to return them to the user one at a time.
-If @code{_opti} is equal to zero, it is set to two, the index in the string
-of the next character to look at (we skip the @samp{-}, which is at position
-one). The variable @code{thisopt} holds the character, obtained with
-@code{substr}. It is saved in @code{Optopt} for the main program to use.
+If @code{_opti} is equal to zero, it is set to two, which is the index in
+the string of the next character to look at (we skip the @samp{-}, which
+is at position one). The variable @code{thisopt} holds the character,
+obtained with @code{substr}. It is saved in @code{Optopt} for the main
+program to use.
If @code{thisopt} is not in the @code{options} string, then it is an
-invalid option. If @code{Opterr} is non-zero, @code{getopt} prints an error
+invalid option. If @code{Opterr} is nonzero, @code{getopt} prints an error
message on the standard error that is similar to the message from the C
version of @code{getopt}.
-Since the option is invalid, it is necessary to skip it and move on to the
+Because the option is invalid, it is necessary to skip it and move on to the
next option character. If @code{_opti} is greater than or equal to the
-length of the current command line argument, then it is necessary to move on
-to the next one, so @code{Optind} is incremented and @code{_opti} is reset
+length of the current command-line argument, it is necessary to move on
+to the next argument, so @code{Optind} is incremented and @code{_opti} is reset
to zero. Otherwise, @code{Optind} is left alone and @code{_opti} is merely
incremented.
-In any case, since the option was invalid, @code{getopt} returns @samp{?}.
+In any case, because the option is invalid, @code{getopt} returns @samp{?}.
The main program can examine @code{Optopt} if it needs to know what the
-invalid option letter actually was.
+invalid option letter actually is. Continuing on:
@example
-@group
@c file eg/lib/getopt.awk
if (substr(options, i + 1, 1) == ":") @{
# get option argument
@@ -13208,19 +16923,17 @@ invalid option letter actually was.
@} else
Optarg = ""
@c endfile
-@end group
@end example
If the option requires an argument, the option letter is followed by a colon
in the @code{options} string. If there are remaining characters in the
-current command line argument (@code{argv[Optind]}), then the rest of that
-string is assigned to @code{Optarg}. Otherwise, the next command line
-argument is used (@samp{-xFOO} vs. @samp{@w{-x FOO}}). In either case,
-@code{_opti} is reset to zero, since there are no more characters left to
-examine in the current command line argument.
+current command-line argument (@code{argv[Optind]}), then the rest of that
+string is assigned to @code{Optarg}. Otherwise, the next command-line
+argument is used (@samp{-xFOO} vs.@: @samp{@w{-x FOO}}). In either case,
+@code{_opti} is reset to zero, because there are no more characters left to
+examine in the current command-line argument. Continuing:
@example
-@c @group
@c file eg/lib/getopt.awk
if (_opti == 0 || _opti >= length(argv[Optind])) @{
Optind++
@@ -13230,18 +16943,22 @@ examine in the current command line argument.
return thisopt
@}
@c endfile
-@c @end group
@end example
Finally, if @code{_opti} is either zero or greater than the length of the
-current command line argument, it means this element in @code{argv} is
+current command-line argument, it means this element in @code{argv} is
through being processed, so @code{Optind} is incremented to point to the
next element in @code{argv}. If neither condition is true, then only
@code{_opti} is incremented, so that the next option letter can be processed
on the next call to @code{getopt}.
+The @code{BEGIN} rule initializes both @code{Opterr} and @code{Optind} to one.
+@code{Opterr} is set to one, since the default behavior is for @code{getopt}
+to print a diagnostic message upon seeing an invalid option. @code{Optind}
+is set to one, since there's no reason to look at the program name, which is
+in @code{ARGV[0]}:
+
@example
-@c @group
@c file eg/lib/getopt.awk
BEGIN @{
Opterr = 1 # default is to diagnose
@@ -13259,20 +16976,12 @@ BEGIN @{
@}
@}
@c endfile
-@c @end group
@end example
-The @code{BEGIN} rule initializes both @code{Opterr} and @code{Optind} to one.
-@code{Opterr} is set to one, since the default behavior is for @code{getopt}
-to print a diagnostic message upon seeing an invalid option. @code{Optind}
-is set to one, since there's no reason to look at the program name, which is
-in @code{ARGV[0]}.
-
The rest of the @code{BEGIN} rule is a simple test program. Here is the
-result of two sample runs of the test program.
+result of two sample runs of the test program:
@example
-@group
$ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x
@print{} c = <a>, optarg = <>
@print{} c = <c>, optarg = <>
@@ -13280,9 +16989,7 @@ $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x
@print{} non-option arguments:
@print{} ARGV[3] = <bax>
@print{} ARGV[4] = <-x>
-@end group
-@group
$ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc
@print{} c = <a>, optarg = <>
@error{} x -- invalid option
@@ -13290,32 +16997,30 @@ $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc
@print{} non-option arguments:
@print{} ARGV[4] = <xyz>
@print{} ARGV[5] = <abc>
-@end group
@end example
-The first @samp{--} terminates the arguments to @code{awk}, so that it does
-not try to interpret the @samp{-a} etc. as its own options.
-
+In both runs,
+the first @option{--} terminates the arguments to @command{awk}, so that it does
+not try to interpret the @option{-a}, etc., as its own options.
Several of the sample programs presented in
-@ref{Sample Programs, ,Practical @code{awk} Programs},
+@ref{Sample Programs, ,Practical @command{awk} Programs},
use @code{getopt} to process their arguments.
@node Passwd Functions, Group Functions, Getopt Function, Library Functions
@section Reading the User Database
-@cindex @file{/dev/user}
-The @file{/dev/user} special file
-(@pxref{Special Files, ,Special File Names in @code{gawk}})
+The @code{PROCINFO} array
+(@pxref{Built-in Variables})
provides access to the current user's real and effective user and group id
numbers, and if available, the user's supplementary group set.
-However, since these are numbers, they do not provide very useful
+However, because these are numbers, they do not provide very useful
information to the average user. There needs to be some way to find the
user information associated with the user and group numbers. This
-section presents a suite of functions for retrieving information from the
+@value{SECTION} presents a suite of functions for retrieving information from the
user database. @xref{Group Functions, ,Reading the Group Database},
for a similar suite that retrieves information from the group database.
-@cindex @code{getpwent}, C version
+@cindex @code{getpwent} C library function
@cindex user information
@cindex login information
@cindex account information
@@ -13325,40 +17030,42 @@ kept. Instead, it provides the @code{<pwd.h>} header file
and several C language subroutines for obtaining user information.
The primary function is @code{getpwent}, for ``get password entry.''
The ``password'' comes from the original user database file,
-@file{/etc/passwd}, which kept user information, along with the
+@file{/etc/passwd}, which stores user information, along with the
encrypted passwords (hence the name).
-While an @code{awk} program could simply read @file{/etc/passwd} directly
-(the format is well known), because of the way password
-files are handled on networked systems,
-this file may not contain complete information about the system's set of users.
-
-@cindex @code{pwcat} program
-To be sure of being
-able to produce a readable, complete version of the user database, it is
-necessary to write a small C program that calls @code{getpwent}.
-@code{getpwent} is defined to return a pointer to a @code{struct passwd}.
-Each time it is called, it returns the next entry in the database.
-When there are no more entries, it returns @code{NULL}, the null pointer.
-When this happens, the C program should call @code{endpwent} to close the
-database.
-Here is @code{pwcat}, a C program that ``cats'' the password database.
-
-@findex pwcat.c
-@example
-@c @group
+@cindex @command{pwcat} program
+While an @command{awk} program could simply read @file{/etc/passwd}
+directly, this file may not contain complete information about the
+system's set of users.@footnote{It is often the case that password
+information is stored in a network database.} To be sure you are able to
+produce a readable and complete version of the user database, it is necessary
+to write a small C program that calls @code{getpwent}. @code{getpwent}
+is defined as returning a pointer to a @code{struct passwd}. Each time it
+is called, it returns the next entry in the database. When there are
+no more entries, it returns @code{NULL}, the null pointer. When this
+happens, the C program should call @code{endpwent} to close the database.
+Following is @command{pwcat}, a C program that ``cats'' the password database.
+
+@c Use old style function header for portability to old systems (SunOS, HP/UX).
+
+@example
@c file eg/lib/pwcat.c
/*
* pwcat.c
*
* Generate a printable version of the password database
- *
- * Arnold Robbins
- * arnold@@gnu.org
- * May 1993
+ */
+@c endfile
+@ignore
+@c file eg/lib/pwcat.c
+/*
+ * Arnold Robbins, arnold@@gnu.org, May 1993
* Public Domain
*/
+@c endfile
+@end ignore
+@c file eg/lib/pwcat.c
#include <stdio.h>
#include <pwd.h>
@@ -13378,13 +17085,13 @@ char **argv;
exit(0);
@}
@c endfile
-@c @end group
@end example
If you don't understand C, don't worry about it.
-The output from @code{pwcat} is the user database, in the traditional
+The output from @command{pwcat} is the user database, in the traditional
@file{/etc/passwd} format of colon-separated fields. The fields are:
+@ignore
@table @asis
@item Login name
The user's login name.
@@ -13403,18 +17110,40 @@ The user's full name, and perhaps other information associated with the
user.
@item Home directory
-The user's login, or ``home'' directory (familiar to shell programmers as
+The user's login (or ``home'') directory (familiar to shell programmers as
@code{$HOME}).
@item Login shell
-The program that will be run when the user logs in. This is usually a
-shell, such as Bash (the Gnu Bourne-Again shell).
+The program that is run when the user logs in. This is usually a
+shell, such as @command{bash}.
@end table
+@end ignore
+
+@multitable {Encrypted password} {1234567890123456789012345678901234567890123456}
+@item Login name @tab The user's login name.
+
+@item Encrypted password @tab The user's encrypted password. This may not be available on some systems.
-Here are a few lines representative of @code{pwcat}'s output.
+@item User-ID @tab The user's numeric user-id number.
+@item Group-ID @tab The user's numeric group-id number.
+
+@item Full name @tab The user's full name, and perhaps other information associated with the
+user.
+
+@item Home directory @tab The user's login (or ``home'') directory (familiar to shell programmers as
+@code{$HOME}).
+
+@item Login shell @tab The program that is run when the user logs in. This is usually a
+shell, such as @command{bash}.
+@end multitable
+
+A few lines representative of @command{pwcat}'s output are as follows:
+
+@cindex Jacobs, Andrew
+@cindex Robbins, Arnold
+@cindex Robbins, Miriam
@example
-@c @group
$ pwcat
@print{} root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh
@print{} nobody:*:65534:65534::/:
@@ -13425,37 +17154,47 @@ $ pwcat
@print{} miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh
@print{} andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh
@dots{}
-@c @end group
@end example
-With that introduction, here is a group of functions for getting user
+With that introduction, following is a group of functions for getting user
information. There are several functions here, corresponding to the C
-functions of the same name.
+functions of the same names:
-@findex _pw_init
+@c Exercise: simplify all these functions that return values.
+@c Answer: return foo[key] returns "" if key not there, no need to check with `in'.
+
+@cindex @code{_pw_init} user-defined function
@example
@c file eg/lib/passwdawk.in
-@group
# passwd.awk --- access password file information
+@c endfile
+@ignore
+@c file eg/lib/passwdawk.in
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+# Revised October 2000
+@c endfile
+@end ignore
+@c file eg/lib/passwdawk.in
BEGIN @{
# tailor this to suit your system
_pw_awklib = "/usr/local/libexec/awk/"
@}
-@end group
-@group
-function _pw_init( oldfs, oldrs, olddol0, pwcat)
+function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw)
@{
if (_pw_inited)
return
+
oldfs = FS
oldrs = RS
olddol0 = $0
+ using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
FS = ":"
RS = "\n"
+
pwcat = _pw_awklib "pwcat"
while ((pwcat | getline) > 0) @{
_pw_byname[$1] = $0
@@ -13466,42 +17205,56 @@ function _pw_init( oldfs, oldrs, olddol0, pwcat)
_pw_count = 0
_pw_inited = 1
FS = oldfs
+ if (using_fw)
+ FIELDWIDTHS = FIELDWIDTHS
RS = oldrs
$0 = olddol0
@}
@c endfile
-@end group
@end example
The @code{BEGIN} rule sets a private variable to the directory where
-@code{pwcat} is stored. Since it is used to help out an @code{awk} library
-routine, we have chosen to put it in @file{/usr/local/libexec/awk}.
-You might want it to be in a different directory on your system.
+@command{pwcat} is stored. Because it is used to help out an @command{awk} library
+routine, we have chosen to put it in @file{/usr/local/libexec/awk};
+however, you might want it to be in a different directory on your system.
The function @code{_pw_init} keeps three copies of the user information
-in three associative arrays. The arrays are indexed by user name
+in three associative arrays. The arrays are indexed by username
(@code{_pw_byname}), by user-id number (@code{_pw_byuid}), and by order of
occurrence (@code{_pw_bycount}).
-
-The variable @code{_pw_inited} is used for efficiency; @code{_pw_init} only
-needs to be called once.
-
-Since this function uses @code{getline} to read information from
-@code{pwcat}, it first saves the values of @code{FS}, @code{RS}, and
-@code{$0}. Doing so is necessary, since these functions could be called
-from anywhere within a user's program, and the user may have his or her
-own values for @code{FS} and @code{RS}.
-@ignore
-Problem, what if FIELDWIDTHS is in use? Sigh.
-@end ignore
+The variable @code{_pw_inited} is used for efficiency; @code{_pw_init}
+needs only to be called once.
+
+Because this function uses @code{getline} to read information from
+@command{pwcat}, it first saves the values of @code{FS}, @code{RS}, and @code{$0}.
+It notes in the variable @code{using_fw} whether field splitting
+with @code{FIELDWIDTHS} is in effect or not.
+Doing so is necessary, since these functions could be called
+from anywhere within a user's program, and the user may have his
+or her
+own way of splitting records and fields.
+
+The @code{using_fw} variable checks @code{PROCINFO["FS"]}, which
+is @code{"FIELDWIDTHS"} if field splitting is being done with
+@code{FIELDWIDTHS}. This makes it possible to restore the correct
+field-splitting mechanism later. The test can only be true for
+@command{gawk}. It is false if using @code{FS} or on some other
+@command{awk} implementation.
The main part of the function uses a loop to read database lines, split
the line into fields, and then store the line into each array as necessary.
When the loop is done, @code{@w{_pw_init}} cleans up by closing the pipeline,
-setting @code{@w{_pw_inited}} to one, and restoring @code{FS}, @code{RS}, and
-@code{$0}. The use of @code{@w{_pw_count}} will be explained below.
+setting @code{@w{_pw_inited}} to one, and restoring @code{FS} (and @code{FIELDWIDTHS}
+if necessary), @code{RS}, and @code{$0}.
+The use of @code{@w{_pw_count}} is explained shortly.
+
+@c NEXT ED: All of these functions don't need the ... in ... test. Just
+@c return the array element, which will be "" if not already there. Duh.
+The @code{getpwnam} function takes a username as a string argument. If that
+user is in the database, it returns the appropriate line. Otherwise it
+returns the null string:
-@findex getpwnam
+@cindex @code{getpwnam} user-defined function
@example
@group
@c file eg/lib/passwdawk.in
@@ -13516,13 +17269,13 @@ function getpwnam(name)
@end group
@end example
-The @code{getpwnam} function takes a user name as a string argument. If that
-user is in the database, it returns the appropriate line. Otherwise it
-returns the null string.
+Similarly,
+the @code{getpwuid} function takes a user-id number argument. If that
+user number is in the database, it returns the appropriate line. Otherwise it
+returns the null string:
-@findex getpwuid
+@cindex @code{getpwuid} user-defined function
@example
-@group
@c file eg/lib/passwdawk.in
function getpwuid(uid)
@{
@@ -13532,17 +17285,14 @@ function getpwuid(uid)
return ""
@}
@c endfile
-@end group
@end example
-Similarly,
-the @code{getpwuid} function takes a user-id number argument. If that
-user number is in the database, it returns the appropriate line. Otherwise it
-returns the null string.
+The @code{getpwent} function simply steps through the database, one entry at
+a time. It uses @code{_pw_count} to track its current position in the
+@code{_pw_bycount} array:
-@findex getpwent
+@cindex @code{getpwent} user-defined function
@example
-@c @group
@c file eg/lib/passwdawk.in
function getpwent()
@{
@@ -13552,60 +17302,53 @@ function getpwent()
return ""
@}
@c endfile
-@c @end group
@end example
-The @code{getpwent} function simply steps through the database, one entry at
-a time. It uses @code{_pw_count} to track its current position in the
-@code{_pw_bycount} array.
+The @code{@w{endpwent}} function resets @code{@w{_pw_count}} to zero, so that
+subsequent calls to @code{getpwent} start over again:
-@findex endpwent
+@cindex @code{endpwent} user-defined function
@example
-@c @group
@c file eg/lib/passwdawk.in
function endpwent()
@{
_pw_count = 0
@}
@c endfile
-@c @end group
@end example
-The @code{@w{endpwent}} function resets @code{@w{_pw_count}} to zero, so that
-subsequent calls to @code{getpwent} will start over again.
-
A conscious design decision in this suite is that each subroutine calls
@code{@w{_pw_init}} to initialize the database arrays. The overhead of running
a separate process to generate the user database, and the I/O to scan it,
-will only be incurred if the user's main program actually calls one of these
+are only incurred if the user's main program actually calls one of these
functions. If this library file is loaded along with a user's program, but
-none of the routines are ever called, then there is no extra run-time overhead.
-(The alternative would be to move the body of @code{@w{_pw_init}} into a
-@code{BEGIN} rule, which would always run @code{pwcat}. This simplifies the
+none of the routines are ever called, then there is no extra runtime overhead.
+(The alternative is move the body of @code{@w{_pw_init}} into a
+@code{BEGIN} rule, which always runs @command{pwcat}. This simplifies the
code but runs an extra process that may never be needed.)
-In turn, calling @code{_pw_init} is not too expensive, since the
+In turn, calling @code{_pw_init} is not too expensive, because the
@code{_pw_inited} variable keeps the program from reading the data more than
once. If you are worried about squeezing every last cycle out of your
-@code{awk} program, the check of @code{_pw_inited} could be moved out of
+@command{awk} program, the check of @code{_pw_inited} could be moved out of
@code{_pw_init} and duplicated in all the other functions. In practice,
-this is not necessary, since most @code{awk} programs are I/O bound, and it
-would clutter up the code.
+this is not necessary, since most @command{awk} programs are I/O-bound, and it
+clutters up the code.
-The @code{id} program in @ref{Id Program, ,Printing Out User Information},
+The @command{id} program in @ref{Id Program, ,Printing out User Information},
uses these functions.
-@node Group Functions, Library Names, Passwd Functions, Library Functions
+@node Group Functions, , Passwd Functions, Library Functions
@section Reading the Group Database
-@cindex @code{getgrent}, C version
+@cindex @code{getgrent} C library function
@cindex group information
@cindex account information
@cindex group file
Much of the discussion presented in
@ref{Passwd Functions, ,Reading the User Database},
applies to the group database as well. Although there has traditionally
-been a well known file, @file{/etc/group}, in a well known format, the POSIX
+been a well-known file (@file{/etc/group}) in a well-known format, the POSIX
standard only provides a set of C library routines
(@code{<grp.h>} and @code{getgrent})
for accessing the information.
@@ -13613,27 +17356,31 @@ Even though this file may exist, it likely does not have
complete information. Therefore, as with the user database, it is necessary
to have a small C program that generates the group database as its output.
-@cindex @code{grcat} program
-Here is @code{grcat}, a C program that ``cats'' the group database.
+@cindex @command{grcat} program
+@command{grcat}, a C program that ``cats'' the group database,
+is as follows:
-@findex grcat.c
@example
-@c @group
@c file eg/lib/grcat.c
/*
* grcat.c
*
* Generate a printable version of the group database
- *
- * Arnold Robbins, arnold@@gnu.org
- * May 1993
+ */
+@c endfile
+@ignore
+@c file eg/lib/grcat.c
+/*
+ * Arnold Robbins, arnold@@gnu.org, May 1993
* Public Domain
*/
+@c endfile
+@end ignore
+@c file eg/lib/grcat.c
#include <stdio.h>
#include <grp.h>
-@group
int
main(argc, argv)
int argc;
@@ -13641,54 +17388,73 @@ char **argv;
@{
struct group *g;
int i;
-@end group
-@group
while ((g = getgrent()) != NULL) @{
printf("%s:%s:%d:", g->gr_name, g->gr_passwd,
g->gr_gid);
-@end group
for (i = 0; g->gr_mem[i] != NULL; i++) @{
printf("%s", g->gr_mem[i]);
+@group
if (g->gr_mem[i+1] != NULL)
putchar(',');
@}
+@end group
putchar('\n');
@}
endgrent();
exit(0);
@}
@c endfile
-@c @end group
@end example
-Each line in the group database represent one group. The fields are
-separated with colons, and represent the following information.
+Each line in the group database represents one group. The fields are
+separated with colons and represent the following information:
+@ignore
@table @asis
@item Group Name
The name of the group.
@item Group Password
The encrypted group password. In practice, this field is never used. It is
-usually empty, or set to @samp{*}.
+usually empty or set to @samp{*}.
@item Group ID Number
The numeric group-id number. This number should be unique within the file.
@item Group Member List
-A comma-separated list of user names. These users are members of the group.
-Most Unix systems allow users to be members of several groups
-simultaneously. If your system does, then reading @file{/dev/user} will
-return those group-id numbers in @code{$5} through @code{$NF}.
-(Note that @file{/dev/user} is a @code{gawk} extension;
-@pxref{Special Files, ,Special File Names in @code{gawk}}.)
+A comma-separated list of usernames. These users are members of the group.
+Modern Unix systems allow users to be members of several groups
+simultaneously. If your system does, then there are elements
+@code{"group1"} through @code{"group@var{N}"} in @code{PROCINFO}
+for those group-id numbers.
+(Note that @code{PROCINFO} is a @command{gawk} extension;
+@pxref{Built-in Variables}.)
@end table
+@end ignore
+
+@multitable {Encrypted password} {1234567890123456789012345678901234567890123456}
+@item Group name @tab The group's name.
+
+@item Group password @tab The group's encrypted password. In practice, this field is never used;
+it is usually empty or set to @samp{*}.
+
+@item Group-ID @tab
+The group's numeric group-id number; this number should be unique within the file.
-Here is what running @code{grcat} might produce:
+@item Group member list @tab
+A comma-separated list of usernames. These users are members of the group.
+Modern Unix systems allow users to be members of several groups
+simultaneously. If your system does, then there are elements
+@code{"group1"} through @code{"group@var{N}"} in @code{PROCINFO}
+for those group-id numbers.
+(Note that @code{PROCINFO} is a @command{gawk} extension;
+@pxref{Built-in Variables}.)
+@end multitable
+
+Here is what running @command{grcat} might produce:
@example
-@group
$ grcat
@print{} wheel:*:0:arnold
@print{} nogroup:*:65534:
@@ -13697,45 +17463,46 @@ $ grcat
@print{} staff:*:10:arnold,miriam,andy
@print{} other:*:20:
@dots{}
-@end group
@end example
Here are the functions for obtaining information from the group database.
-There are several, modeled after the C library functions of the same names.
+There are several, modeled after the C library functions of the same names:
-@findex _gr_init
+@cindex @code{_gr_init} user-defined function
@example
-@group
@c file eg/lib/groupawk.in
# group.awk --- functions for dealing with the group file
+@c endfile
+@ignore
+@c file eg/lib/groupawk.in
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+# Revised October 2000
+@c endfile
+@end ignore
+@c line break on _gr_init for smallbook
+@c file eg/lib/groupawk.in
BEGIN \
@{
# Change to suit your system
_gr_awklib = "/usr/local/libexec/awk/"
@}
-@c endfile
-@end group
-@group
-@c file eg/lib/groupawk.in
-function _gr_init( oldfs, oldrs, olddol0, grcat, n, a, i)
+function _gr_init( oldfs, oldrs, olddol0, grcat,
+ using_fw, n, a, i)
@{
if (_gr_inited)
return
-@end group
-@group
oldfs = FS
oldrs = RS
olddol0 = $0
+ using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
FS = ":"
RS = "\n"
-@end group
-@group
grcat = _gr_awklib "grcat"
while ((grcat | getline) > 0) @{
if ($1 in _gr_byname)
@@ -13748,34 +17515,29 @@ function _gr_init( oldfs, oldrs, olddol0, grcat, n, a, i)
_gr_bygid[$3] = $0
n = split($4, a, "[ \t]*,[ \t]*")
-@end group
-@group
for (i = 1; i <= n; i++)
if (a[i] in _gr_groupsbyuser)
_gr_groupsbyuser[a[i]] = \
_gr_groupsbyuser[a[i]] " " $1
else
_gr_groupsbyuser[a[i]] = $1
-@end group
-@group
_gr_bycount[++_gr_count] = $0
@}
-@end group
-@group
close(grcat)
_gr_count = 0
_gr_inited++
FS = oldfs
+ if (using_fw)
+ FIELDWIDTHS = FIELDWIDTHS
RS = oldrs
$0 = olddol0
@}
@c endfile
-@end group
@end example
The @code{BEGIN} rule sets a private variable to the directory where
-@code{grcat} is stored. Since it is used to help out an @code{awk} library
+@command{grcat} is stored. Because it is used to help out an @command{awk} library
routine, we have chosen to put it in @file{/usr/local/libexec/awk}. You might
want it to be in a different directory on your system.
@@ -13783,39 +17545,43 @@ These routines follow the same general outline as the user database routines
(@pxref{Passwd Functions, ,Reading the User Database}).
The @code{@w{_gr_inited}} variable is used to
ensure that the database is scanned no more than once.
-The @code{@w{_gr_init}} function first saves @code{FS}, @code{RS}, and
+The @code{@w{_gr_init}} function first saves @code{FS}, @code{FIELDWIDTHS}, @code{RS}, and
@code{$0}, and then sets @code{FS} and @code{RS} to the correct values for
scanning the group information.
The group information is stored is several associative arrays.
The arrays are indexed by group name (@code{@w{_gr_byname}}), by group-id number
(@code{@w{_gr_bygid}}), and by position in the database (@code{@w{_gr_bycount}}).
-There is an additional array indexed by user name (@code{@w{_gr_groupsbyuser}}),
-that is a space separated list of groups that each user belongs to.
+There is an additional array indexed by username (@code{@w{_gr_groupsbyuser}}),
+which is a space-separated list of groups that each user belongs to.
Unlike the user database, it is possible to have multiple records in the
database for the same group. This is common when a group has a large number
-of members. Such a pair of entries might look like:
+of members. A pair of such entries might look like the following:
@example
-tvpeople:*:101:johny,jay,arsenio
+tvpeople:*:101:johnny,jay,arsenio
tvpeople:*:101:david,conan,tom,joan
@end example
For this reason, @code{_gr_init} looks to see if a group name or
-group-id number has already been seen. If it has, then the user names are
+group-id number is already seen. If it is, then the usernames are
simply concatenated onto the previous list of users. (There is actually a
-subtle problem with the code presented above. Suppose that
+subtle problem with the code just presented. Suppose that
the first time there were no names. This code adds the names with
a leading comma. It also doesn't check that there is a @code{$4}.)
-Finally, @code{_gr_init} closes the pipeline to @code{grcat}, restores
-@code{FS}, @code{RS}, and @code{$0}, initializes @code{_gr_count} to zero
-(it is used later), and makes @code{_gr_inited} non-zero.
+Finally, @code{_gr_init} closes the pipeline to @command{grcat}, restores
+@code{FS} (and @code{FIELDWIDTHS} if necessary), @code{RS}, and @code{$0},
+initializes @code{_gr_count} to zero
+(it is used later), and makes @code{_gr_inited} nonzero.
+
+The @code{getgrnam} function takes a group name as its argument, and if that
+group exists, it is returned. Otherwise, @code{getgrnam} returns the null
+string:
-@findex getgrnam
+@cindex @code{getgrnam} user-defined function
@example
-@c @group
@c file eg/lib/groupawk.in
function getgrnam(group)
@{
@@ -13825,16 +17591,13 @@ function getgrnam(group)
return ""
@}
@c endfile
-@c @end group
@end example
-The @code{getgrnam} function takes a group name as its argument, and if that
-group exists, it is returned. Otherwise, @code{getgrnam} returns the null
-string.
+The @code{getgrgid} function is similar, it takes a numeric group-id and
+looks up the information associated with that group-id:
-@findex getgrgid
+@cindex @code{getgrgid} user-defined function
@example
-@c @group
@c file eg/lib/groupawk.in
function getgrgid(gid)
@{
@@ -13844,15 +17607,13 @@ function getgrgid(gid)
return ""
@}
@c endfile
-@c @end group
@end example
-The @code{getgrgid} function is similar, it takes a numeric group-id, and
-looks up the information associated with that group-id.
+The @code{getgruser} function does not have a C counterpart. It takes a
+username and returns the list of groups that have the user as a member:
-@findex getgruser
+@cindex @code{getgruser} user-defined function
@example
-@group
@c file eg/lib/groupawk.in
function getgruser(user)
@{
@@ -13862,15 +17623,13 @@ function getgruser(user)
return ""
@}
@c endfile
-@end group
@end example
-The @code{getgruser} function does not have a C counterpart. It takes a
-user name, and returns the list of groups that have the user as a member.
+The @code{getgrent} function steps through the database one entry at a time.
+It uses @code{_gr_count} to track its position in the list:
-@findex getgrent
+@cindex @code{getgrent} user-defined function
@example
-@c @group
@c file eg/lib/groupawk.in
function getgrent()
@{
@@ -13880,197 +17639,149 @@ function getgrent()
return ""
@}
@c endfile
-@c @end group
@end example
-The @code{getgrent} function steps through the database one entry at a time.
-It uses @code{_gr_count} to track its position in the list.
+The @code{endgrent} function resets @code{_gr_count} to zero so that @code{getgrent} can
+start over again:
-@findex endgrent
+@cindex @code{endgrent} user-defined function
@example
-@group
@c file eg/lib/groupawk.in
function endgrent()
@{
_gr_count = 0
@}
@c endfile
-@end group
@end example
-@code{endgrent} resets @code{_gr_count} to zero so that @code{getgrent} can
-start over again.
-
As with the user database routines, each function calls @code{_gr_init} to
initialize the arrays. Doing so only incurs the extra overhead of running
-@code{grcat} if these functions are used (as opposed to moving the body of
+@command{grcat} if these functions are used (as opposed to moving the body of
@code{_gr_init} into a @code{BEGIN} rule).
Most of the work is in scanning the database and building the various
associative arrays. The functions that the user calls are themselves very
-simple, relying on @code{awk}'s associative arrays to do work.
+simple, relying on @command{awk}'s associative arrays to do work.
-The @code{id} program in @ref{Id Program, ,Printing Out User Information},
+The @command{id} program in @ref{Id Program, ,Printing out User Information},
uses these functions.
-@node Library Names, , Group Functions, Library Functions
-@section Naming Library Function Global Variables
-
-@cindex namespace issues in @code{awk}
-@cindex documenting @code{awk} programs
-@cindex programs, documenting
-Due to the way the @code{awk} language evolved, variables are either
-@dfn{global} (usable by the entire program), or @dfn{local} (usable just by
-a specific function). There is no intermediate state analogous to
-@code{static} variables in C.
-
-Library functions often need to have global variables that they can use to
-preserve state information between calls to the function. For example,
-@code{getopt}'s variable @code{_opti}
-(@pxref{Getopt Function, ,Processing Command Line Options}),
-and the @code{_tm_months} array used by @code{mktime}
-(@pxref{Mktime Function, ,Turning Dates Into Timestamps}).
-Such variables are called @dfn{private}, since the only functions that need to
-use them are the ones in the library.
+@node Sample Programs, Language History, Library Functions, Top
+@chapter Practical @command{awk} Programs
-When writing a library function, you should try to choose names for your
-private variables so that they will not conflict with any variables used by
-either another library function or a user's main program. For example, a
-name like @samp{i} or @samp{j} is not a good choice, since user programs
-often use variable names like these for their own purposes.
+@ref{Library Functions, ,A Library of @command{awk} Functions},
+presents the idea that reading programs in a language contributes to
+learning that language. This @value{CHAPTER} continues that theme,
+presenting a potpourri of @command{awk} programs for your reading
+enjoyment.
+@ifnotinfo
+There are three sections.
+The first describes how to run the programs presented
+in this @value{CHAPTER}.
-The example programs shown in this chapter all start the names of their
-private variables with an underscore (@samp{_}). Users generally don't use
-leading underscores in their variable names, so this convention immediately
-decreases the chances that the variable name will be accidentally shared
-with the user's program.
+The second presents @command{awk}
+versions of several common POSIX utilities.
+These are programs that you are hopefully already familiar with,
+and therefore, whose problems are understood.
+By reimplementing these programs in @command{awk},
+you can focus on the @command{awk}-related aspects of solving
+the programming problem.
+
+The third is a grab bag of interesting programs.
+These solve a number of different data-manipulation and management
+problems. Many of the programs are short, which emphasizes @command{awk}'s
+ability to do a lot in just a few lines of code.
+@end ifnotinfo
-In addition, several of the library functions use a prefix that helps
-indicate what function or set of functions uses the variables. For example,
-@code{_tm_months} in @code{mktime}
-(@pxref{Mktime Function, ,Turning Dates Into Timestamps}), and
-@code{_pw_byname} in the user data base routines
-(@pxref{Passwd Functions, ,Reading the User Database}).
-This convention is recommended, since it even further decreases the chance
-of inadvertent conflict among variable names.
-Note that this convention can be used equally well both for variable names
-and for private function names too.
+Many of these programs use the library functions presented in
+@ref{Library Functions, ,A Library of @command{awk} Functions}.
-While I could have re-written all the library routines to use this
-convention, I did not do so, in order to show how my own @code{awk}
-programming style has evolved, and to provide some basis for this
-discussion.
+@menu
+* Running Examples:: How to run these examples.
+* Clones:: Clones of common utilities.
+* Miscellaneous Programs:: Some interesting @command{awk} programs.
+@end menu
-As a final note on variable naming, if a function makes global variables
-available for use by a main program, it is a good convention to start that
-variable's name with a capital letter.
-For example, @code{getopt}'s @code{Opterr} and @code{Optind} variables
-(@pxref{Getopt Function, ,Processing Command Line Options}).
-The leading capital letter indicates that it is global, while the fact that
-the variable name is not all capital letters indicates that the variable is
-not one of @code{awk}'s built-in variables, like @code{FS}.
+@node Running Examples, Clones, Sample Programs, Sample Programs
+@section Running the Example Programs
-It is also important that @emph{all} variables in library functions
-that do not need to save state are in fact declared local. If this is
-not done, the variable could accidentally be used in the user's program,
-leading to bugs that are very difficult to track down.
+To run a given program, you would typically do something like this:
@example
-function lib_func(x, y, l1, l2)
-@{
- @dots{}
- @var{use variable} some_var # some_var could be local
- @dots{} # but is not by oversight
-@}
+awk -f @var{program} -- @var{options} @var{files}
@end example
-@cindex Tcl
-A different convention, common in the Tcl community, is to use a single
-associative array to hold the values needed by the library function(s), or
-``package.'' This significantly decreases the number of actual global names
-in use. For example, the functions described in
-@ref{Passwd Functions, , Reading the User Database},
-might have used @code{@w{PW_data["inited"]}}, @code{@w{PW_data["total"]}},
-@code{@w{PW_data["count"]}} and @code{@w{PW_data["awklib"]}}, instead of
-@code{@w{_pw_inited}}, @code{@w{_pw_awklib}}, @code{@w{_pw_total}},
-and @code{@w{_pw_count}}.
-
-The conventions presented in this section are exactly that, conventions. You
-are not required to write your programs this way, we merely recommend that
-you do so.
+@noindent
+Here, @var{program} is the name of the @command{awk} program (such as
+@file{cut.awk}), @var{options} are any command-line options for the
+program that start with a @samp{-}, and @var{files} are the actual @value{DF}s.
-@node Sample Programs, Language History, Library Functions, Top
-@chapter Practical @code{awk} Programs
+If your system supports the @samp{#!} executable interpreter mechanism
+(@pxref{Executable Scripts, , Executable @command{awk} Programs}),
+you can instead run your program directly:
-This chapter presents a potpourri of @code{awk} programs for your reading
-enjoyment.
-@iftex
-There are two sections. The first presents @code{awk}
-versions of several common POSIX utilities.
-The second is a grab-bag of interesting programs.
-@end iftex
+@example
+cut.awk -c1-8 myfiles > results
+@end example
-Many of these programs use the library functions presented in
-@ref{Library Functions, ,A Library of @code{awk} Functions}.
+If your @command{awk} is not @command{gawk}, you may instead need to use this:
-@menu
-* Clones:: Clones of common utilities.
-* Miscellaneous Programs:: Some interesting @code{awk} programs.
-@end menu
+@example
+cut.awk -- -c1-8 myfiles > results
+@end example
-@node Clones, Miscellaneous Programs, Sample Programs, Sample Programs
-@section Re-inventing Wheels for Fun and Profit
+@node Clones, Miscellaneous Programs, Running Examples, Sample Programs
+@section Reinventing Wheels for Fun and Profit
-This section presents a number of POSIX utilities that are implemented in
-@code{awk}. Re-inventing these programs in @code{awk} is often enjoyable,
-since the algorithms can be very clearly expressed, and usually the code is
-very concise and simple. This is true because @code{awk} does so much for you.
+This @value{SECTION} presents a number of POSIX utilities that are implemented in
+@command{awk}. Reinventing these programs in @command{awk} is often enjoyable,
+because the algorithms can be very clearly expressed, and the code is usually
+very concise and simple. This is true because @command{awk} does so much for you.
It should be noted that these programs are not necessarily intended to
replace the installed versions on your system. Instead, their
-purpose is to illustrate @code{awk} language programming for ``real world''
+purpose is to illustrate @command{awk} language programming for ``real world''
tasks.
The programs are presented in alphabetical order.
@menu
-* Cut Program:: The @code{cut} utility.
-* Egrep Program:: The @code{egrep} utility.
-* Id Program:: The @code{id} utility.
-* Split Program:: The @code{split} utility.
-* Tee Program:: The @code{tee} utility.
-* Uniq Program:: The @code{uniq} utility.
-* Wc Program:: The @code{wc} utility.
+* Cut Program:: The @command{cut} utility.
+* Egrep Program:: The @command{egrep} utility.
+* Id Program:: The @command{id} utility.
+* Split Program:: The @command{split} utility.
+* Tee Program:: The @command{tee} utility.
+* Uniq Program:: The @command{uniq} utility.
+* Wc Program:: The @command{wc} utility.
@end menu
@node Cut Program, Egrep Program, Clones, Clones
-@subsection Cutting Out Fields and Columns
+@subsection Cutting out Fields and Columns
-@cindex @code{cut} utility
-The @code{cut} utility selects, or ``cuts,'' either characters or fields
-from its standard
-input and sends them to its standard output. @code{cut} can cut out either
-a list of characters, or a list of fields. By default, fields are separated
-by tabs, but you may supply a command line option to change the field
-@dfn{delimiter}, i.e.@: the field separator character. @code{cut}'s definition
-of fields is less general than @code{awk}'s.
+@cindex @command{cut} utility
+The @command{cut} utility selects, or ``cuts,'' characters or fields
+from its standard input and sends them to its standard output.
+Fields are separated by tabs by default,
+but you may supply a command-line option to change the field
+@dfn{delimiter} (i.e., the field separator character). @command{cut}'s
+definition of fields is less general than @command{awk}'s.
-A common use of @code{cut} might be to pull out just the login name of
-logged-on users from the output of @code{who}. For example, the following
-pipeline generates a sorted, unique list of the logged on users:
+A common use of @command{cut} might be to pull out just the login name of
+logged-on users from the output of @command{who}. For example, the following
+pipeline generates a sorted, unique list of the logged-on users:
@example
who | cut -c1-8 | sort | uniq
@end example
-The options for @code{cut} are:
+The options for @command{cut} are:
@table @code
@item -c @var{list}
Use @var{list} as the list of characters to cut out. Items within the list
may be separated by commas, and ranges of characters can be separated with
-dashes. The list @samp{1-8,15,22-35} specifies characters one through
-eight, 15, and 22 through 35.
+dashes. The list @samp{1-8,15,22-35} specifies characters 1 through
+8, 15, and 22 through 35.
@item -f @var{list}
Use @var{list} as the list of fields to cut out.
@@ -14083,30 +17794,40 @@ character.
Suppress printing of lines that do not contain the field delimiter.
@end table
-The @code{awk} implementation of @code{cut} uses the @code{getopt} library
-function (@pxref{Getopt Function, ,Processing Command Line Options}),
+The @command{awk} implementation of @command{cut} uses the @code{getopt} library
+function (@pxref{Getopt Function, ,Processing Command-Line Options})
and the @code{join} library function
-(@pxref{Join Function, ,Merging an Array Into a String}).
+(@pxref{Join Function, ,Merging an Array into a String}).
-The program begins with a comment describing the options and a @code{usage}
-function which prints out a usage message and exits. @code{usage} is called
-if invalid arguments are supplied.
+The program begins with a comment describing the options, the library
+functions needed, and a @code{usage} function that prints out a usage
+message and exits. @code{usage} is called if invalid arguments are
+supplied:
-@findex cut.awk
+@cindex @code{cut.awk} program
@example
-@c @group
@c file eg/prog/cut.awk
# cut.awk --- implement cut in awk
+@c endfile
+@ignore
+@c file eg/prog/cut.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/prog/cut.awk
# Options:
-# -f list Cut fields
-# -d c Field delimiter character
-# -c list Cut characters
+# -f list Cut fields
+# -d c Field delimiter character
+# -c list Cut characters
#
-# -s Suppress lines without the delimiter character
+# -s Suppress lines without the delimiter
+#
+# Requires getopt and join library functions
+@group
function usage( e1, e2)
@{
e1 = "usage: cut [-f list] [-d c] [-s] [files...]"
@@ -14115,32 +17836,31 @@ function usage( e1, e2)
print e2 > "/dev/stderr"
exit 1
@}
+@end group
@c endfile
-@c @end group
@end example
@noindent
The variables @code{e1} and @code{e2} are used so that the function
fits nicely on the
-@iftex
+@ifnotinfo
page.
-@end iftex
-@ifinfo
+@end ifnotinfo
+@ifnottex
screen.
-@end ifinfo
+@end ifnottex
-Next comes a @code{BEGIN} rule that parses the command line options.
-It sets @code{FS} to a single tab character, since that is @code{cut}'s
+Next comes a @code{BEGIN} rule that parses the command-line options.
+It sets @code{FS} to a single tab character, because that is @command{cut}'s
default field separator. The output field separator is also set to be the
same as the input field separator. Then @code{getopt} is used to step
-through the command line options. One or the other of the variables
+through the command-line options. One or the other of the variables
@code{by_fields} or @code{by_chars} is set to true, to indicate that
-processing should be done by fields or by characters respectively.
+processing should be done by fields or by characters, respectively.
When cutting by characters, the output field separator is set to the null
string.
@example
-@c @group
@c file eg/prog/cut.awk
BEGIN \
@{
@@ -14154,7 +17874,6 @@ BEGIN \
by_chars = 1
fieldlist = Optarg
OFS = ""
-@group
@} else if (c == "d") @{
if (length(Optarg) > 1) @{
printf("Using first character of %s" \
@@ -14170,31 +17889,28 @@ BEGIN \
else
usage()
@}
-@end group
for (i = 1; i < Optind; i++)
ARGV[i] = ""
@c endfile
-@c @end group
@end example
-Special care is taken when the field delimiter is a space. Using
-@code{@w{" "}} (a single space) for the value of @code{FS} is
-incorrect---@code{awk} would
-separate fields with runs of spaces, tabs and/or newlines, and we want them to be
-separated with individual spaces. Also, note that after @code{getopt} is
-through, we have to clear out all the elements of @code{ARGV} from one to
-@code{Optind}, so that @code{awk} will not try to process the command line
-options as file names.
+Special care is taken when the field delimiter is a space. Using
+a single space (@code{@w{" "}}) for the value of @code{FS} is
+incorrect---@command{awk} would separate fields with runs of spaces,
+tabs, and/or newlines, and we want them to be separated with individual
+spaces. Also, note that after @code{getopt} is through, we have to
+clear out all the elements of @code{ARGV} from 1 to @code{Optind},
+so that @command{awk} does not try to process the command-line options
+as @value{FN}s.
-After dealing with the command line options, the program verifies that the
-options make sense. Only one or the other of @samp{-c} and @samp{-f} should
-be used, and both require a field list. Then either @code{set_fieldlist} or
-@code{set_charlist} is called to pull apart the list of fields or
-characters.
+After dealing with the command-line options, the program verifies that the
+options make sense. Only one or the other of @option{-c} and @option{-f}
+should be used, and both require a field list. Then the program calls
+either @code{set_fieldlist} or @code{set_charlist} to pull apart the
+list of fields or characters:
@example
-@c @group
@c file eg/prog/cut.awk
if (by_fields && by_chars)
usage()
@@ -14207,28 +17923,24 @@ characters.
exit 1
@}
-@group
if (by_fields)
set_fieldlist()
else
set_charlist()
@}
@c endfile
-@end group
@end example
-Here is @code{set_fieldlist}. It first splits the field list apart
-at the commas, into an array. Then, for each element of the array, it
-looks to see if it is actually a range, and if so splits it apart. The range
+@code{set_fieldlist} is used to split the field list apart at the commas,
+and into an array. Then, for each element of the array, it looks to
+see if it is actually a range, and if so, splits it apart. The range
is verified to make sure the first number is smaller than the second.
-Each number in the list is added to the @code{flist} array, which simply
-lists the fields that will be printed.
-Normal field splitting is used.
-The program lets @code{awk}
-handle the job of doing the field splitting.
+Each number in the list is added to the @code{flist} array, which
+simply lists the fields that will be printed. Normal field splitting
+is used. The program lets @command{awk} handle the job of doing the
+field splitting:
@example
-@c @group
@c file eg/prog/cut.awk
function set_fieldlist( n, m, i, j, k, f, g)
@{
@@ -14237,11 +17949,13 @@ function set_fieldlist( n, m, i, j, k, f, g)
for (i = 1; i <= n; i++) @{
if (index(f[i], "-") != 0) @{ # a range
m = split(f[i], g, "-")
+@group
if (m != 2 || g[1] >= g[2]) @{
printf("bad field list: %s\n",
f[i]) > "/dev/stderr"
exit 1
@}
+@end group
for (k = g[1]; k <= g[2]; k++)
flist[j++] = k
@} else
@@ -14250,29 +17964,28 @@ function set_fieldlist( n, m, i, j, k, f, g)
nfields = j - 1
@}
@c endfile
-@c @end group
@end example
The @code{set_charlist} function is more complicated than @code{set_fieldlist}.
-The idea here is to use @code{gawk}'s @code{FIELDWIDTHS} variable
-(@pxref{Constant Size, ,Reading Fixed-width Data}),
+The idea here is to use @command{gawk}'s @code{FIELDWIDTHS} variable
+(@pxref{Constant Size, ,Reading Fixed-Width Data}),
which describes constant width input. When using a character list, that is
exactly what we have.
Setting up @code{FIELDWIDTHS} is more complicated than simply listing the
-fields that need to be printed. We have to keep track of the fields to be
-printed, and also the intervening characters that have to be skipped.
-For example, suppose you wanted characters one through eight, 15, and
+fields that need to be printed. We have to keep track of the fields to
+print and also the intervening characters that have to be skipped.
+For example, suppose you wanted characters 1 through 8, 15, and
22 through 35. You would use @samp{-c 1-8,15,22-35}. The necessary value
-for @code{FIELDWIDTHS} would be @code{@w{"8 6 1 6 14"}}. This gives us five
-fields, and what should be printed are @code{$1}, @code{$3}, and @code{$5}.
-The intermediate fields are ``filler,'' stuff in between the desired data.
-
-@code{flist} lists the fields to be printed, and @code{t} tracks the
-complete field list, including filler fields.
+for @code{FIELDWIDTHS} is @code{@w{"8 6 1 6 14"}}. This yields five
+fields, and the fields to print
+are @code{$1}, @code{$3}, and @code{$5}.
+The intermediate fields are @dfn{filler},
+which is stuff in between the desired data.
+@code{flist} lists the fields to print, and @code{t} tracks the
+complete field list, including filler fields:
@example
-@c @group
@c file eg/prog/cut.awk
function set_charlist( field, i, j, f, g, t,
filler, last, len)
@@ -14293,8 +18006,10 @@ function set_charlist( field, i, j, f, g, t,
filler = g[1] - last - 1
else
filler = 0
+@group
if (filler)
t[field++] = filler
+@end group
t[field++] = len # length of field
last = g[2]
flist[j++] = field - 1
@@ -14310,34 +18025,29 @@ function set_charlist( field, i, j, f, g, t,
flist[j++] = field - 1
@}
@}
-@group
FIELDWIDTHS = join(t, 1, field - 1)
nfields = j - 1
@}
-@end group
@c endfile
@end example
-Here is the rule that actually processes the data. If the @samp{-s} option
-was given, then @code{suppress} will be true. The first @code{if} statement
+Next is the rule that actually processes the data. If the @option{-s} option
+is given, then @code{suppress} is true. The first @code{if} statement
makes sure that the input record does have the field separator. If
-@code{cut} is processing fields, @code{suppress} is true, and the field
+@command{cut} is processing fields, @code{suppress} is true, and the field
separator character is not in the record, then the record is skipped.
-If the record is valid, then at this point, @code{gawk} has split the data
+If the record is valid, then @command{gawk} has split the data
into fields, either using the character in @code{FS} or using fixed-length
fields and @code{FIELDWIDTHS}. The loop goes through the list of fields
-that should be printed. If the corresponding field has data in it, it is
-printed. If the next field also has data, then the separator character is
-written out in between the fields.
-
-@c 2e: Could use `index($0, FS) != 0' instead of `$0 !~ FS', below
+that should be printed. The corresponding field is printed if it contains data.
+If the next field also has data, then the separator character is
+written out between the fields:
@example
-@c @group
@c file eg/prog/cut.awk
@{
- if (by_fields && suppress && $0 !~ FS)
+ if (by_fields && suppress && index($0, FS) != 0)
next
for (i = 1; i <= nfields; i++) @{
@@ -14350,37 +18060,39 @@ written out in between the fields.
print ""
@}
@c endfile
-@c @end group
@end example
-This version of @code{cut} relies on @code{gawk}'s @code{FIELDWIDTHS}
-variable to do the character-based cutting. While it would be possible in
-other @code{awk} implementations to use @code{substr}
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}),
-it would also be extremely painful to do so.
+This version of @command{cut} relies on @command{gawk}'s @code{FIELDWIDTHS}
+variable to do the character-based cutting. While it is possible in
+other @command{awk} implementations to use @code{substr}
+(@pxref{String Functions, ,String Manipulation Functions}),
+it is also extremely painful.
The @code{FIELDWIDTHS} variable supplies an elegant solution to the problem
of picking the input line apart by characters.
+@c Exercise: Rewrite using split with "".
+
@node Egrep Program, Id Program, Cut Program, Clones
@subsection Searching for Regular Expressions in Files
-@cindex @code{egrep} utility
-The @code{egrep} utility searches files for patterns. It uses regular
-expressions that are almost identical to those available in @code{awk}
-(@pxref{Regexp Constants, ,Regular Expression Constants}). It is used this way:
+@cindex @command{egrep} utility
+The @command{egrep} utility searches files for patterns. It uses regular
+expressions that are almost identical to those available in @command{awk}
+(@pxref{Regexp, ,Regular Expressions}).
+It is used in the following manner:
@example
egrep @r{[} @var{options} @r{]} '@var{pattern}' @var{files} @dots{}
@end example
-The @var{pattern} is a regexp.
-In typical usage, the regexp is quoted to prevent the shell from expanding
-any of the special characters as file name wildcards.
-Normally, @code{egrep} prints the
-lines that matched. If multiple file names are provided on the command
-line, each output line is preceded by the name of the file and a colon.
+The @var{pattern} is a regular expression. In typical usage, the regular
+expression is quoted to prevent the shell from expanding any of the
+special characters as @value{FN} wildcards. Normally, @command{egrep}
+prints the lines that matched. If multiple @value{FN}s are provided on
+the command line, each output line is preceded by the name of the file
+and a colon.
-The options are:
+The options to @command{egrep} are as follows:
@table @code
@item -c
@@ -14388,44 +18100,50 @@ Print out a count of the lines that matched the pattern, instead of the
lines themselves.
@item -s
-Be silent. No output is produced, and the exit value indicates whether
-or not the pattern was matched.
+Be silent. No output is produced and the exit value indicates whether
+the pattern was matched.
@item -v
-Invert the sense of the test. @code{egrep} prints the lines that do
-@emph{not} match the pattern, and exits successfully if the pattern was not
+Invert the sense of the test. @command{egrep} prints the lines that do
+@emph{not} match the pattern and exits successfully if the pattern is not
matched.
@item -i
Ignore case distinctions in both the pattern and the input data.
@item -l
-Only print the names of the files that matched, not the lines that matched.
+Only print (list) the names of the files that matched, not the lines that matched.
@item -e @var{pattern}
-Use @var{pattern} as the regexp to match. The purpose of the @samp{-e}
+Use @var{pattern} as the regexp to match. The purpose of the @option{-e}
option is to allow patterns that start with a @samp{-}.
@end table
This version uses the @code{getopt} library function
-(@pxref{Getopt Function, ,Processing Command Line Options}),
+(@pxref{Getopt Function, ,Processing Command-Line Options})
and the file transition library program
-(@pxref{Filetrans Function, ,Noting Data File Boundaries}).
+(@pxref{Filetrans Function, ,Noting @value{DDF} Boundaries}).
-The program begins with a descriptive comment, and then a @code{BEGIN} rule
-that processes the command line arguments with @code{getopt}. The @samp{-i}
-(ignore case) option is particularly easy with @code{gawk}; we just use the
-@code{IGNORECASE} built in variable
-(@pxref{Built-in Variables}).
+The program begins with a descriptive comment and then a @code{BEGIN} rule
+that processes the command-line arguments with @code{getopt}. The @option{-i}
+(ignore case) option is particularly easy with @command{gawk}; we just use the
+@code{IGNORECASE} built-in variable
+(@pxref{Built-in Variables}):
-@findex egrep.awk
+@cindex @code{egrep.awk} program
@example
-@c @group
@c file eg/prog/egrep.awk
# egrep.awk --- simulate egrep in awk
+@c endfile
+@ignore
+@c file eg/prog/egrep.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/prog/egrep.awk
# Options:
# -c count of lines
# -s silent - use exit value
@@ -14433,6 +18151,8 @@ that processes the command line arguments with @code{getopt}. The @samp{-i}
# -i ignore case
# -l print filenames only
# -e argument is pattern
+#
+# Requires getopt and file transition library functions
BEGIN @{
while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) @{
@@ -14452,23 +18172,17 @@ BEGIN @{
usage()
@}
@c endfile
-@c @end group
@end example
-Next comes the code that handles the @code{egrep} specific behavior. If no
-pattern was supplied with @samp{-e}, the first non-option on the command
-line is used. The @code{awk} command line arguments up to @code{ARGV[Optind]}
-are cleared, so that @code{awk} won't try to process them as files. If no
-files were specified, the standard input is used, and if multiple files were
-specified, we make sure to note this so that the file names can precede the
-matched lines in the output.
-
-The last two lines are commented out, since they are not needed in
-@code{gawk}. They should be uncommented if you have to use another version
-of @code{awk}.
+Next comes the code that handles the @command{egrep}-specific behavior. If no
+pattern is supplied with @option{-e}, the first non-option on the
+command line is used. The @command{awk} command-line arguments up to @code{ARGV[Optind]}
+are cleared, so that @command{awk} won't try to process them as files. If no
+files are specified, the standard input is used, and if multiple files are
+specified, we make sure to note this so that the @value{FN}s can precede the
+matched lines in the output:
@example
-@c @group
@c file eg/prog/egrep.awk
if (pattern == "")
pattern = ARGV[Optind++]
@@ -14485,53 +18199,57 @@ of @code{awk}.
# pattern = tolower(pattern)
@}
@c endfile
-@c @end group
@end example
+The last two lines are commented out, since they are not needed in
+@command{gawk}. They should be uncommented if you have to use another version
+of @command{awk}.
+
The next set of lines should be uncommented if you are not using
-@code{gawk}. This rule translates all the characters in the input line
-into lower-case if the @samp{-i} option was specified. The rule is
-commented out since it is not necessary with @code{gawk}.
-@c bug: if a match happens, we output the translated line, not the original
+@command{gawk}. This rule translates all the characters in the input line
+into lowercase if the @option{-i} option is specified.@footnote{It
+also introduces a subtle bug;
+if a match happens, we output the translated line, not the original.}
+The rule is
+commented out since it is not necessary with @command{gawk}:
+
+@c Exercise: Fix this, w/array and new line as key to original line
@example
-@c @group
@c file eg/prog/egrep.awk
#@{
# if (IGNORECASE)
# $0 = tolower($0)
#@}
@c endfile
-@c @end group
@end example
The @code{beginfile} function is called by the rule in @file{ftrans.awk}
when each new file is processed. In this case, it is very simple; all it
does is initialize a variable @code{fcount} to zero. @code{fcount} tracks
how many lines in the current file matched the pattern.
+(Naming the parameter @code{junk} shows we know that @code{beginfile}
+is called with a parameter, but that we're not interested in its value.):
@example
-@group
@c file eg/prog/egrep.awk
function beginfile(junk)
@{
fcount = 0
@}
@c endfile
-@end group
@end example
The @code{endfile} function is called after each file has been processed.
-It is used only when the user wants a count of the number of lines that
-matched. @code{no_print} will be true only if the exit status is desired.
-@code{count_only} will be true if line counts are desired. @code{egrep}
-will therefore only print line counts if printing and counting are enabled.
-The output format must be adjusted depending upon the number of files to be
-processed. Finally, @code{fcount} is added to @code{total}, so that we
-know how many lines altogether matched the pattern.
+It affects the output only when the user wants a count of the number of lines that
+matched. @code{no_print} is true only if the exit status is desired.
+@code{count_only} is true if line counts are desired. @command{egrep}
+therefore only prints line counts if printing and counting are enabled.
+The output format must be adjusted depending upon the number of files to
+process. Finally, @code{fcount} is added to @code{total}, so that we
+know how many lines altogether matched the pattern:
@example
-@group
@c file eg/prog/egrep.awk
function endfile(file)
@{
@@ -14544,30 +18262,38 @@ function endfile(file)
total += fcount
@}
@c endfile
-@end group
@end example
-This rule does most of the work of matching lines. The variable
-@code{matches} will be true if the line matched the pattern. If the user
-wants lines that did not match, the sense of the @code{matches} is inverted
+The following rule does most of the work of matching lines. The variable
+@code{matches} is true if the line matched the pattern. If the user
+wants lines that did not match, the sense of @code{matches} is inverted
using the @samp{!} operator. @code{fcount} is incremented with the value of
-@code{matches}, which will be either one or zero, depending upon a
-successful or unsuccessful match. If the line did not match, the
+@code{matches}, which is either one or zero, depending upon a
+successful or unsuccessful match. If the line does not match, the
@code{next} statement just moves on to the next record.
-There are several optimizations for performance in the following few lines
-of code. If the user only wants exit status (@code{no_print} is true), and
-we don't have to count lines, then it is enough to know that one line in
-this file matched, and we can skip on to the next file with @code{nextfile}.
-Along similar lines, if we are only printing file names, and we
-don't need to count lines, we can print the file name, and then skip to the
-next file with @code{nextfile}.
+A number of additional tests are made, but they are only done if we
+are not counting lines. First, if the user only wants exit status
+(@code{no_print} is true), then it is enough to know that @emph{one}
+line in this file matched, and we can skip on to the next file with
+@code{nextfile}. Similarly, if we are only printing @value{FN}s, we can
+print the @value{FN}, and then skip to the next file with @code{nextfile}.
+Finally, each line is printed, with a leading @value{FN} and colon
+if necessary:
-Finally, each line is printed, with a leading filename and colon if
-necessary.
+@cindex @code{!} operator
+@example
+@c file eg/prog/egrep.awk
+@{
+ matches = ($0 ~ pattern)
+ if (invert)
+ matches = ! matches
+
+ fcount += matches # 1 or 0
+
+ if (! matches)
+ next
-@ignore
-2e: note, probably better to recode the last few lines as
if (! count_only) @{
if (no_print)
nextfile
@@ -14582,47 +18308,14 @@ necessary.
else
print
@}
-@end ignore
-
-@example
-@c @group
-@c file eg/prog/egrep.awk
-@{
- matches = ($0 ~ pattern)
- if (invert)
- matches = ! matches
-
- fcount += matches # 1 or 0
-
- if (! matches)
- next
-
- if (no_print && ! count_only)
- nextfile
-
- if (filenames_only && ! count_only) @{
- print FILENAME
- nextfile
- @}
-
- if (do_filenames && ! count_only)
- print FILENAME ":" $0
-@group
- else if (! count_only)
- print
-@end group
@}
@c endfile
-@c @end group
@end example
-@c @strong{Exercise}: rearrange the code inside @samp{if (! count_only)}.
-
The @code{END} rule takes care of producing the correct exit status. If
-there were no matches, the exit status is one, otherwise it is zero.
+there are no matches, the exit status is one, otherwise it is zero:
@example
-@c @group
@c file eg/prog/egrep.awk
END \
@{
@@ -14631,48 +18324,44 @@ END \
exit 0
@}
@c endfile
-@c @end group
@end example
-The @code{usage} function prints a usage message in case of invalid options
-and then exits.
+The @code{usage} function prints a usage message in case of invalid options,
+and then exits:
@example
-@c @group
@c file eg/prog/egrep.awk
function usage( e)
@{
e = "Usage: egrep [-csvil] [-e pat] [files ...]"
+ e = e "\n\tegrep [-csvil] pat [files ...]"
print e > "/dev/stderr"
exit 1
@}
@c endfile
-@c @end group
@end example
The variable @code{e} is used so that the function fits nicely
on the printed page.
@cindex backslash continuation
-Just a note on programming style. You may have noticed that the @code{END}
+Just a note on programming style: you may have noticed that the @code{END}
rule uses backslash continuation, with the open brace on a line by
itself. This is so that it more closely resembles the way functions
are written. Many of the examples
-@iftex
-in this chapter
-@end iftex
+in this @value{CHAPTER}
use this style. You can decide for yourself if you like writing
-your @code{BEGIN} and @code{END} rules this way,
+your @code{BEGIN} and @code{END} rules this way
or not.
@node Id Program, Split Program, Egrep Program, Clones
-@subsection Printing Out User Information
+@subsection Printing out User Information
-@cindex @code{id} utility
-The @code{id} utility lists a user's real and effective user-id numbers,
+@cindex @command{id} utility
+The @command{id} utility lists a user's real and effective user-id numbers,
real and effective group-id numbers, and the user's group set, if any.
-@code{id} will only print the effective user-id and group-id if they are
-different from the real ones. If possible, @code{id} will also supply the
+@command{id} only prints the effective user-id and group-id if they are
+different from the real ones. If possible, @command{id} also supplies the
corresponding user and group names. The output might look like this:
@example
@@ -14680,61 +18369,61 @@ $ id
@print{} uid=2076(arnold) gid=10(staff) groups=10(staff),4(tty)
@end example
-This information is exactly what is provided by @code{gawk}'s
-@file{/dev/user} special file (@pxref{Special Files, ,Special File Names in @code{gawk}}).
-However, the @code{id} utility provides a more palatable output than just a
-string of numbers.
+This information is part of what is provided by @command{gawk}'s
+@code{PROCINFO} array (@pxref{Built-in Variables}).
+However, the @command{id} utility provides a more palatable output than just
+individual numbers.
-Here is a simple version of @code{id} written in @code{awk}.
+Here is a simple version of @command{id} written in @command{awk}.
It uses the user database library functions
-(@pxref{Passwd Functions, ,Reading the User Database}),
+(@pxref{Passwd Functions, ,Reading the User Database})
and the group database library functions
-(@pxref{Group Functions, ,Reading the Group Database}).
+(@pxref{Group Functions, ,Reading the Group Database}):
The program is fairly straightforward. All the work is done in the
-@code{BEGIN} rule. The user and group id numbers are obtained from
-@file{/dev/user}. If there is no support for @file{/dev/user}, the program
-gives up.
-
+@code{BEGIN} rule. The user and group ID numbers are obtained from
+@code{PROCINFO}.
The code is repetitive. The entry in the user database for the real user-id
number is split into parts at the @samp{:}. The name is the first field.
-Similar code is used for the effective user-id number, and the group
+Similar code is used for the effective user-id number and the group
numbers.
-@findex id.awk
+@cindex @code{id.awk} program
@example
-@c @group
@c file eg/prog/id.awk
# id.awk --- implement id in awk
+#
+# Requires user and group library functions
+@c endfile
+@ignore
+@c file eg/prog/id.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+# Revised February 1996
+@c endfile
+@end ignore
+@c file eg/prog/id.awk
# output is:
# uid=12(foo) euid=34(bar) gid=3(baz) \
# egid=5(blat) groups=9(nine),2(two),1(one)
+@group
BEGIN \
@{
- if ((getline < "/dev/user") < 0) @{
- err = "id: no /dev/user support - cannot run"
- print err > "/dev/stderr"
- exit 1
- @}
- close("/dev/user")
-
- uid = $1
- euid = $2
- gid = $3
- egid = $4
+ uid = PROCINFO["uid"]
+ euid = PROCINFO["euid"]
+ gid = PROCINFO["gid"]
+ egid = PROCINFO["egid"]
+@end group
printf("uid=%d", uid)
pw = getpwuid(uid)
-@group
if (pw != "") @{
split(pw, a, ":")
printf("(%s)", a[1])
@}
-@end group
if (euid != uid) @{
printf(" euid=%d", euid)
@@ -14761,48 +18450,70 @@ BEGIN \
@}
@}
- if (NF > 4) @{
- printf(" groups=");
- for (i = 5; i <= NF; i++) @{
- printf("%d", $i)
- pw = getgrgid($i)
- if (pw != "") @{
- split(pw, a, ":")
- printf("(%s)", a[1])
- @}
-@group
- if (i < NF)
- printf(",")
-@end group
+ for (i = 1; ("group" i) in PROCINFO; i++) @{
+ if (i == 1)
+ printf(" groups=")
+ group = PROCINFO["group" i]
+ printf("%d", group)
+ pw = getgrgid(group)
+ if (pw != "") @{
+ split(pw, a, ":")
+ printf("(%s)", a[1])
@}
+ if (("group" (i+1)) in PROCINFO)
+ printf(",")
@}
+
print ""
@}
@c endfile
-@c @end group
@end example
+@cindex @code{in} operator
+The test in the @code{for} loop is worth noting.
+Any supplementary groups in the @code{PROCINFO} array have the
+indices @code{"group1"} through @code{"group@var{N}"} for some
+@var{N}; i.e., the total number of supplementary groups.
+The problem is, we don't know in advance how many of these groups
+there are.
+
+This loop works by starting at one, concatenating the value with
+@code{"group"}, and then using @code{in} to see if that value is
+in the array. Eventually, @code{i} is incremented past
+the last group in the array and the loop exits.
+
+The loop is also correct if there are @emph{no} supplementary
+groups; then the condition is false the first time it's
+tested, and the loop body never executes.
+
@c exercise!!!
@ignore
-The POSIX version of @code{id} takes arguments that control which
+The POSIX version of @command{id} takes arguments that control which
information is printed. Modify this version to accept the same
arguments and perform in the same way.
@end ignore
@node Split Program, Tee Program, Id Program, Clones
-@subsection Splitting a Large File Into Pieces
+@subsection Splitting a Large File into Pieces
@cindex @code{split} utility
-The @code{split} program splits large text files into smaller pieces. By default,
+The @code{split} program splits large text files into smaller pieces.
+The usage is as follows:
+
+@example
+split @r{[}-@var{count}@r{]} file @r{[} @var{prefix} @r{]}
+@end example
+
+By default,
the output files are named @file{xaa}, @file{xab}, and so on. Each file has
1000 lines in it, with the likely exception of the last file. To change the
-number of lines in each file, you supply a number on the command line
-preceded with a minus, e.g., @samp{-500} for files with 500 lines in them
+number of lines in each file, supply a number on the command line
+preceded with a minus; e.g., @samp{-500} for files with 500 lines in them
instead of 1000. To change the name of the output files to something like
-@file{myfileaa}, @file{myfileab}, and so on, you supply an additional
-argument that specifies the filename.
+@file{myfileaa}, @file{myfileab}, and so on, supply an additional
+argument that specifies the @value{FN} prefix.
-Here is a version of @code{split} in @code{awk}. It uses the @code{ord} and
+Here is a version of @code{split} in @command{awk}. It uses the @code{ord} and
@code{chr} functions presented in
@ref{Ordinal Functions, ,Translating Between Characters and Numbers}.
@@ -14810,17 +18521,25 @@ The program first sets its defaults, and then tests to make sure there are
not too many arguments. It then looks at each argument in turn. The
first argument could be a minus followed by a number. If it is, this happens
to look like a negative number, so it is made positive, and that is the
-count of lines. The data file name is skipped over, and the final argument
-is used as the prefix for the output file names.
+count of lines. The data @value{FN} is skipped over and the final argument
+is used as the prefix for the output @value{FN}s:
-@findex split.awk
+@cindex @code{split.awk} program
@example
-@c @group
@c file eg/prog/split.awk
# split.awk --- do split in awk
+#
+# Requires ord and chr library functions
+@c endfile
+@ignore
+@c file eg/prog/split.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/prog/split.awk
# usage: split [-num] [file] [outname]
BEGIN @{
@@ -14847,46 +18566,49 @@ BEGIN @{
out = (outfile s1 s2)
@}
@c endfile
-@c @end group
@end example
The next rule does most of the work. @code{tcount} (temporary count) tracks
how many lines have been printed to the output file so far. If it is greater
than @code{count}, it is time to close the current file and start a new one.
-@code{s1} and @code{s2} track the current suffixes for the file name. If
+@code{s1} and @code{s2} track the current suffixes for the @value{FN}. If
they are both @samp{z}, the file is just too big. Otherwise, @code{s1}
moves to the next letter in the alphabet and @code{s2} starts over again at
-@samp{a}.
+@samp{a}:
+@c else on separate line here for page breaking
@example
-@c @group
@c file eg/prog/split.awk
@{
if (++tcount > count) @{
close(out)
if (s2 == "z") @{
if (s1 == "z") @{
- printf("split: %s is too large to split\n", \
+ printf("split: %s is too large to split\n",
FILENAME) > "/dev/stderr"
exit 1
@}
s1 = chr(ord(s1) + 1)
s2 = "a"
- @} else
+ @}
+@group
+ else
s2 = chr(ord(s2) + 1)
+@end group
out = (outfile s1 s2)
tcount = 1
@}
print > out
@}
@c endfile
-@c @end group
@end example
-The @code{usage} function simply prints an error message and exits.
+@c Exercise: do this with just awk builtin functions, index("abc..."), substr, etc.
+
+@noindent
+The @code{usage} function simply prints an error message and exits:
@example
-@c @group
@c file eg/prog/split.awk
function usage( e)
@{
@@ -14895,97 +18617,95 @@ function usage( e)
exit 1
@}
@c endfile
-@c @end group
@end example
@noindent
The variable @code{e} is used so that the function
fits nicely on the
-@iftex
-page.
-@end iftex
@ifinfo
screen.
@end ifinfo
+@ifnotinfo
+page.
+@end ifnotinfo
-This program is a bit sloppy; it relies on @code{awk} to close the last file
+This program is a bit sloppy; it relies on @command{awk} to close the last file
for it automatically, instead of doing it in an @code{END} rule.
+It also assumes that letters are contiguous in the character set,
+which isn't true for EBCDIC systems.
+@c BFD...
@node Tee Program, Uniq Program, Split Program, Clones
-@subsection Duplicating Output Into Multiple Files
+@subsection Duplicating Output into Multiple Files
@cindex @code{tee} utility
The @code{tee} program is known as a ``pipe fitting.'' @code{tee} copies
-its standard input to its standard output, and also duplicates it to the
-files named on the command line. Its usage is:
+its standard input to its standard output and also duplicates it to the
+files named on the command line. Its usage is as follows:
@example
tee @r{[}-a@r{]} file @dots{}
@end example
-The @samp{-a} option tells @code{tee} to append to the named files, instead of
+The @option{-a} option tells @code{tee} to append to the named files, instead of
truncating them and starting over.
-The @code{BEGIN} rule first makes a copy of all the command line arguments,
+The @code{BEGIN} rule first makes a copy of all the command-line arguments
into an array named @code{copy}.
@code{ARGV[0]} is not copied, since it is not needed.
-@code{tee} cannot use @code{ARGV} directly, since @code{awk} will attempt to
-process each file named in @code{ARGV} as input data.
+@code{tee} cannot use @code{ARGV} directly, since @command{awk} attempts to
+process each @value{FN} in @code{ARGV} as input data.
-If the first argument is @samp{-a}, then the flag variable
+@cindex flag variables
+If the first argument is @option{-a}, then the flag variable
@code{append} is set to true, and both @code{ARGV[1]} and
-@code{copy[1]} are deleted. If @code{ARGC} is less than two, then no file
-names were supplied, and @code{tee} prints a usage message and exits.
-Finally, @code{awk} is forced to read the standard input by setting
-@code{ARGV[1]} to @code{"-"}, and @code{ARGC} to two.
+@code{copy[1]} are deleted. If @code{ARGC} is less than two, then no
+@value{FN}s were supplied and @code{tee} prints a usage message and exits.
+Finally, @command{awk} is forced to read the standard input by setting
+@code{ARGV[1]} to @code{"-"} and @code{ARGC} to two:
-@c 2e: the `ARGC--' in the `if (ARGV[1] == "-a")' isn't needed.
-
-@findex tee.awk
+@c NEXT ED: Add more leading commentary in this program
+@cindex @code{tee.awk} program
@example
-@group
@c file eg/prog/tee.awk
# tee.awk --- tee in awk
+@c endfile
+@ignore
+@c file eg/prog/tee.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
# Revised December 1995
-@end group
-@group
+@c endfile
+@end ignore
+@c file eg/prog/tee.awk
BEGIN \
@{
for (i = 1; i < ARGC; i++)
copy[i] = ARGV[i]
-@end group
-@group
if (ARGV[1] == "-a") @{
append = 1
delete ARGV[1]
delete copy[1]
ARGC--
@}
-@end group
-@group
if (ARGC < 2) @{
print "usage: tee [-a] file ..." > "/dev/stderr"
exit 1
@}
-@end group
-@group
ARGV[1] = "-"
ARGC = 2
@}
@c endfile
-@end group
@end example
The single rule does all the work. Since there is no pattern, it is
executed for each line of input. The body of the rule simply prints the
-line into each file on the command line, and then to the standard output.
+line into each file on the command line, and then to the standard output:
@example
-@group
@c file eg/prog/tee.awk
@{
# moving the if outside the loop makes it run faster
@@ -14998,10 +18718,10 @@ line into each file on the command line, and then to the standard output.
print
@}
@c endfile
-@end group
@end example
-It would have been possible to code the loop this way:
+@noindent
+It is also possible to write the loop this way:
@example
for (i in copy)
@@ -15012,17 +18732,16 @@ for (i in copy)
@end example
@noindent
-This is more concise, but it is also less efficient. The @samp{if} is
+This is more concise but it is also less efficient. The @samp{if} is
tested for each record and for each output file. By duplicating the loop
body, the @samp{if} is only tested once for each input record. If there are
-@var{N} input records and @var{M} input files, the first method only
-executes @var{N} @samp{if} statements, while the second would execute
+@var{N} input records and @var{M} output files, the first method only
+executes @var{N} @samp{if} statements, while the second executes
@var{N}@code{*}@var{M} @samp{if} statements.
-Finally, the @code{END} rule cleans up, by closing all the output files.
+Finally, the @code{END} rule cleans up by closing all the output files:
@example
-@c @group
@c file eg/prog/tee.awk
END \
@{
@@ -15030,16 +18749,16 @@ END \
close(copy[i])
@}
@c endfile
-@c @end group
@end example
@node Uniq Program, Wc Program, Tee Program, Clones
-@subsection Printing Non-duplicated Lines of Text
+@subsection Printing Non-Duplicated Lines of Text
-@cindex @code{uniq} utility
-The @code{uniq} utility reads sorted lines of data on its standard input,
-and (by default) removes duplicate lines. In other words, only unique lines
-are printed, hence the name. @code{uniq} has a number of options. The usage is:
+@cindex @command{uniq} utility
+The @command{uniq} utility reads sorted lines of data on its standard
+input, and by default removes duplicate lines. In other words, it only
+prints unique lines---hence the name. @command{uniq} has a number of
+options. The usage is as follows:
@example
uniq @r{[}-udc @r{[}-@var{n}@r{]]} @r{[}+@var{n}@r{]} @r{[} @var{input file} @r{[} @var{output file} @r{]]}
@@ -15055,12 +18774,12 @@ Only print repeated lines.
Only print non-repeated lines.
@item -c
-Count lines. This option overrides @samp{-d} and @samp{-u}. Both repeated
+Count lines. This option overrides @option{-d} and @option{-u}. Both repeated
and non-repeated lines are counted.
@item -@var{n}
Skip @var{n} fields before comparing lines. The definition of fields
-is similar to @code{awk}'s default: non-whitespace characters separated
+is similar to @command{awk}'s default: non-whitespace characters separated
by runs of spaces and/or tabs.
@item +@var{n}
@@ -15076,49 +18795,57 @@ The generated output is sent to the named output file, instead of to the
standard output.
@end table
-Normally @code{uniq} behaves as if both the @samp{-d} and @samp{-u} options
-had been provided.
+Normally @command{uniq} behaves as if both the @option{-d} and
+@option{-u} options are provided.
-Here is an @code{awk} implementation of @code{uniq}. It uses the
+@command{uniq} uses the
@code{getopt} library function
-(@pxref{Getopt Function, ,Processing Command Line Options}),
+(@pxref{Getopt Function, ,Processing Command-Line Options})
and the @code{join} library function
-(@pxref{Join Function, ,Merging an Array Into a String}).
+(@pxref{Join Function, ,Merging an Array into a String}).
The program begins with a @code{usage} function and then a brief outline of
the options and their meanings in a comment.
-
-The @code{BEGIN} rule deals with the command line arguments and options. It
+The @code{BEGIN} rule deals with the command-line arguments and options. It
uses a trick to get @code{getopt} to handle options of the form @samp{-25},
treating such an option as the option letter @samp{2} with an argument of
-@samp{5}. If indeed two or more digits were supplied (@code{Optarg} looks
+@samp{5}. If indeed two or more digits are supplied (@code{Optarg} looks
like a number), @code{Optarg} is
-concatenated with the option digit, and then result is added to zero to make
+concatenated with the option digit and then the result is added to zero to make
it into a number. If there is only one digit in the option, then
-@code{Optarg} is not needed, and @code{Optind} must be decremented so that
-@code{getopt} will process it next time. This code is admittedly a bit
+@code{Optarg} is not needed. @code{Optind} must be decremented so that
+@code{getopt} processes it next time. This code is admittedly a bit
tricky.
-If no options were supplied, then the default is taken, to print both
+If no options are supplied, then the default is taken, to print both
repeated and non-repeated lines. The output file, if provided, is assigned
-to @code{outputfile}. Earlier, @code{outputfile} was initialized to the
-standard output, @file{/dev/stdout}.
+to @code{outputfile}. Early on, @code{outputfile} is initialized to the
+standard output, @file{/dev/stdout}:
-@findex uniq.awk
+@cindex @code{uniq.awk} program
@example
@c file eg/prog/uniq.awk
+@group
# uniq.awk --- do uniq in awk
+#
+# Requires getopt and join library functions
+@end group
+@c endfile
+@ignore
+@c file eg/prog/uniq.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
-@group
+@c endfile
+@end ignore
+@c file eg/prog/uniq.awk
function usage( e)
@{
e = "Usage: uniq [-udc [-n]] [+n] [ in [ out ]]"
print e > "/dev/stderr"
exit 1
@}
-@end group
# -c count lines. overrides -d and -u
# -d only repeated lines
@@ -15143,12 +18870,10 @@ BEGIN \
# this messes us up for things like -5
if (Optarg ~ /^[0-9]+$/)
fcount = (c Optarg) + 0
-@group
else @{
fcount = c + 0
Optind--
@}
-@end group
@} else
usage()
@}
@@ -15175,26 +18900,22 @@ BEGIN \
The following function, @code{are_equal}, compares the current line,
@code{$0}, to the
previous line, @code{last}. It handles skipping fields and characters.
-
-If no field count and no character count were specified, @code{are_equal}
+If no field count and no character count are specified, @code{are_equal}
simply returns one or zero depending upon the result of a simple string
comparison of @code{last} and @code{$0}. Otherwise, things get more
complicated.
-
If fields have to be skipped, each line is broken into an array using
@code{split}
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}),
-and then the desired fields are joined back into a line using @code{join}.
+(@pxref{String Functions, ,String Manipulation Functions});
+the desired fields are then joined back into a line using @code{join}.
The joined lines are stored in @code{clast} and @code{cline}.
If no fields are skipped, @code{clast} and @code{cline} are set to
-@code{last} and @code{$0} respectively.
-
+@code{last} and @code{$0}, respectively.
Finally, if characters are skipped, @code{substr} is used to strip off the
leading @code{charcount} characters in @code{clast} and @code{cline}. The
-two strings are then compared, and @code{are_equal} returns the result.
+two strings are then compared and @code{are_equal} returns the result:
@example
-@c @group
@c file eg/prog/uniq.awk
function are_equal( n, m, clast, cline, alast, aline)
@{
@@ -15218,38 +18939,35 @@ function are_equal( n, m, clast, cline, alast, aline)
return (clast == cline)
@}
@c endfile
-@c @end group
@end example
The following two rules are the body of the program. The first one is
executed only for the very first line of data. It sets @code{last} equal to
@code{$0}, so that subsequent lines of text have something to be compared to.
-The second rule does the work. The variable @code{equal} will be one or zero
-depending upon the results of @code{are_equal}'s comparison. If @code{uniq}
-is counting repeated lines, then the @code{count} variable is incremented if
-the lines are equal. Otherwise the line is printed and @code{count} is
-reset, since the two lines are not equal.
-
-If @code{uniq} is not counting, @code{count} is incremented if the lines are
-equal. Otherwise, if @code{uniq} is counting repeated lines, and more than
-one line has been seen, or if @code{uniq} is counting non-repeated lines,
-and only one line has been seen, then the line is printed, and @code{count}
+The second rule does the work. The variable @code{equal} is one or zero,
+depending upon the results of @code{are_equal}'s comparison. If @command{uniq}
+is counting repeated lines, and the lines are equal, then it increments the @code{count} variable.
+Otherwise it prints the line and resets @code{count},
+since the two lines are not equal.
+
+If @command{uniq} is not counting, and if the lines are equal, @code{count} is incremented.
+Nothing is printed, since the point is to remove duplicates.
+Otherwise, if @command{uniq} is counting repeated lines and more than
+one line is seen, or if @command{uniq} is counting non-repeated lines
+and only one line is seen, then the line is printed, and @code{count}
is reset.
Finally, similar logic is used in the @code{END} rule to print the final
-line of input data.
+line of input data:
@example
-@c @group
@c file eg/prog/uniq.awk
-@group
NR == 1 @{
last = $0
next
@}
-@end group
-
+
@{
equal = are_equal()
@@ -15275,7 +18993,6 @@ NR == 1 @{
@}
@}
-@group
END @{
if (do_count)
printf("%4d %s\n", count, last) > outputfile
@@ -15283,25 +19000,23 @@ END @{
(non_repeated_only && count == 1))
print last > outputfile
@}
-@end group
@c endfile
-@c @end group
@end example
-@node Wc Program, , Uniq Program, Clones
+@node Wc Program, , Uniq Program, Clones
@subsection Counting Things
-@cindex @code{wc} utility
-The @code{wc} (word count) utility counts lines, words, and characters in
-one or more input files. Its usage is:
+@cindex @command{wc} utility
+The @command{wc} (word count) utility counts lines, words, and characters in
+one or more input files. Its usage is as follows:
@example
wc @r{[}-lwc@r{]} @r{[} @var{files} @dots{} @r{]}
@end example
-If no files are specified on the command line, @code{wc} reads its standard
-input. If there are multiple files, it will also print total counts for all
-the files. The options and their meanings are:
+If no files are specified on the command line, @command{wc} reads its standard
+input. If there are multiple files, it also prints total counts for all
+the files. The options and their meanings are shown in the following list:
@table @code
@item -l
@@ -15310,40 +19025,46 @@ Only count lines.
@item -w
Only count words.
A ``word'' is a contiguous sequence of non-whitespace characters, separated
-by spaces and/or tabs. Happily, this is the normal way @code{awk} separates
+by spaces and/or tabs. Happily, this is the normal way @command{awk} separates
fields in its input data.
@item -c
Only count characters.
@end table
-Implementing @code{wc} in @code{awk} is particularly elegant, since
-@code{awk} does a lot of the work for us; it splits lines into words (i.e.@:
-fields) and counts them, it counts lines (i.e.@: records) for us, and it can
-easily tell us how long a line is.
+Implementing @command{wc} in @command{awk} is particularly elegant,
+since @command{awk} does a lot of the work for us; it splits lines into
+words (i.e., fields) and counts them, it counts lines (i.e., records),
+and it can easily tell us how long a line is.
-This version uses the @code{getopt} library function
-(@pxref{Getopt Function, ,Processing Command Line Options}),
+This uses the @code{getopt} library function
+(@pxref{Getopt Function, ,Processing Command-Line Options})
and the file transition functions
-(@pxref{Filetrans Function, ,Noting Data File Boundaries}).
+(@pxref{Filetrans Function, ,Noting @value{DDF} Boundaries}).
-This version has one major difference from traditional versions of @code{wc}.
-Our version always prints the counts in the order lines, words,
-and characters. Traditional versions note the order of the @samp{-l},
-@samp{-w}, and @samp{-c} options on the command line, and print the counts
-in that order.
+This version has one notable difference from traditional versions of
+@command{wc}: it always prints the counts in the order lines, words,
+and characters. Traditional versions note the order of the @option{-l},
+@option{-w}, and @option{-c} options on the command line, and print the
+counts in that order.
-The @code{BEGIN} rule does the argument processing.
-The variable @code{print_total} will
-be true if more than one file was named on the command line.
+The @code{BEGIN} rule does the argument processing. The variable
+@code{print_total} is true if more than one file is named on the
+command line:
-@findex wc.awk
+@cindex @code{wc.awk} program
@example
-@c @group
@c file eg/prog/wc.awk
# wc.awk --- count lines, words, characters
+@c endfile
+@ignore
+@c file eg/prog/wc.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/prog/wc.awk
# Options:
# -l only count lines
@@ -15351,6 +19072,8 @@ be true if more than one file was named on the command line.
# -c only count characters
#
# Default is to count lines, words, characters
+#
+# Requires getopt and file transition library functions
BEGIN @{
# let getopt print a message about
@@ -15373,28 +19096,31 @@ BEGIN @{
print_total = (ARGC - i > 2)
@}
@c endfile
-@c @end group
@end example
The @code{beginfile} function is simple; it just resets the counts of lines,
-words, and characters to zero, and saves the current file name in
-@code{fname}.
-
-The @code{endfile} function adds the current file's numbers to the running
-totals of lines, words, and characters. It then prints out those numbers
-for the file that was just read. It relies on @code{beginfile} to reset the
-numbers for the following data file.
+words, and characters to zero, and saves the current @value{FN} in
+@code{fname}:
+@c NEXT ED: make it lines = words = chars = 0
@example
-@c left brace on line with `function' because of page breaking
@c file eg/prog/wc.awk
-@group
-function beginfile(file) @{
+function beginfile(file)
+@{
chars = lines = words = 0
fname = FILENAME
@}
-@end group
+@c endfile
+@end example
+
+The @code{endfile} function adds the current file's numbers to the running
+totals of lines, words, and characters. It then prints out those numbers
+for the file that was just read. It relies on @code{beginfile} to reset the
+numbers for the following @value{DF}:
+@c NEXT ED: make order for += be lines, words, chars
+@example
+@c file eg/prog/wc.awk
function endfile(file)
@{
tchars += chars
@@ -15402,8 +19128,10 @@ function endfile(file)
twords += words
if (do_lines)
printf "\t%d", lines
+@group
if (do_words)
printf "\t%d", words
+@end group
if (do_chars)
printf "\t%d", chars
printf "\t%s\n", fname
@@ -15411,20 +19139,20 @@ function endfile(file)
@c endfile
@end example
-There is one rule that is executed for each line. It adds the length of the
-record to @code{chars}. It has to add one, since the newline character
-separating records (the value of @code{RS}) is not part of the record
-itself. @code{lines} is incremented for each line read, and @code{words} is
-incremented by the value of @code{NF}, the number of ``words'' on this
-line.@footnote{Examine the code in
-@ref{Filetrans Function, ,Noting Data File Boundaries}.
-Why must @code{wc} use a separate @code{lines} variable, instead of using
-the value of @code{FNR} in @code{endfile}?}
-
-Finally, the @code{END} rule simply prints the totals for all the files.
+There is one rule that is executed for each line. It adds the length of
+the record, plus one, to @code{chars}. Adding one plus the record length
+is needed because the newline character separating records (the value
+of @code{RS}) is not part of the record itself, and thus not included
+in its length. Next, @code{lines} is incremented for each line read,
+and @code{words} is incremented by the value of @code{NF}, which is the
+number of ``words'' on this line:@footnote{@command{wc} can't just use
+the value of @code{FNR} in @code{endfile}. If you examine the code in
+@ref{Filetrans Function, ,Noting @value{DDF} Boundaries},
+you will see that @code{FNR} has already been reset by the time
+@code{endfile} is called.}
+@c ONE DAY: make the above an exercise, instead of giving away the answer.
@example
-@c @group
@c file eg/prog/wc.awk
# do per line
@{
@@ -15432,7 +19160,13 @@ Finally, the @code{END} rule simply prints the totals for all the files.
lines++
words += NF
@}
+@c endfile
+@end example
+Finally, the @code{END} rule simply prints the totals for all the files.
+
+@example
+@c file eg/prog/wc.awk
END @{
if (print_total) @{
if (do_lines)
@@ -15445,64 +19179,80 @@ END @{
@}
@}
@c endfile
-@c @end group
@end example
-@node Miscellaneous Programs, , Clones, Sample Programs
-@section A Grab Bag of @code{awk} Programs
+@node Miscellaneous Programs, , Clones, Sample Programs
+@section A Grab Bag of @command{awk} Programs
-This section is a large ``grab bag'' of miscellaneous programs.
+This @value{SECTION} is a large ``grab bag'' of miscellaneous programs.
We hope you find them both interesting and enjoyable.
@menu
-* Dupword Program:: Finding duplicated words in a document.
-* Alarm Program:: An alarm clock.
-* Translate Program:: A program similar to the @code{tr} utility.
-* Labels Program:: Printing mailing labels.
-* Word Sorting:: A program to produce a word usage count.
-* History Sorting:: Eliminating duplicate entries from a history
- file.
-* Extract Program:: Pulling out programs from Texinfo source
- files.
-* Simple Sed:: A Simple Stream Editor.
-* Igawk Program:: A wrapper for @code{awk} that includes files.
+* Dupword Program:: Finding duplicated words in a document.
+* Alarm Program:: An alarm clock.
+* Translate Program:: A program similar to the @command{tr} utility.
+* Labels Program:: Printing mailing labels.
+* Word Sorting:: A program to produce a word usage count.
+* History Sorting:: Eliminating duplicate entries from a history
+ file.
+* Extract Program:: Pulling out programs from Texinfo source
+ files.
+* Simple Sed:: A Simple Stream Editor.
+* Igawk Program:: A wrapper for @command{awk} that includes
+ files.
@end menu
@node Dupword Program, Alarm Program, Miscellaneous Programs, Miscellaneous Programs
@subsection Finding Duplicated Words in a Document
A common error when writing large amounts of prose is to accidentally
-duplicate words. Often you will see this in text as something like ``the
-the program does the following @dots{}.'' When the text is on-line, often
+duplicate words. Typically you will see this in text as something like ``the
+the program does the following @dots{}.'' When the text is online, often
the duplicated words occur at the end of one line and the beginning of
another, making them very difficult to spot.
@c as here!
-This program, @file{dupword.awk}, scans through a file one line at a time,
+This program, @file{dupword.awk}, scans through a file one line at a time
and looks for adjacent occurrences of the same word. It also saves the last
word on a line (in the variable @code{prev}) for comparison with the first
word on the next line.
-The first two statements make sure that the line is all lower-case, so that,
-for example,
-``The'' and ``the'' compare equal to each other. The second statement
-removes all non-alphanumeric and non-whitespace characters from the line, so
-that punctuation does not affect the comparison either. This sometimes
-leads to reports of duplicated words that really are different, but this is
-unusual.
+@cindex Texinfo
+The first two statements make sure that the line is all lowercase,
+so that, for example, ``The'' and ``the'' compare equal to each other.
+The next statement replaces non-alphanumeric and non-whitespace characters
+with spaces, so that punctuation does not affect the comparison either.
+The characters are replaced with spaces so that formatting controls
+don't create nonsense words (e.g., the Texinfo @samp{@@code@{NF@}}
+becomes @samp{codeNF} if punctuation is simply deleted). The record is
+then re-split into fields, yielding just the actual words on the line,
+and insuring that there are no empty fields.
+
+If there are no fields left after removing all the punctuation, the
+current record is skipped. Otherwise, the program loops through each
+word, comparing it to the previous one:
-@c FIXME: add check for $i != ""
-@findex dupword.awk
+@cindex @code{dupword.awk} program
@example
-@group
@c file eg/prog/dupword.awk
-# dupword --- find duplicate words in text
+# dupword.awk --- find duplicate words in text
+@c endfile
+@ignore
+@c file eg/prog/dupword.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# December 1991
+# Revised October 2000
+@c endfile
+@end ignore
+@c file eg/prog/dupword.awk
@{
$0 = tolower($0)
- gsub(/[^A-Za-z0-9 \t]/, "");
+ gsub(/[^[:alnum:][:blank:]]/, " ");
+ $0 = $0 # re-split
+ if (NF == 0)
+ next
if ($1 == prev)
printf("%s:%d: duplicate %s\n",
FILENAME, FNR, $1)
@@ -15513,37 +19263,50 @@ unusual.
prev = $NF
@}
@c endfile
-@end group
@end example
@node Alarm Program, Translate Program, Dupword Program, Miscellaneous Programs
@subsection An Alarm Clock Program
+@cindex insomnia, cure for
+@cindex Robbins, Arnold
+@quotation
+@i{Nothing cures insomnia like a ringing alarm clock.}@*
+Arnold Robbins
+@end quotation
The following program is a simple ``alarm clock'' program.
-You give it a time of day, and an optional message. At the given time,
+You give it a time of day and an optional message. At the specified time,
it prints the message on the standard output. In addition, you can give it
-the number of times to repeat the message, and also a delay between
+the number of times to repeat the message as well as a delay between
repetitions.
This program uses the @code{gettimeofday} function from
@ref{Gettimeofday Function, ,Managing the Time of Day}.
All the work is done in the @code{BEGIN} rule. The first part is argument
-checking and setting of defaults; the delay, the count, and the message to
-print. If the user supplied a message, but it does not contain the ASCII BEL
-character (known as the ``alert'' character, @samp{\a}), then it is added to
+checking and setting of defaults: the delay, the count, and the message to
+print. If the user supplied a message without the ASCII BEL
+character (known as the ``alert'' character, @code{"\a"}), then it is added to
the message. (On many systems, printing the ASCII BEL generates some sort
-of audible alert. Thus, when the alarm goes off, the system calls attention
-to itself, in case the user is not looking at their computer or terminal.)
+of audible alert. Thus when the alarm goes off, the system calls attention
+to itself in case the user is not looking at their computer or terminal.):
-@findex alarm.awk
+@cindex @code{alarm.awk} program
@example
-@c @group
@c file eg/prog/alarm.awk
-# alarm --- set an alarm
+# alarm.awk --- set an alarm
+#
+# Requires gettimeofday library function
+@c endfile
+@ignore
+@c file eg/prog/alarm.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
+@c endfile
+@end ignore
+@c file eg/prog/alarm.awk
# usage: alarm time [ "message" [ count [ delay ] ] ]
BEGIN \
@@ -15553,7 +19316,8 @@ BEGIN \
usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1])
if (ARGC < 2) @{
- print usage > "/dev/stderr"
+ print usage1 > "/dev/stderr"
+ print usage2 > "/dev/stderr"
exit 1
@} else if (ARGC == 5) @{
delay = ARGV[4] + 0
@@ -15573,27 +19337,26 @@ BEGIN \
# set defaults for once we reach the desired time
if (delay == 0)
delay = 180 # 3 minutes
+@group
if (count == 0)
count = 5
-@group
+@end group
if (message == "")
message = sprintf("\aIt is now %s!\a", ARGV[1])
else if (index(message, "\a") == 0)
message = "\a" message "\a"
-@end group
@c endfile
@end example
-The next section of code turns the alarm time into hours and minutes,
-and converts it if necessary to a 24-hour clock. Then it turns that
+The next @value{SECTION} of code turns the alarm time into hours and minutes,
+converts it (if necessary) to a 24-hour clock, and then turns that
time into a count of the seconds since midnight. Next it turns the current
time into a count of seconds since midnight. The difference between the two
-is how long to wait before setting off the alarm.
+is how long to wait before setting off the alarm:
@example
-@c @group
@c file eg/prog/alarm.awk
- # split up dest time
+ # split up alarm time
split(ARGV[1], atime, ":")
hour = atime[1] + 0 # force numeric
minute = atime[2] + 0 # force numeric
@@ -15621,25 +19384,23 @@ is how long to wait before setting off the alarm.
exit 1
@}
@c endfile
-@c @end group
@end example
+@cindex @command{sleep} utility
Finally, the program uses the @code{system} function
-(@pxref{I/O Functions, ,Built-in Functions for Input/Output})
-to call the @code{sleep} utility. The @code{sleep} utility simply pauses
+(@pxref{I/O Functions, ,Input/Output Functions})
+to call the @command{sleep} utility. The @command{sleep} utility simply pauses
for the given number of seconds. If the exit status is not zero,
-the program assumes that @code{sleep} was interrupted, and exits. If
-@code{sleep} exited with an OK status (zero), then the program prints the
-message in a loop, again using @code{sleep} to delay for however many
-seconds are necessary.
+the program assumes that @command{sleep} was interrupted and exits. If
+@command{sleep} exited with an OK status (zero), then the program prints the
+message in a loop, again using @command{sleep} to delay for however many
+seconds are necessary:
@example
@c file eg/prog/alarm.awk
-@group
# zzzzzz..... go away if interrupted
if (system(sprintf("sleep %d", naptime)) != 0)
exit 1
-@end group
# time to notify!
command = sprintf("sleep %d", delay)
@@ -15658,46 +19419,48 @@ seconds are necessary.
@node Translate Program, Labels Program, Alarm Program, Miscellaneous Programs
@subsection Transliterating Characters
-The system @code{tr} utility transliterates characters. For example, it is
-often used to map upper-case letters into lower-case, for further
-processing.
+@cindex @command{tr} utility
+The system @command{tr} utility transliterates characters. For example, it is
+often used to map uppercase letters into lowercase for further processing:
@example
-@var{generate data} | tr '[A-Z]' '[a-z]' | @var{process data} @dots{}
+@var{generate data} | tr 'A-Z' 'a-z' | @var{process data} @dots{}
@end example
-You give @code{tr} two lists of characters enclosed in square brackets.
-Usually, the lists are quoted to keep the shell from attempting to do a
-filename expansion.@footnote{On older, non-POSIX systems, @code{tr} often
-does not require that the lists be enclosed in square brackets and quoted.
-This is a feature.} When processing the input, the
-first character in the first list is replaced with the first character in the
-second list, the second character in the first list is replaced with the
-second character in the second list, and so on.
-If there are more characters in the ``from'' list than in the ``to'' list,
-the last character of the ``to'' list is used for the remaining characters
-in the ``from'' list.
+@command{tr} requires two lists of characters.@footnote{On some older
+System V systems,
+@command{tr} may require that the lists be written as
+range expressions enclosed in square brackets (@samp{[a-z]}) and quoted,
+to prevent the shell from attempting a @value{FN} expansion. This is
+not a feature.} When processing the input, the first character in the
+first list is replaced with the first character in the second list,
+the second character in the first list is replaced with the second
+character in the second list, and so on. If there are more characters
+in the ``from'' list than in the ``to'' list, the last character of the
+``to'' list is used for the remaining characters in the ``from'' list.
Some time ago,
@c early or mid-1989!
-a user proposed to us that we add a transliteration function to @code{gawk}.
-Being opposed to ``creeping featurism,'' I wrote the following program to
+a user proposed that a transliteration function should
+be added to @command{gawk}.
+@c Wishing to avoid gratuitous new features,
+@c at least theoretically
+The following program was written to
prove that character transliteration could be done with a user-level
-function. This program is not as complete as the system @code{tr} utility,
-but it will do most of the job.
-
-The @code{translate} program demonstrates one of the few weaknesses of
-standard
-@code{awk}: dealing with individual characters is very painful, requiring
-repeated use of the @code{substr}, @code{index}, and @code{gsub} built-in
-functions
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).@footnote{This
-program was written before @code{gawk} acquired the ability to
-split each character in a string into separate array elements.
-How might you use this new feature to simplify the program?}
+function. This program is not as complete as the system @command{tr} utility
+but it does most of the job.
+
+The @command{translate} program demonstrates one of the few weaknesses
+of standard @command{awk}: dealing with individual characters is very
+painful, requiring repeated use of the @code{substr}, @code{index},
+and @code{gsub} built-in functions
+(@pxref{String Functions, ,String Manipulation Functions}).@footnote{This
+program was written before @command{gawk} acquired the ability to
+split each character in a string into separate array elements.}
+@c Exercise: How might you use this new feature to simplify the program?
There are two functions. The first, @code{stranslate}, takes three
-arguments.
+arguments:
@table @code
@item from
@@ -15719,19 +19482,25 @@ is used to change it to the corresponding @code{to} character.
The @code{translate} function simply calls @code{stranslate} using @code{$0}
as the target. The main program sets two global variables, @code{FROM} and
@code{TO}, from the command line, and then changes @code{ARGV} so that
-@code{awk} will read from the standard input.
+@command{awk} reads from the standard input.
-Finally, the processing rule simply calls @code{translate} for each record.
+Finally, the processing rule simply calls @code{translate} for each record:
-@findex translate.awk
+@cindex @code{translate.awk} program
@example
-@c @group
@c file eg/prog/translate.awk
-# translate --- do tr like stuff
+# translate.awk --- do tr-like stuff
+@c endfile
+@ignore
+@c file eg/prog/translate.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# August 1989
-# bugs: does not handle things like: tr A-Z a-z, it has
+@c endfile
+@end ignore
+@c file eg/prog/translate.awk
+# Bugs: does not handle things like: tr A-Z a-z, it has
# to be spelled out. However, if `to' is shorter than `from',
# the last character in `to' is used for the rest of `from'.
@@ -15757,9 +19526,9 @@ function translate(from, to)
return $0 = stranslate(from, to, $0)
@}
-@group
# main program
BEGIN @{
+@group
if (ARGC < 3) @{
print "usage: translate from to" > "/dev/stderr"
exit
@@ -15776,16 +19545,17 @@ BEGIN @{
print
@}
@c endfile
-@c @end group
@end example
While it is possible to do character transliteration in a user-level
-function, it is not necessarily efficient, and we started to consider adding
-a built-in function. However, shortly after writing this program, we learned
-that the System V Release 4 @code{awk} had added the @code{toupper} and
-@code{tolower} functions. These functions handle the vast majority of the
+function, it is not necessarily efficient, and we (the @command{gawk}
+authors) started to consider adding a built-in function. However,
+shortly after writing this program, we learned that the System V Release 4
+@command{awk} had added the @code{toupper} and @code{tolower} functions
+(@pxref{String Functions, ,String Manipulation Functions}).
+These functions handle the vast majority of the
cases where character transliteration is necessary, and so we chose to
-simply add those functions to @code{gawk} as well, and then leave well
+simply add those functions to @command{gawk} as well and then leave well
enough alone.
An obvious improvement to this program would be to set up the
@@ -15798,8 +19568,9 @@ will never change throughout the lifetime of the program.
Here is a ``real world''@footnote{``Real world'' is defined as
``a program actually used to get something done.''}
-program. This script reads lists of names and
-addresses, and generates mailing labels. Each page of labels has 20 labels
+program. This
+script reads lists of names and
+addresses and generates mailing labels. Each page of labels has 20 labels
on it, two across and ten down. The addresses are guaranteed to be no more
than five lines of data. Each address is separated from the next by a blank
line.
@@ -15809,19 +19580,19 @@ is stored in the @code{line} array. The single rule takes care of filling
the @code{line} array and printing the page when 20 labels have been read.
The @code{BEGIN} rule simply sets @code{RS} to the empty string, so that
-@code{awk} will split records at blank lines
-(@pxref{Records, ,How Input is Split into Records}).
-It sets @code{MAXLINES} to 100, since @code{MAXLINE} is the maximum number
+@command{awk} splits records at blank lines
+(@pxref{Records, ,How Input Is Split into Records}).
+It sets @code{MAXLINES} to 100, since 100 is the maximum number
of lines on the page (20 * 5 = 100).
Most of the work is done in the @code{printpage} function.
The label lines are stored sequentially in the @code{line} array. But they
-have to be printed horizontally; @code{line[1]} next to @code{line[6]},
+have to print horizontally; @code{line[1]} next to @code{line[6]},
@code{line[2]} next to @code{line[7]}, and so on. Two loops are used to
accomplish this. The outer loop, controlled by @code{i}, steps through
every 10 lines of data; this is each row of labels. The inner loop,
controlled by @code{j}, goes through the lines within the row.
-As @code{j} goes from zero to four, @samp{i+j} is the @code{j}'th line in
+As @code{j} goes from 0 to 4, @samp{i+j} is the @code{j}'th line in
the row, and @samp{i+j+5} is the entry next to it. The output ends up
looking something like this:
@@ -15831,27 +19602,34 @@ line 2 line 7
line 3 line 8
line 4 line 9
line 5 line 10
+@dots{}
@end example
-As a final note, at lines 21 and 61, an extra blank line is printed, to keep
+As a final note, an extra blank line is printed at lines 21 and 61, to keep
the output lined up on the labels. This is dependent on the particular
brand of labels in use when the program was written. You will also note
that there are two blank lines at the top and two blank lines at the bottom.
The @code{END} rule arranges to flush the final page of labels; there may
-not have been an even multiple of 20 labels in the data.
+not have been an even multiple of 20 labels in the data:
-@findex labels.awk
+@cindex @code{labels.awk} program
@example
-@c @group
@c file eg/prog/labels.awk
-# labels.awk
+# labels.awk --- print mailing labels
+@c endfile
+@ignore
+@c file eg/prog/labels.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# June 1992
+@c endfile
+@end ignore
+@c file eg/prog/labels.awk
-# Program to print labels. Each label is 5 lines of data
-# that may have blank lines. The label sheets have 2
-# blank lines at the top and 2 at the bottom.
+# Each label is 5 lines of data that may have blank lines.
+# The label sheets have 2 blank lines at the top and 2 at
+# the bottom.
BEGIN @{ RS = "" ; MAXLINES = 100 @}
@@ -15899,102 +19677,100 @@ END \
printpage()
@}
@c endfile
-@c @end group
@end example
@node Word Sorting, History Sorting, Labels Program, Miscellaneous Programs
@subsection Generating Word Usage Counts
-The following @code{awk} program prints
+@c NEXT ED: Rewrite this whole section and example
+The following @command{awk} program prints
the number of occurrences of each word in its input. It illustrates the
-associative nature of @code{awk} arrays by using strings as subscripts. It
-also demonstrates the @samp{for @var{x} in @var{array}} construction.
-Finally, it shows how @code{awk} can be used in conjunction with other
+associative nature of @command{awk} arrays by using strings as subscripts. It
+also demonstrates the @samp{for @var{index} in @var{array}} mechanism.
+Finally, it shows how @command{awk} is used in conjunction with other
utility programs to do a useful task of some complexity with a minimum of
-effort. Some explanations follow the program listing.
+effort. Some explanations follow the program listing:
@example
-awk '
# Print list of word frequencies
@{
for (i = 1; i <= NF; i++)
freq[$i]++
@}
-@group
END @{
for (word in freq)
printf "%s\t%d\n", word, freq[word]
-@}'
-@end group
+@}
@end example
-The first thing to notice about this program is that it has two rules. The
-first rule, because it has an empty pattern, is executed on every line of
-the input. It uses @code{awk}'s field-accessing mechanism
+@c Exercise: Use asort() here
+
+This program has two rules. The
+first rule, because it has an empty pattern, is executed for every input line.
+It uses @command{awk}'s field-accessing mechanism
(@pxref{Fields, ,Examining Fields}) to pick out the individual words from
the line, and the built-in variable @code{NF} (@pxref{Built-in Variables})
to know how many fields are available.
-
-For each input word, an element of the array @code{freq} is incremented to
+For each input word, it increments an element of the array @code{freq} to
reflect that the word has been seen an additional time.
The second rule, because it has the pattern @code{END}, is not executed
until the input has been exhausted. It prints out the contents of the
@code{freq} table that has been built up inside the first action.
-
This program has several problems that would prevent it from being
useful by itself on real text files:
@itemize @bullet
@item
-Words are detected using the @code{awk} convention that fields are
-separated by whitespace and that other characters in the input (except
-newlines) don't have any special meaning to @code{awk}. This means that
+Words are detected using the @command{awk} convention that fields are
+separated just by whitespace. Other characters in the input (except
+newlines) don't have any special meaning to @command{awk}. This means that
punctuation characters count as part of words.
@item
-The @code{awk} language considers upper- and lower-case characters to be
-distinct. Therefore, @samp{bartender} and @samp{Bartender} are not treated
-as the same word. This is undesirable since, in normal text, words
+The @command{awk} language considers upper- and lowercase characters to be
+distinct. Therefore, ``bartender'' and ``Bartender'' are not treated
+as the same word. This is undesirable, since in normal text, words
are capitalized if they begin sentences, and a frequency analyzer should not
be sensitive to capitalization.
@item
The output does not come out in any useful order. You're more likely to be
-interested in which words occur most frequently, or having an alphabetized
+interested in which words occur most frequently or in having an alphabetized
table of how frequently each word occurs.
@end itemize
-The way to solve these problems is to use some of the more advanced
-features of the @code{awk} language. First, we use @code{tolower} to remove
+@cindex @command{sort} utility
+The way to solve these problems is to use some of @command{awk}'s more advanced
+features. First, we use @code{tolower} to remove
case distinctions. Next, we use @code{gsub} to remove punctuation
-characters. Finally, we use the system @code{sort} utility to process the
-output of the @code{awk} script. Here is the new version of
+characters. Finally, we use the system @command{sort} utility to process the
+output of the @command{awk} script. Here is the new version of
the program:
-@findex wordfreq.sh
+@cindex @code{wordfreq.awk} program
@example
@c file eg/prog/wordfreq.awk
-# Print list of word frequencies
+# wordfreq.awk --- print list of word frequencies
+
@{
$0 = tolower($0) # remove case distinctions
- gsub(/[^a-z0-9_ \t]/, "", $0) # remove punctuation
+ # remove punctuation
+ gsub(/[^[:alnum:]_[:blank:]]/, "", $0)
for (i = 1; i <= NF; i++)
freq[$i]++
@}
-@c endfile
-@group
END @{
for (word in freq)
printf "%s\t%d\n", word, freq[word]
@}
-@end group
+@c endfile
@end example
Assuming we have saved this program in a file named @file{wordfreq.awk},
-and that the data is in @file{file1}, the following pipeline
+and that the data is in @file{file1}, the following pipeline:
@example
awk -f wordfreq.awk file1 | sort +1 -nr
@@ -16002,20 +19778,18 @@ awk -f wordfreq.awk file1 | sort +1 -nr
@noindent
produces a table of the words appearing in @file{file1} in order of
-decreasing frequency.
-
-The @code{awk} program suitably massages the data and produces a word
-frequency table, which is not ordered.
+decreasing frequency. The @command{awk} program suitably massages the
+data and produces a word frequency table, which is not ordered.
-The @code{awk} script's output is then sorted by the @code{sort} utility and
-printed on the terminal. The options given to @code{sort} in this example
-specify to sort using the second field of each input line (skipping one field),
-that the sort keys should be treated as numeric quantities (otherwise
-@samp{15} would come before @samp{5}), and that the sorting should be done
-in descending (reverse) order.
+The @command{awk} script's output is then sorted by the @command{sort}
+utility and printed on the terminal. The options given to @command{sort}
+specify a sort that uses the second field of each input line (skipping
+one field), that the sort keys should be treated as numeric quantities
+(otherwise @samp{15} would come before @samp{5}), and that the sorting
+should be done in descending (reverse) order.
-We could have even done the @code{sort} from within the program, by
-changing the @code{END} action to:
+The @command{sort} could even be done from within the program, by changing
+the @code{END} action to:
@example
@c file eg/prog/wordfreq.awk
@@ -16028,147 +19802,158 @@ END @{
@c endfile
@end example
-You would have to use this way of sorting on systems that do not
-have true pipes.
-
+This way of sorting must be used on systems that do not
+have true pipes at the command-line (or batch-file) level.
See the general operating system documentation for more information on how
-to use the @code{sort} program.
+to use the @command{sort} program.
@node History Sorting, Extract Program, Word Sorting, Miscellaneous Programs
@subsection Removing Duplicates from Unsorted Text
-The @code{uniq} program
-(@pxref{Uniq Program, ,Printing Non-duplicated Lines of Text}),
+The @command{uniq} program
+(@pxref{Uniq Program, ,Printing Non-Duplicated Lines of Text}),
removes duplicate lines from @emph{sorted} data.
-Suppose, however, you need to remove duplicate lines from a data file, but
-that you wish to preserve the order the lines are in? A good example of
+Suppose, however, you need to remove duplicate lines from a @value{DF} but
+that you want to preserve the order the lines are in. A good example of
this might be a shell history file. The history file keeps a copy of all
the commands you have entered, and it is not unusual to repeat a command
-several times in a row. Occasionally you might wish to compact the history
+several times in a row. Occasionally you might want to compact the history
by removing duplicate entries. Yet it is desirable to maintain the order
of the original commands.
This simple program does the job. It uses two arrays. The @code{data}
array is indexed by the text of each line.
For each line, @code{data[$0]} is incremented.
-
If a particular line has not
-been seen before, then @code{data[$0]} will be zero.
-In that case, the text of the line is stored in @code{lines[count]}.
+been seen before, then @code{data[$0]} is zero.
+In this case, the text of the line is stored in @code{lines[count]}.
Each element of @code{lines} is a unique command, and the indices of
-@code{lines} indicate the order in which those lines were encountered.
-The @code{END} rule simply prints out the lines, in order.
+@code{lines} indicate the order in which those lines are encountered.
+The @code{END} rule simply prints out the lines, in order:
@cindex Rakitzis, Byron
-@findex histsort.awk
+@cindex @code{histsort.awk} program
@example
-@group
@c file eg/prog/histsort.awk
# histsort.awk --- compact a shell history file
+# Thanks to Byron Rakitzis for the general idea
+@c endfile
+@ignore
+@c file eg/prog/histsort.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# May 1993
-# Thanks to Byron Rakitzis for the general idea
+@c endfile
+@end ignore
+@c file eg/prog/histsort.awk
+@group
@{
if (data[$0]++ == 0)
lines[++count] = $0
@}
+@end group
END @{
for (i = 1; i <= count; i++)
print lines[i]
@}
@c endfile
-@end group
@end example
This program also provides a foundation for generating other useful
-information. For example, using the following @code{print} satement in the
-@code{END} rule would indicate how often a particular command was used.
+information. For example, using the following @code{print} statement in the
+@code{END} rule indicates how often a particular command is used:
@example
print data[lines[i]], lines[i]
@end example
-This works because @code{data[$0]} was incremented each time a line was
+This works because @code{data[$0]} is incremented each time a line is
seen.
@node Extract Program, Simple Sed, History Sorting, Miscellaneous Programs
@subsection Extracting Programs from Texinfo Source Files
-@iftex
+@ifnotinfo
Both this chapter and the previous chapter
-(@ref{Library Functions, ,A Library of @code{awk} Functions}),
-present a large number of @code{awk} programs.
-@end iftex
+(@ref{Library Functions, ,A Library of @command{awk} Functions})
+present a large number of @command{awk} programs.
+@end ifnotinfo
@ifinfo
The nodes
-@ref{Library Functions, ,A Library of @code{awk} Functions},
-and @ref{Sample Programs, ,Practical @code{awk} Programs},
-are the top level nodes for a large number of @code{awk} programs.
+@ref{Library Functions, ,A Library of @command{awk} Functions},
+and @ref{Sample Programs, ,Practical @command{awk} Programs},
+are the top level nodes for a large number of @command{awk} programs.
@end ifinfo
-If you wish to experiment with these programs, it is tedious to have to type
+If you want to experiment with these programs, it is tedious to have to type
them in by hand. Here we present a program that can extract parts of a
Texinfo input file into separate files.
+@cindex Texinfo
This @value{DOCUMENT} is written in Texinfo, the GNU project's document
-formatting language. A single Texinfo source file can be used to produce both
-printed and on-line documentation.
-@iftex
-Texinfo is fully documented in @cite{Texinfo---The GNU Documentation Format},
+formatting
+language.
+A single Texinfo source file can be used to produce both
+printed and online documentation.
+@ifnotinfo
+Texinfo is fully documented in the book
+@cite{Texinfo---The GNU Documentation Format},
available from the Free Software Foundation.
-@end iftex
+@end ifnotinfo
@ifinfo
The Texinfo language is described fully, starting with
-@ref{Top, , Introduction, texi, Texinfo---The GNU Documentation Format}.
+@ref{Top}.
@end ifinfo
For our purposes, it is enough to know three things about Texinfo input
-files.
+files:
@itemize @bullet
@item
-The ``at'' symbol, @samp{@@}, is special in Texinfo, much like @samp{\} in C
-or @code{awk}. Literal @samp{@@} symbols are represented in Texinfo source
+The ``at'' symbol (@samp{@@}) is special in Texinfo, much as
+the backslash (@samp{\}) is in C
+or @command{awk}. Literal @samp{@@} symbols are represented in Texinfo source
files as @samp{@@@@}.
@item
Comments start with either @samp{@@c} or @samp{@@comment}.
-The file extraction program will work by using special comments that start
+The file extraction program works by using special comments that start
at the beginning of a line.
@item
-Example text that should not be split across a page boundary is bracketed
-between lines containing @samp{@@group} and @samp{@@end group} commands.
+Lines containing @samp{@@group} and @samp{@@end group} commands bracket
+example text that should not be split across a page boundary.
+(Unfortunately, @TeX{} isn't always smart enough to do things exactly right
+and we have to give it some help.)
@end itemize
The following program, @file{extract.awk}, reads through a Texinfo source
-file, and does two things, based on the special comments.
+file and does two things, based on the special comments.
Upon seeing @samp{@w{@@c system @dots{}}},
it runs a command, by extracting the command text from the
control line and passing it on to the @code{system} function
-(@pxref{I/O Functions, ,Built-in Functions for Input/Output}).
+(@pxref{I/O Functions, ,Input/Output Functions}).
Upon seeing @samp{@@c file @var{filename}}, each subsequent line is sent to
the file @var{filename}, until @samp{@@c endfile} is encountered.
-The rules in @file{extract.awk} will match either @samp{@@c} or
+The rules in @file{extract.awk} match either @samp{@@c} or
@samp{@@comment} by letting the @samp{omment} part be optional.
Lines containing @samp{@@group} and @samp{@@end group} are simply removed.
@file{extract.awk} uses the @code{join} library function
-(@pxref{Join Function, ,Merging an Array Into a String}).
-
-The example programs in the on-line Texinfo source for @cite{@value{TITLE}}
-(@file{gawk.texi}) have all been bracketed inside @samp{file},
-and @samp{endfile} lines. The @code{gawk} distribution uses a copy of
-@file{extract.awk} to extract the sample
-programs and install many of them in a standard directory, where
-@code{gawk} can find them.
+(@pxref{Join Function, ,Merging an Array into a String}).
+
+The example programs in the online Texinfo source for @cite{@value{TITLE}}
+(@file{gawk.texi}) have all been bracketed inside @samp{file} and
+@samp{endfile} lines. The @command{gawk} distribution uses a copy of
+@file{extract.awk} to extract the sample programs and install many
+of them in a standard directory where @command{gawk} can find them.
The Texinfo file looks something like this:
@example
@dots{}
-This program has a @@code@{BEGIN@} block,
-which prints a nice message:
+This program has a @@code@{BEGIN@} rule,
+that prints a nice message:
@@example
@@c file examples/messages.awk
@@ -16187,23 +19972,30 @@ END @@@{ print "Always avoid bored archeologists!" @@@}
@end example
@file{extract.awk} begins by setting @code{IGNORECASE} to one, so that
-mixed upper-case and lower-case letters in the directives won't matter.
+mixed upper- and lowercase letters in the directives won't matter.
-The first rule handles calling @code{system}, checking that a command was
-given (@code{NF} is at least three), and also checking that the command
-exited with a zero exit status, signifying OK.
+The first rule handles calling @code{system}, checking that a command is
+given (@code{NF} is at least three) and also checking that the command
+exits with a zero exit status, signifying OK:
-@findex extract.awk
+@cindex @code{extract.awk} program
@example
-@c @group
@c file eg/prog/extract.awk
# extract.awk --- extract files and run programs
# from texinfo files
-# Arnold Robbins, arnold@@gnu.org, Public Domain, May 1993
+@c endfile
+@ignore
+@c file eg/prog/extract.awk
+#
+# Arnold Robbins, arnold@@gnu.org, Public Domain
+# May 1993
+# Revised September 2000
+@c endfile
+@end ignore
+@c file eg/prog/extract.awk
BEGIN @{ IGNORECASE = 1 @}
-@group
/^@@c(omment)?[ \t]+system/ \
@{
if (NF < 3) @{
@@ -16221,25 +20013,25 @@ BEGIN @{ IGNORECASE = 1 @}
print e > "/dev/stderr"
@}
@}
-@end group
@c endfile
@end example
@noindent
The variable @code{e} is used so that the function
fits nicely on the
-@iftex
+@ifnotinfo
page.
-@end iftex
-@ifinfo
+@end ifnotinfo
+@ifnottex
screen.
-@end ifinfo
+@end ifnottex
-The second rule handles moving data into files. It verifies that a file
-name was given in the directive. If the file named is not the current file,
-then the current file is closed. This means that an @samp{@@c endfile} was
-not given for that file. (We should probably print a diagnostic in this
-case, although at the moment we do not.)
+The second rule handles moving data into files. It verifies that a
+@value{FN} is given in the directive. If the file named is not the
+current file, then the current file is closed. Keeping the current file
+open until a new file is encountered allows the use of the @samp{>}
+redirection for printing the contents, keeping open file management
+simple.
The @samp{for} loop does the work. It reads lines using @code{getline}
(@pxref{Getline, ,Explicit Input with @code{getline}}).
@@ -16247,30 +20039,26 @@ For an unexpected end of file, it calls the @code{@w{unexpected_eof}}
function. If the line is an ``endfile'' line, then it breaks out of
the loop.
If the line is an @samp{@@group} or @samp{@@end group} line, then it
-ignores it, and goes on to the next line.
-(These Texinfo control lines keep blocks of code together on one page;
-unfortunately, @TeX{} isn't always smart enough to do things exactly right,
-and we have to give it some advice.)
+ignores it and goes on to the next line.
+Similarly, comments within examples are also ignored.
Most of the work is in the following few lines. If the line has no @samp{@@}
-symbols, it can be printed directly. Otherwise, each leading @samp{@@} must be
-stripped off.
-
+symbols, the program can print it directly.
+Otherwise, each leading @samp{@@} must be stripped off.
To remove the @samp{@@} symbols, the line is split into separate elements of
the array @code{a}, using the @code{split} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
+The @samp{@@} symbol is used as the separator character.
Each element of @code{a} that is empty indicates two successive @samp{@@}
symbols in the original line. For each two empty elements (@samp{@@@@} in
-the original file), we have to add back in a single @samp{@@} symbol.
+the original file), we have to add a single @samp{@@} symbol back in.
When the processing of the array is finished, @code{join} is called with the
value of @code{SUBSEP}, to rejoin the pieces back into a single
-line. That line is then printed to the output file.
+line. That line is then printed to the output file:
@example
-@c @group
@c file eg/prog/extract.awk
-@group
/^@@c(omment)?[ \t]+file/ \
@{
if (NF != 3) @{
@@ -16278,7 +20066,6 @@ line. That line is then printed to the output file.
print e > "/dev/stderr"
next
@}
-@end group
if ($3 != curfile) @{
if (curfile != "")
close(curfile)
@@ -16292,15 +20079,15 @@ line. That line is then printed to the output file.
break
else if (line ~ /^@@(end[ \t]+)?group/)
continue
+ else if (line ~ /^@@c(omment+)?[ \t]+/)
+ continue
if (index(line, "@@") == 0) @{
print line > curfile
continue
@}
n = split(line, a, "@@")
-@group
# if a[1] == "", means leading @@,
# don't add one back in.
-@end group
for (i = 2; i <= n; i++) @{
if (a[i] == "") @{ # was an @@@@
a[i] = "@@"
@@ -16312,29 +20099,27 @@ line. That line is then printed to the output file.
@}
@}
@c endfile
-@c @end group
@end example
An important thing to note is the use of the @samp{>} redirection.
Output done with @samp{>} only opens the file once; it stays open and
subsequent output is appended to the file
(@pxref{Redirection, , Redirecting Output of @code{print} and @code{printf}}).
-This allows us to easily mix program text and explanatory prose for the same
+This makes it easy to mix program text and explanatory prose for the same
sample source file (as has been done here!) without any hassle. The file is
-only closed when a new data file name is encountered, or at the end of the
+only closed when a new data @value{FN} is encountered or at the end of the
input file.
Finally, the function @code{@w{unexpected_eof}} prints an appropriate
error message and then exits.
+The @code{END} rule handles the final cleanup, closing the open file:
-The @code{END} rule handles the final cleanup, closing the open file.
-
+@c function lb put on same line for page breaking. sigh
@example
@c file eg/prog/extract.awk
@group
-function unexpected_eof()
-@{
- printf("%s:%d: unexpected EOF or error\n", \
+function unexpected_eof() @{
+ printf("%s:%d: unexpected EOF or error\n",
FILENAME, FNR) > "/dev/stderr"
exit 1
@}
@@ -16350,55 +20135,58 @@ END @{
@node Simple Sed, Igawk Program, Extract Program, Miscellaneous Programs
@subsection A Simple Stream Editor
-@cindex @code{sed} utility
-The @code{sed} utility is a ``stream editor,'' a program that reads a
-stream of data, makes changes to it, and passes the modified data on.
-It is often used to make global changes to a large file, or to a stream
+@cindex @command{sed} utility
+@cindex stream editor
+The @command{sed} utility is a ``stream editor,'' a program that reads a
+stream of data, makes changes to it, and passes it on.
+It is often used to make global changes to a large file or to a stream
of data generated by a pipeline of commands.
-
-While @code{sed} is a complicated program in its own right, its most common
+While @command{sed} is a complicated program in its own right, its most common
use is to perform global substitutions in the middle of a pipeline:
@example
command1 < orig.data | sed 's/old/new/g' | command2 > result
@end example
-Here, the @samp{s/old/new/g} tells @code{sed} to look for the regexp
-@samp{old} on each input line, and replace it with the text @samp{new},
-globally (i.e.@: all the occurrences on a line). This is similar to
-@code{awk}'s @code{gsub} function
-(@pxref{String Functions, , Built-in Functions for String Manipulation}).
+Here, @samp{s/old/new/g} tells @command{sed} to look for the regexp
+@samp{old} on each input line and globally replace it with the text
+@samp{new}, (i.e., all the occurrences on a line). This is similar to
+@command{awk}'s @code{gsub} function
+(@pxref{String Functions, ,String Manipulation Functions}).
-The following program, @file{awksed.awk}, accepts at least two command line
-arguments; the pattern to look for and the text to replace it with. Any
-additional arguments are treated as data file names to process. If none
-are provided, the standard input is used.
+The following program, @file{awksed.awk}, accepts at least two command-line
+arguments: the pattern to look for and the text to replace it with. Any
+additional arguments are treated as data @value{FN}s to process. If none
+are provided, the standard input is used:
@cindex Brennan, Michael
-@cindex @code{awksed}
+@cindex @command{awksed.awk} program
@cindex simple stream editor
@cindex stream editor, simple
@example
-@c @group
@c file eg/prog/awksed.awk
# awksed.awk --- do s/foo/bar/g using just print
# Thanks to Michael Brennan for the idea
-
+@c endfile
+@ignore
+@c file eg/prog/awksed.awk
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# August 1995
+@c endfile
+@end ignore
+@c file eg/prog/awksed.awk
function usage()
@{
print "usage: awksed pat repl [files...]" > "/dev/stderr"
exit 1
@}
-@group
BEGIN @{
# validate arguments
if (ARGC < 3)
usage()
-@end group
RS = ARGV[1]
ORS = ARGV[2]
@@ -16407,6 +20195,7 @@ BEGIN @{
ARGV[1] = ARGV[2] = ""
@}
+@group
# look ma, no hands!
@{
if (RT == "")
@@ -16414,38 +20203,36 @@ BEGIN @{
else
print
@}
+@end group
@c endfile
-@c @end group
@end example
-The program relies on @code{gawk}'s ability to have @code{RS} be a regexp
-and on the setting of @code{RT} to the actual text that terminated the
-record (@pxref{Records, ,How Input is Split into Records}).
+The program relies on @command{gawk}'s ability to have @code{RS} be a regexp,
+as well as on the setting of @code{RT} to the actual text that terminates the
+record (@pxref{Records, ,How Input Is Split into Records}).
-The idea is to have @code{RS} be the pattern to look for. @code{gawk}
-will automatically set @code{$0} to the text between matches of the pattern.
-This is text that we wish to keep, unmodified. Then, by setting @code{ORS}
-to the replacement text, a simple @code{print} statement will output the
-text we wish to keep, followed by the replacement text.
+The idea is to have @code{RS} be the pattern to look for. @command{gawk}
+automatically sets @code{$0} to the text between matches of the pattern.
+This is text that we want to keep, unmodified. Then, by setting @code{ORS}
+to the replacement text, a simple @code{print} statement outputs the
+text we want to keep, followed by the replacement text.
There is one wrinkle to this scheme, which is what to do if the last record
-doesn't end with text that matches @code{RS}? Using a @code{print}
+doesn't end with text that matches @code{RS}. Using a @code{print}
statement unconditionally prints the replacement text, which is not correct.
-
However, if the file did not end in text that matches @code{RS}, @code{RT}
-will be set to the null string. In this case, we can print @code{$0} using
+is set to the null string. In this case, we can print @code{$0} using
@code{printf}
(@pxref{Printf, ,Using @code{printf} Statements for Fancier Printing}).
The @code{BEGIN} rule handles the setup, checking for the right number
-of arguments, and calling @code{usage} if there is a problem. Then it sets
-@code{RS} and @code{ORS} from the command line arguments, and sets
-@code{ARGV[1]} and @code{ARGV[2]} to the null string, so that they will
-not be treated as file names
+of arguments and calling @code{usage} if there is a problem. Then it sets
+@code{RS} and @code{ORS} from the command-line arguments and sets
+@code{ARGV[1]} and @code{ARGV[2]} to the null string, so that they are
+not treated as @value{FN}s
(@pxref{ARGC and ARGV, , Using @code{ARGC} and @code{ARGV}}).
The @code{usage} function prints an error message and exits.
-
Finally, the single rule handles the printing scheme outlined above,
using @code{print} or @code{printf} as appropriate, depending upon the
value of @code{RT}.
@@ -16473,16 +20260,15 @@ Others?
@node Igawk Program, , Simple Sed, Miscellaneous Programs
@subsection An Easy Way to Use Library Functions
-Using library functions in @code{awk} can be very beneficial. It
-encourages code re-use and the writing of general functions. Programs are
-smaller, and therefore clearer.
-However, using library functions is only easy when writing @code{awk}
-programs; it is painful when running them, requiring multiple @samp{-f}
-options. If @code{gawk} is unavailable, then so too is the @code{AWKPATH}
-environment variable and the ability to put @code{awk} functions into a
-library directory (@pxref{Options, ,Command Line Options}).
-
-It would be nice to be able to write programs like so:
+Using library functions in @command{awk} can be very beneficial. It
+encourages code reuse and the writing of general functions. Programs are
+smaller and therefore clearer.
+However, using library functions is only easy when writing @command{awk}
+programs; it is painful when running them, requiring multiple @option{-f}
+options. If @command{gawk} is unavailable, then so too is the @env{AWKPATH}
+environment variable and the ability to put @command{awk} functions into a
+library directory (@pxref{Options, ,Command-Line Options}).
+It would be nice to be able to write programs in the following manner:
@example
# library functions
@@ -16499,127 +20285,124 @@ BEGIN @{
@end example
The following program, @file{igawk.sh}, provides this service.
-It simulates @code{gawk}'s searching of the @code{AWKPATH} variable,
-and also allows @dfn{nested} includes; i.e.@: a file that has been included
+It simulates @command{gawk}'s searching of the @env{AWKPATH} variable
+and also allows @dfn{nested} includes; i.e., a file that is included
with @samp{@@include} can contain further @samp{@@include} statements.
-@code{igawk} will make an effort to only include files once, so that nested
+@command{igawk} makes an effort to only include files once, so that nested
includes don't accidentally include a library function twice.
-@code{igawk} should behave externally just like @code{gawk}. This means it
-should accept all of @code{gawk}'s command line arguments, including the
-ability to have multiple source files specified via @samp{-f}, and the
-ability to mix command line and library source files.
+@command{igawk} should behave just like @command{gawk} externally. This
+means it should accept all of @command{gawk}'s command-line arguments,
+including the ability to have multiple source files specified via
+@option{-f}, and the ability to mix command-line and library source files.
-The program is written using the POSIX Shell (@code{sh}) command language.
+The program is written using the POSIX Shell (@command{sh}) command language.
The way the program works is as follows:
@enumerate
@item
Loop through the arguments, saving anything that doesn't represent
-@code{awk} source code for later, when the expanded program is run.
+@command{awk} source code for later, when the expanded program is run.
@item
-For any arguments that do represent @code{awk} text, put the arguments into
-a temporary file that will be expanded. There are two cases.
+For any arguments that do represent @command{awk} text, put the arguments into
+a temporary file that will be expanded. There are two cases:
@enumerate a
@item
-Literal text, provided with @samp{--source} or @samp{--source=}. This
-text is just echoed directly. The @code{echo} program will automatically
-supply a trailing newline.
+Literal text, provided with @option{--source} or @option{--source=}. This
+text is just echoed directly. The @command{echo} program automatically
+supplies a trailing newline.
@item
-File names provided with @samp{-f}. We use a neat trick, and echo
+Source @value{FN}s provided with @option{-f}. We use a neat trick and echo
@samp{@@include @var{filename}} into the temporary file. Since the file
-inclusion program will work the way @code{gawk} does, this will get the text
+inclusion program works the way @command{gawk} does, this gets the text
of the file included into the program at the correct point.
@end enumerate
@item
-Run an @code{awk} program (naturally) over the temporary file to expand
+Run an @command{awk} program (naturally) over the temporary file to expand
@samp{@@include} statements. The expanded program is placed in a second
temporary file.
@item
-Run the expanded program with @code{gawk} and any other original command line
-arguments that the user supplied (such as the data file names).
+Run the expanded program with @command{gawk} and any other original command-line
+arguments that the user supplied (such as the data @value{FN}s).
@end enumerate
The initial part of the program turns on shell tracing if the first
-argument was @samp{debug}. Otherwise, a shell @code{trap} statement
+argument is @samp{debug}. Otherwise, a shell @code{trap} statement
arranges to clean up any temporary files on program exit or upon an
interrupt.
@c 2e: For the temp file handling, go with Darrel's ig=${TMP:-/tmp}/igs.$$
@c 2e: or something as similar as possible.
-The next part loops through all the command line arguments.
-There are several cases of interest.
+The next part loops through all the command-line arguments.
+There are several cases of interest:
@table @code
@item --
-This ends the arguments to @code{igawk}. Anything else should be passed on
-to the user's @code{awk} program without being evaluated.
+This ends the arguments to @command{igawk}. Anything else should be passed on
+to the user's @command{awk} program without being evaluated.
@item -W
-This indicates that the next option is specific to @code{gawk}. To make
-argument processing easier, the @samp{-W} is appended to the front of the
-remaining arguments and the loop continues. (This is an @code{sh}
+This indicates that the next option is specific to @command{gawk}. To make
+argument processing easier, the @option{-W} is appended to the front of the
+remaining arguments and the loop continues. (This is an @command{sh}
programming trick. Don't worry about it if you are not familiar with
-@code{sh}.)
+@command{sh}.)
-@item -v
-@itemx -F
-These are saved and passed on to @code{gawk}.
-
-@item -f
-@itemx --file
-@itemx --file=
-@itemx -Wfile=
-The file name is saved to the temporary file @file{/tmp/ig.s.$$} with an
+@item -v@r{,} -F
+These are saved and passed on to @command{gawk}.
+
+@item -f@r{,} --file@r{,} --file=@r{,} -Wfile=
+The @value{FN} is saved to the temporary file @file{/tmp/ig.s.$$} with an
@samp{@@include} statement.
-The @code{sed} utility is used to remove the leading option part of the
+The @command{sed} utility is used to remove the leading option part of the
argument (e.g., @samp{--file=}).
-@item --source
-@itemx --source=
-@itemx -Wsource=
+@item --source@r{,} --source=@r{,} -Wsource=
The source text is echoed into @file{/tmp/ig.s.$$}.
-@item --version
-@itemx -Wversion
-@code{igawk} prints its version number, and runs @samp{gawk --version}
-to get the @code{gawk} version information, and then exits.
+@item --version@r{,} -Wversion
+@command{igawk} prints its version number, runs @samp{gawk --version}
+to get the @command{gawk} version information, and then exits.
@end table
-If none of @samp{-f}, @samp{--file}, @samp{-Wfile}, @samp{--source},
-or @samp{-Wsource}, were supplied, then the first non-option argument
-should be the @code{awk} program. If there are no command line
-arguments left, @code{igawk} prints an error message and exits.
+If none of the @option{-f}, @option{--file}, @option{-Wfile}, @option{--source},
+or @option{-Wsource} arguments are supplied, then the first non-option argument
+should be the @command{awk} program. If there are no command-line
+arguments left, @command{igawk} prints an error message and exits.
Otherwise, the first argument is echoed into @file{/tmp/ig.s.$$}.
-
In any case, after the arguments have been processed,
-@file{/tmp/ig.s.$$} contains the complete text of the original @code{awk}
+@file{/tmp/ig.s.$$} contains the complete text of the original @command{awk}
program.
-The @samp{$$} in @code{sh} represents the current process ID number.
-It is often used in shell programs to generate unique temporary file
-names. This allows multiple users to run @code{igawk} without worrying
-that the temporary file names will clash.
-
-@cindex @code{sed} utility
-Here's the program:
+@cindex @command{sed} utility
+@cindex stream editor
+The @samp{$$} in @command{sh} represents the current process ID number.
+It is often used in shell programs to generate unique temporary @value{FN}s.
+This allows multiple users to run @command{igawk} without worrying
+that the temporary @value{FN}s will clash.
+The program is as follows:
-@findex igawk.sh
+@cindex @code{igawk.sh} program
@example
-@c @group
@c file eg/prog/igawk.sh
#! /bin/sh
-
# igawk --- like gawk but do @@include processing
+@c endfile
+@ignore
+@c file eg/prog/igawk.sh
+#
# Arnold Robbins, arnold@@gnu.org, Public Domain
# July 1993
+@c endfile
+@end ignore
+@c file eg/prog/igawk.sh
if [ "$1" = debug ]
then
set -x
@@ -16646,24 +20429,22 @@ do
-f) echo @@include "$2" >> /tmp/ig.s.$$
shift;;
-@group
-f*) f=`echo "$1" | sed 's/-f//'`
echo @@include "$f" >> /tmp/ig.s.$$ ;;
-@end group
-?file=*) # -Wfile or --file
f=`echo "$1" | sed 's/-.file=//'`
echo @@include "$f" >> /tmp/ig.s.$$ ;;
- -?file) # get arg, $2
+ -?file) # get arg, $2
echo @@include "$2" >> /tmp/ig.s.$$
shift;;
- -?source=*) # -Wsource or --source
+ -?source=*) # -Wsource or --source
t=`echo "$1" | sed 's/-.source=//'`
echo "$t" >> /tmp/ig.s.$$ ;;
- -?source) # get arg, $2
+ -?source) # get arg, $2
echo "$2" >> /tmp/ig.s.$$
shift;;
@@ -16672,7 +20453,7 @@ do
gawk --version
exit 0 ;;
- -[W-]*) opts="$opts '$1'" ;;
+ -[W-]*) opts="$opts '$1'" ;;
*) break;;
esac
@@ -16681,10 +20462,12 @@ done
if [ ! -s /tmp/ig.s.$$ ]
then
+@group
if [ -z "$1" ]
then
echo igawk: no program! 1>&2
exit 1
+@end group
else
echo "$1" > /tmp/ig.s.$$
shift
@@ -16693,40 +20476,38 @@ fi
# at this point, /tmp/ig.s.$$ has the program
@c endfile
-@c @end group
@end example
-The @code{awk} program to process @samp{@@include} directives reads through
-the program, one line at a time using @code{getline}
-(@pxref{Getline, ,Explicit Input with @code{getline}}).
-The input file names and @samp{@@include} statements are managed using a
-stack. As each @samp{@@include} is encountered, the current file name is
-``pushed'' onto the stack, and the file named in the @samp{@@include}
-directive becomes
-the current file name. As each file is finished, the stack is ``popped,''
-and the previous input file becomes the current input file again.
-The process is started by making the original file the first one on the
-stack.
-
-The @code{pathto} function does the work of finding the full path to a
-file. It simulates @code{gawk}'s behavior when searching the @code{AWKPATH}
-environment variable
-(@pxref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}).
-If a file name has a @samp{/} in it, no path search
-is done. Otherwise, the file name is concatenated with the name of each
-directory in the path, and an attempt is made to open the generated file
-name. The only way in @code{awk} to test if a file can be read is to go
-ahead and try to read it with @code{getline}; that is what @code{pathto}
-does.@footnote{On some very old versions of @code{awk}, the test
+The @command{awk} program to process @samp{@@include} directives
+reads through the program, one line at a time, using @code{getline}
+(@pxref{Getline, ,Explicit Input with @code{getline}}). The input
+@value{FN}s and @samp{@@include} statements are managed using a stack.
+As each @samp{@@include} is encountered, the current @value{FN} is
+``pushed'' onto the stack and the file named in the @samp{@@include}
+directive becomes the current @value{FN}. As each file is finished,
+the stack is ``popped,'' and the previous input file becomes the current
+input file again. The process is started by making the original file
+the first one on the stack.
+
+The @code{pathto} function does the work of finding the full path to
+a file. It simulates @command{gawk}'s behavior when searching the
+@env{AWKPATH} environment variable
+(@pxref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}).
+If a @value{FN} has a @samp{/} in it, no path search is done. Otherwise,
+the @value{FN} is concatenated with the name of each directory in
+the path, and an attempt is made to open the generated @value{FN}.
+The only way to test if a file can be read in @command{awk} is to go
+ahead and try to read it with @code{getline}; this is what @code{pathto}
+does.@footnote{On some very old versions of @command{awk}, the test
@samp{getline junk < t} can loop forever if the file exists but is empty.
-Caveat Emptor.}
-If the file can be read, it is closed, and the file name is
-returned.
+Caveat emptor.} If the file can be read, it is closed and the @value{FN}
+is returned:
+
@ignore
An alternative way to test for the file's existence would be to call
-@samp{system("test -r " t)}, which uses the @code{test} utility to
+@samp{system("test -r " t)}, which uses the @command{test} utility to
see if the file exists and is readable. The disadvantage to this method
-is that it requires creating an extra process, and can thus be slightly
+is that it requires creating an extra process and can thus be slightly
slower.
@end ignore
@@ -16734,10 +20515,7 @@ slower.
@c file eg/prog/igawk.sh
gawk -- '
# process @@include directives
-@c endfile
-@group
-@c file eg/prog/igawk.sh
function pathto(file, i, t, junk)
@{
if (index(file, "/") != 0)
@@ -16745,25 +20523,25 @@ function pathto(file, i, t, junk)
for (i = 1; i <= ndirs; i++) @{
t = (pathlist[i] "/" file)
+@group
if ((getline junk < t) > 0) @{
# found it
close(t)
return t
@}
+@end group
@}
return ""
@}
@c endfile
-@end group
@end example
The main program is contained inside one @code{BEGIN} rule. The first thing it
does is set up the @code{pathlist} array that @code{pathto} uses. After
splitting the path on @samp{:}, null elements are replaced with @code{"."},
-which represents the current directory.
+which represents the current directory:
@example
-@group
@c file eg/prog/igawk.sh
BEGIN @{
path = ENVIRON["AWKPATH"]
@@ -16773,29 +20551,26 @@ BEGIN @{
pathlist[i] = "."
@}
@c endfile
-@end group
@end example
The stack is initialized with @code{ARGV[1]}, which will be @file{/tmp/ig.s.$$}.
The main loop comes next. Input lines are read in succession. Lines that
do not start with @samp{@@include} are printed verbatim.
-
-If the line does start with @samp{@@include}, the file name is in @code{$2}.
-@code{pathto} is called to generate the full path. If it could not, then we
+If the line does start with @samp{@@include}, the @value{FN} is in @code{$2}.
+@code{pathto} is called to generate the full path. If it cannot, then we
print an error message and continue.
-The next thing to check is if the file has been included already. The
-@code{processed} array is indexed by the full file name of each included
-file, and it tracks this information for us. If the file has been
-seen, a warning message is printed. Otherwise, the new file name is
+The next thing to check is if the file is included already. The
+@code{processed} array is indexed by the full @value{FN} of each included
+file and it tracks this information for us. If the file is
+seen again, a warning message is printed. Otherwise, the new @value{FN} is
pushed onto the stack and processing continues.
Finally, when @code{getline} encounters the end of the input file, the file
is closed and the stack is popped. When @code{stackptr} is less than zero,
-the program is done.
+the program is done:
@example
-@c @group
@c file eg/prog/igawk.sh
stackptr = 0
input[stackptr] = ARGV[1] # ARGV[1] is first file
@@ -16807,65 +20582,62 @@ the program is done.
continue
@}
fpath = pathto($2)
+@group
if (fpath == "") @{
- printf("igawk:%s:%d: cannot find %s\n", \
+ printf("igawk:%s:%d: cannot find %s\n",
input[stackptr], FNR, $2) > "/dev/stderr"
continue
@}
-@group
+@end group
if (! (fpath in processed)) @{
processed[fpath] = input[stackptr]
- input[++stackptr] = fpath
+ input[++stackptr] = fpath # push onto stack
@} else
- print $2, "included in", input[stackptr], \
- "already included in", \
+ print $2, "included in", input[stackptr],
+ "already included in",
processed[fpath] > "/dev/stderr"
@}
-@end group
-@group
close(input[stackptr])
@}
@}' /tmp/ig.s.$$ > /tmp/ig.e.$$
-@end group
@c endfile
-@c @end group
@end example
-The last step is to call @code{gawk} with the expanded program and the original
-options and command line arguments that the user supplied. @code{gawk}'s
-exit status is passed back on to @code{igawk}'s calling program.
+The last step is to call @command{gawk} with the expanded program,
+along with the original
+options and command-line arguments that the user supplied. @command{gawk}'s
+exit status is passed back on to @command{igawk}'s calling program:
@c this causes more problems than it solves, so leave it out.
@ignore
-The special file @file{/dev/null} is passed as a data file to @code{gawk}
+The special file @file{/dev/null} is passed as a @value{DF} to @command{gawk}
to handle an interesting case. Suppose that the user's program only has
-a @code{BEGIN} rule, and there are no data files to read. The program should exit without reading any data
-files. However, suppose that an included library file defines an @code{END}
-rule of its own. In this case, @code{gawk} will hang, reading standard
-input. In order to avoid this, @file{/dev/null} is explicitly to the
-command line. Reading from @file{/dev/null} always returns an immediate
+a @code{BEGIN} rule and there are no @value{DF}s to read.
+The program should exit without reading any @value{DF}s.
+However, suppose that an included library file defines an @code{END}
+rule of its own. In this case, @command{gawk} will hang, reading standard
+input. In order to avoid this, @file{/dev/null} is explicitly added to the
+command-line. Reading from @file{/dev/null} always returns an immediate
end of file indication.
@c Hmm. Add /dev/null if $# is 0? Still messes up ARGV. Sigh.
@end ignore
@example
-@c @group
@c file eg/prog/igawk.sh
eval gawk -f /tmp/ig.e.$$ $opts -- "$@@"
exit $?
@c endfile
-@c @end group
@end example
-This version of @code{igawk} represents my third attempt at this program.
-There are three key simplifications that made the program work better.
+This version of @command{igawk} represents my third attempt at this program.
+There are three key simplifications that make the program work better:
-@enumerate
+@itemize @bullet
@item
-Using @samp{@@include} even for the files named with @samp{-f} makes building
-the initial collected @code{awk} program much simpler; all the
+Using @samp{@@include} even for the files named with @option{-f} makes building
+the initial collected @command{awk} program much simpler; all the
@samp{@@include} processing can be done once.
@item
@@ -16879,55 +20651,101 @@ this line for use with the main program complicates things considerably.
Using a @code{getline} loop in the @code{BEGIN} rule does it all in one
place. It is not necessary to call out to a separate loop for processing
nested @samp{@@include} statements.
-@end enumerate
+@end itemize
Also, this program illustrates that it is often worthwhile to combine
-@code{sh} and @code{awk} programming together. You can usually accomplish
-quite a lot, without having to resort to low-level programming in C or C++, and it
-is frequently easier to do certain kinds of string and argument manipulation
-using the shell than it is in @code{awk}.
+@command{sh} and @command{awk} programming together. You can usually
+accomplish quite a lot, without having to resort to low-level programming
+in C or C++, and it is frequently easier to do certain kinds of string
+and argument manipulation using the shell than it is in @command{awk}.
-Finally, @code{igawk} shows that it is not always necessary to add new
-features to a program; they can often be layered on top. With @code{igawk},
+Finally, @command{igawk} shows that it is not always necessary to add new
+features to a program; they can often be layered on top. With @command{igawk},
there is no real reason to build @samp{@@include} processing into
-@code{gawk} itself.
+@command{gawk} itself.
+@cindex search path
+@cindex directory search
+@cindex path, search
+@cindex search path, for source files
As an additional example of this, consider the idea of having two
-files in a directory in the search path.
+files in a directory in the search path:
@table @file
@item default.awk
-This file would contain a set of default library functions, such
+This file contains a set of default library functions, such
as @code{getopt} and @code{assert}.
@item site.awk
-This file would contain library functions that are specific to a site or
-installation, i.e.@: locally developed functions.
+This file contains library functions that are specific to a site or
+installation; i.e., locally developed functions.
Having a separate file allows @file{default.awk} to change with
-new @code{gawk} releases, without requiring the system administrator to
+new @command{gawk} releases, without requiring the system administrator to
update it each time by adding the local functions.
@end table
One user
@c Karl Berry, karl@ileaf.com, 10/95
-suggested that @code{gawk} be modified to automatically read these files
-upon startup. Instead, it would be very simple to modify @code{igawk}
-to do this. Since @code{igawk} can process nested @samp{@@include}
+suggested that @command{gawk} be modified to automatically read these files
+upon startup. Instead, it would be very simple to modify @command{igawk}
+to do this. Since @command{igawk} can process nested @samp{@@include}
directives, @file{default.awk} could simply contain @samp{@@include}
statements for the desired library functions.
@c Exercise: make this change
-@node Language History, Gawk Summary, Sample Programs, Top
-@chapter The Evolution of the @code{awk} Language
+@ignore
+@c Try this
+@iftex
+@page
+@headings off
+@majorheading III@ @ @ Appendixes
+Part III provides the appendixes, the Glossary, and two licenses that cover
+the @command{gawk} source code and this @value{DOCUMENT}, respectively.
+It contains the following appendixes:
+
+@itemize @bullet
+@item
+@ref{Language History, ,The Evolution of the @command{awk} Language}.
+
+@item
+@ref{Installation, ,Installing @command{gawk}}.
+
+@item
+@ref{Notes, ,Implementation Notes}.
+
+@item
+@ref{Basic Concepts, ,Basic Programming Concepts}.
+
+@item
+@ref{Glossary}.
+
+@item
+@ref{Copying, ,GNU General Public License}.
+
+@item
+@ref{GNU Free Documentation License}.
+@end itemize
+
+@page
+@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
+@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
+@end iftex
+@end ignore
-This @value{DOCUMENT} describes the GNU implementation of @code{awk}, which follows
-the POSIX specification. Many @code{awk} users are only familiar
-with the original @code{awk} implementation in Version 7 Unix.
-(This implementation was the basis for @code{awk} in Berkeley Unix,
-through 4.3--Reno. The 4.4 release of Berkeley Unix uses @code{gawk} 2.15.2
-for its version of @code{awk}.) This chapter briefly describes the
-evolution of the @code{awk} language, with cross references to other parts
+@node Language History, Installation, Sample Programs, Top
+@appendix The Evolution of the @command{awk} Language
+
+This @value{DOCUMENT} describes the GNU implementation of @command{awk}, which follows
+the POSIX specification.
+Many long-time @command{awk} users learned @command{awk} programming
+with the original @command{awk} implementation in Version 7 Unix.
+(This implementation was the basis for @command{awk} in Berkeley Unix,
+through 4.3--Reno. Subsequent versions of Berkeley Unix, and systems
+derived from 4.4BSD--Lite, use various versions of @command{gawk}
+for their @command{awk}.)
+This @value{CHAPTER} briefly describes the
+evolution of the @command{awk} language, with cross references to other parts
of the @value{DOCUMENT} where you can find more information.
@menu
@@ -16937,27 +20755,28 @@ of the @value{DOCUMENT} where you can find more information.
and 4.
* POSIX:: New features from the POSIX standard.
* BTL:: New features from the Bell Laboratories
- version of @code{awk}.
-* POSIX/GNU:: The extensions in @code{gawk} not in POSIX
- @code{awk}.
+ version of @command{awk}.
+* POSIX/GNU:: The extensions in @command{gawk} not in POSIX
+ @command{awk}.
+* Contributors:: The major contributors to @command{gawk}.
@end menu
@node V7/SVR3.1, SVR4, Language History, Language History
-@section Major Changes between V7 and SVR3.1
+@appendixsec Major Changes Between V7 and SVR3.1
-The @code{awk} language evolved considerably between the release of
-Version 7 Unix (1978) and the new version first made generally available in
-System V Release 3.1 (1987). This section summarizes the changes, with
-cross-references to further details.
+The @command{awk} language evolved considerably between the release of
+Version 7 Unix (1978) and the new version that was first made generally available in
+System V Release 3.1 (1987). This @value{SECTION} summarizes the changes, with
+cross-references to further details:
@itemize @bullet
@item
The requirement for @samp{;} to separate rules on a line
-(@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}).
+(@pxref{Statements/Lines, ,@command{awk} Statements Versus Lines}).
@item
-User-defined functions, and the @code{return} statement
-(@pxref{User-defined, ,User-defined Functions}).
+User-defined functions and the @code{return} statement
+(@pxref{User-defined, ,User-Defined Functions}).
@item
The @code{delete} statement (@pxref{Delete, ,The @code{delete} Statement}).
@@ -16967,16 +20786,16 @@ The @code{do}-@code{while} statement
(@pxref{Do Statement, ,The @code{do}-@code{while} Statement}).
@item
-The built-in functions @code{atan2}, @code{cos}, @code{sin}, @code{rand} and
-@code{srand} (@pxref{Numeric Functions, ,Numeric Built-in Functions}).
+The built-in functions @code{atan2}, @code{cos}, @code{sin}, @code{rand}, and
+@code{srand} (@pxref{Numeric Functions}).
@item
The built-in functions @code{gsub}, @code{sub}, and @code{match}
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
@item
-The built-in functions @code{close}, and @code{system}
-(@pxref{I/O Functions, ,Built-in Functions for Input/Output}).
+The built-in functions @code{close} and @code{system}
+(@pxref{I/O Functions, ,Input/Output Functions}).
@item
The @code{ARGC}, @code{ARGV}, @code{FNR}, @code{RLENGTH}, @code{RSTART},
@@ -16992,14 +20811,14 @@ The exponentiation operator @samp{^}
form @samp{^=} (@pxref{Assignment Ops, ,Assignment Expressions}).
@item
-C-compatible operator precedence, which breaks some old @code{awk}
+C-compatible operator precedence, which breaks some old @command{awk}
programs (@pxref{Precedence, ,Operator Precedence (How Operators Nest)}).
@item
Regexps as the value of @code{FS}
-(@pxref{Field Separators, ,Specifying How Fields are Separated}), and as the
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}) and as the
third argument to the @code{split} function
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
@item
Dynamic regexps as operands of the @samp{~} and @samp{!~} operators
@@ -17008,8 +20827,8 @@ Dynamic regexps as operands of the @samp{~} and @samp{!~} operators
@item
The escape sequences @samp{\b}, @samp{\f}, and @samp{\r}
(@pxref{Escape Sequences}).
-(Some vendors have updated their old versions of @code{awk} to
-recognize @samp{\r}, @samp{\b}, and @samp{\f}, but this is not
+(Some vendors have updated their old versions of @command{awk} to
+recognize @samp{\b}, @samp{\f}, and @samp{\r}, but this is not
something you can rely on.)
@item
@@ -17021,44 +20840,48 @@ Multiple @code{BEGIN} and @code{END} rules
(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
@item
-Multi-dimensional arrays
-(@pxref{Multi-dimensional, ,Multi-dimensional Arrays}).
+Multidimensional arrays
+(@pxref{Multi-dimensional, ,Multidimensional Arrays}).
@end itemize
@node SVR4, POSIX, V7/SVR3.1, Language History
-@section Changes between SVR3.1 and SVR4
+@appendixsec Changes Between SVR3.1 and SVR4
-@cindex @code{awk} language, V.4 version
-The System V Release 4 version of Unix @code{awk} added these features
-(some of which originated in @code{gawk}):
+@cindex @command{awk} language, V.4 version
+The System V Release 4 (1989) version of Unix @command{awk} added these features
+(some of which originated in @command{gawk}):
@itemize @bullet
@item
The @code{ENVIRON} variable (@pxref{Built-in Variables}).
+@c gawk and MKS awk
@item
-Multiple @samp{-f} options on the command line
-(@pxref{Options, ,Command Line Options}).
+Multiple @option{-f} options on the command line
+(@pxref{Options, ,Command-Line Options}).
+@c MKS awk
@item
-The @samp{-v} option for assigning variables before program execution begins
-(@pxref{Options, ,Command Line Options}).
+The @option{-v} option for assigning variables before program execution begins
+(@pxref{Options, ,Command-Line Options}).
+@c GNU, Bell Laboratories & MKS together
@item
-The @samp{--} option for terminating command line options.
+The @option{--} option for terminating command-line options.
@item
The @samp{\a}, @samp{\v}, and @samp{\x} escape sequences
(@pxref{Escape Sequences}).
+@c GNU, for ANSI C compat
@item
A defined return value for the @code{srand} built-in function
-(@pxref{Numeric Functions, ,Numeric Built-in Functions}).
+(@pxref{Numeric Functions}).
@item
The @code{toupper} and @code{tolower} built-in string functions
for case translation
-(@pxref{String Functions, ,Built-in Functions for String Manipulation}).
+(@pxref{String Functions, ,String Manipulation Functions}).
@item
A cleaner specification for the @samp{%c} format-control letter in the
@@ -17071,27 +20894,32 @@ in the argument list of the @code{printf} function
(@pxref{Control Letters, ,Format-Control Letters}).
@item
-The use of regexp constants such as @code{/foo/} as expressions, where
+The use of regexp constants, such as @code{/foo/}, as expressions, where
they are equivalent to using the matching operator, as in @samp{$0 ~ /foo/}
(@pxref{Using Constant Regexps, ,Using Regular Expression Constants}).
+
+@item
+Processing of escape sequences inside command-line variable assignments
+(@pxref{Assignment Options, ,Assigning Variables on the Command Line}).
@end itemize
@node POSIX, BTL, SVR4, Language History
-@section Changes between SVR4 and POSIX @code{awk}
+@appendixsec Changes Between SVR4 and POSIX @command{awk}
-The POSIX Command Language and Utilities standard for @code{awk}
+The POSIX Command Language and Utilities standard for @command{awk} (1992)
introduced the following changes into the language:
@itemize @bullet
@item
-The use of @samp{-W} for implementation-specific options.
+The use of @option{-W} for implementation-specific options
+(@pxref{Options, ,Command-Line Options}).
@item
The use of @code{CONVFMT} for controlling the conversion of numbers
to strings (@pxref{Conversion, ,Conversion of Strings and Numbers}).
@item
-The concept of a numeric string, and tighter comparison rules to go
+The concept of a numeric string and tighter comparison rules to go
with it (@pxref{Typing and Comparison, ,Variable Typing and Comparison Expressions}).
@item
@@ -17111,7 +20939,12 @@ standard:
@item
Newlines do not act as whitespace to separate fields when @code{FS} is
-equal to a single space.
+equal to a single space
+(@pxref{Fields, ,Examining Fields}).
+
+@item
+Newlines are not allowed after @samp{?} or @samp{:}
+(@pxref{Conditional Exp, ,Conditional Expressions}).
@item
The synonym @code{func} for the keyword @code{function} is not
@@ -17120,1523 +20953,588 @@ recognized (@pxref{Definition Syntax, ,Function Definition Syntax}).
@item
The operators @samp{**} and @samp{**=} cannot be used in
place of @samp{^} and @samp{^=} (@pxref{Arithmetic Ops, ,Arithmetic Operators},
-and also @pxref{Assignment Ops, ,Assignment Expressions}).
+and @ref{Assignment Ops, ,Assignment Expressions}).
@item
Specifying @samp{-Ft} on the command line does not set the value
of @code{FS} to be a single tab character
-(@pxref{Field Separators, ,Specifying How Fields are Separated}).
+(@pxref{Field Separators, ,Specifying How Fields Are Separated}).
@item
The @code{fflush} built-in function is not supported
-(@pxref{I/O Functions, , Built-in Functions for Input/Output}).
+(@pxref{I/O Functions, ,Input/Output Functions}).
@end itemize
@node BTL, POSIX/GNU, POSIX, Language History
-@section Extensions in the Bell Laboratories @code{awk}
+@appendixsec Extensions in the Bell Laboratories @command{awk}
+@cindex extensions, Bell Laboratories @command{awk}
@cindex Kernighan, Brian
-Brian Kernighan, one of the original designers of Unix @code{awk},
-has made his version available via anonymous @code{ftp}
-(@pxref{Other Versions, ,Other Freely Available @code{awk} Implementations}).
-This section describes extensions in his version of @code{awk} that are
-not in POSIX @code{awk}.
+Brian Kernighan, one of the original designers of Unix @command{awk},
+has made his version available via his home page
+(@pxref{Other Versions, ,Other Freely Available @command{awk} Implementations}).
+This @value{SECTION} describes extensions in his version of @command{awk} that are
+not in POSIX @command{awk}.
@itemize @bullet
@item
-The @samp{-mf @var{NNN}} and @samp{-mr @var{NNN}} command line options
-to set the maximum number of fields, and the maximum
+The @samp{-mf @var{N}} and @samp{-mr @var{N}} command-line options
+to set the maximum number of fields and the maximum
record size, respectively
-(@pxref{Options, ,Command Line Options}).
+(@pxref{Options, ,Command-Line Options}).
+As a side note, his @command{awk} no longer needs these options;
+it continues to accept them to avoid breaking old programs.
@item
The @code{fflush} built-in function for flushing buffered output
-(@pxref{I/O Functions, ,Built-in Functions for Input/Output}).
+(@pxref{I/O Functions, ,Input/Output Functions}).
+
+@item
+The @samp{**} and @samp{**=} operators
+(@pxref{Arithmetic Ops, ,Arithmetic Operators}
+and
+@ref{Assignment Ops, ,Assignment Expressions}).
+
+@item
+The use of @code{func} as an abbreviation for @code{function}
+(@pxref{Definition Syntax, ,Function Definition Syntax}).
@ignore
@item
-The @code{SYMTAB} array, that allows access to the internal symbol
-table of @code{awk}. This feature is not documented, largely because
+The @code{SYMTAB} array, that allows access to @command{awk}'s internal symbol
+table. This feature is not documented, largely because
it is somewhat shakily implemented. For instance, you cannot access arrays
or array elements through it.
@end ignore
@end itemize
-@node POSIX/GNU, , BTL, Language History
-@section Extensions in @code{gawk} Not in POSIX @code{awk}
+The Bell Laboratories @command{awk} also incorporates the following extensions,
+originally developed for @command{gawk}:
+
+@itemize @bullet
+@item
+The @samp{\x} escape sequence
+(@pxref{Escape Sequences}).
+
+@item
+The @file{/dev/stdin}, @file{/dev/stdout}, and @file{/dev/stderr}
+special files
+(@pxref{Special Files, ,Special @value{FFN}s in @command{gawk}}).
+
+@item
+The ability for @code{FS} and for the third
+argument to @code{split} to be null strings
+(@pxref{Single Character Fields, , Making Each Character a Separate Field}).
+
+@item
+The @code{nextfile} statement
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
+
+@item
+The ability to delete all of an array at once with @samp{delete @var{array}}
+(@pxref{Delete, ,The @code{delete} Statement}).
+@end itemize
+
+@node POSIX/GNU, Contributors, BTL, Language History
+@appendixsec Extensions in @command{gawk} Not in POSIX @command{awk}
+
+@ignore
+I've tried to follow this general order, esp. for the 3.0 and 3.1 sections:
+ variables
+ special files
+ language changes (e.g., hex constants)
+ differences in standard awk functions
+ new gawk functions
+ new keywords
+ new command-line options
+ new ports
+Within each category, be alphabetical.
+@end ignore
@cindex compatibility mode
-The GNU implementation, @code{gawk}, adds a number of features.
-This sections lists them in the order they were added to @code{gawk}.
-They can all be disabled with either the @samp{--traditional} or
-@samp{--posix} options
-(@pxref{Options, ,Command Line Options}).
+The GNU implementation, @command{gawk}, adds a large number of features.
+This @value{SECTION} lists them in the order they were added to @command{gawk}.
+They can all be disabled with either the @option{--traditional} or
+@option{--posix} options
+(@pxref{Options, ,Command-Line Options}).
-Version 2.10 of @code{gawk} introduced these features:
+Version 2.10 of @command{gawk} introduced the following features:
@itemize @bullet
@item
-The @code{AWKPATH} environment variable for specifying a path search for
-the @samp{-f} command line option
-(@pxref{Options, ,Command Line Options}).
+The @env{AWKPATH} environment variable for specifying a path search for
+the @option{-f} command-line option
+(@pxref{Options, ,Command-Line Options}).
@item
The @code{IGNORECASE} variable and its effects
-(@pxref{Case-sensitivity, ,Case-sensitivity in Matching}).
+(@pxref{Case-sensitivity, ,Case Sensitivity in Matching}).
@item
-The @file{/dev/stdin}, @file{/dev/stdout}, @file{/dev/stderr}, and
-@file{/dev/fd/@var{n}} file name interpretation
-(@pxref{Special Files, ,Special File Names in @code{gawk}}).
+The @file{/dev/stdin}, @file{/dev/stdout}, @file{/dev/stderr} and
+@file{/dev/fd/@var{N}} special @value{FN}s
+(@pxref{Special Files, ,Special @value{FFN}s in @command{gawk}}).
@end itemize
-Version 2.13 of @code{gawk} introduced these features:
+Version 2.13 of @command{gawk} introduced the following features:
@itemize @bullet
@item
The @code{FIELDWIDTHS} variable and its effects
-(@pxref{Constant Size, ,Reading Fixed-width Data}).
+(@pxref{Constant Size, ,Reading Fixed-Width Data}).
@item
The @code{systime} and @code{strftime} built-in functions for obtaining
-and printing time stamps
-(@pxref{Time Functions, ,Functions for Dealing with Time Stamps}).
+and printing timestamps
+(@pxref{Time Functions, ,Using @command{gawk}'s Timestamp Functions}).
@item
-The @samp{-W lint} option to provide source code and run time error
-and portability checking
-(@pxref{Options, ,Command Line Options}).
+The @option{-W lint} option to provide error and portability checking
+for both the source code and at runtime
+(@pxref{Options, ,Command-Line Options}).
@item
-The @samp{-W compat} option to turn off these extensions
-(@pxref{Options, ,Command Line Options}).
+The @option{-W compat} option to turn off the GNU extensions
+(@pxref{Options, ,Command-Line Options}).
@item
-The @samp{-W posix} option for full POSIX compliance
-(@pxref{Options, ,Command Line Options}).
+The @option{-W posix} option for full POSIX compliance
+(@pxref{Options, ,Command-Line Options}).
@end itemize
-Version 2.14 of @code{gawk} introduced these features:
+Version 2.14 of @command{gawk} introduced the following feature:
@itemize @bullet
@item
-The @code{next file} statement for skipping to the next data file
-(@pxref{Nextfile Statement, ,The @code{nextfile} Statement}).
+The @code{next file} statement for skipping to the next @value{DF}
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
@end itemize
-Version 2.15 of @code{gawk} introduced these features:
+Version 2.15 of @command{gawk} introduced the following features:
@itemize @bullet
@item
-The @code{ARGIND} variable, that tracks the movement of @code{FILENAME}
+The @code{ARGIND} variable, which tracks the movement of @code{FILENAME}
through @code{ARGV} (@pxref{Built-in Variables}).
@item
-The @code{ERRNO} variable, that contains the system error message when
-@code{getline} returns @minus{}1, or when @code{close} fails
+The @code{ERRNO} variable, which contains the system error message when
+@code{getline} returns @minus{}1 or when @code{close} fails
(@pxref{Built-in Variables}).
@item
-The ability to use GNU-style long named options that start with @samp{--}
-(@pxref{Options, ,Command Line Options}).
+The @file{/dev/pid}, @file{/dev/ppid}, @file{/dev/pgrpid}, and
+@file{/dev/user} @value{FN} interpretation
+(@pxref{Special Files, ,Special @value{FFN}s in @command{gawk}}).
@item
-The @samp{--source} option for mixing command line and library
-file source code
-(@pxref{Options, ,Command Line Options}).
+The ability to delete all of an array at once with @samp{delete @var{array}}
+(@pxref{Delete, ,The @code{delete} Statement}).
@item
-The @file{/dev/pid}, @file{/dev/ppid}, @file{/dev/pgrpid}, and
-@file{/dev/user} file name interpretation
-(@pxref{Special Files, ,Special File Names in @code{gawk}}).
+The ability to use GNU-style long-named options that start with @option{--}
+(@pxref{Options, ,Command-Line Options}).
+
+@item
+The @option{--source} option for mixing command-line and library
+file source code
+(@pxref{Options, ,Command-Line Options}).
@end itemize
-Version 3.0 of @code{gawk} introduced these features:
+Version 3.0 of @command{gawk} introduced the following features:
@itemize @bullet
@item
-The @code{next file} statement became @code{nextfile}
-(@pxref{Nextfile Statement, ,The @code{nextfile} Statement}).
+@code{IGNORECASE} changed, now applying to string comparison as well
+as regexp operations
+(@pxref{Case-sensitivity, ,Case Sensitivity in Matching}).
@item
-The @samp{--lint-old} option to
-warn about constructs that are not available in
-the original Version 7 Unix version of @code{awk}
-(@pxref{V7/SVR3.1, , Major Changes between V7 and SVR3.1}).
+The @code{RT} variable that contains the input text that
+matched @code{RS}
+(@pxref{Records, ,How Input Is Split into Records}).
@item
-The @samp{--traditional} option was added as a better name for
-@samp{--compat} (@pxref{Options, ,Command Line Options}).
+Full support for both POSIX and GNU regexps
+(@pxref{Regexp, , Regular Expressions}).
@item
-The ability for @code{FS} to be a null string, and for the third
-argument to @code{split} to be the null string
-(@pxref{Single Character Fields, , Making Each Character a Separate Field}).
+The @code{gensub} function for more powerful text manipulation
+(@pxref{String Functions, ,String Manipulation Functions}).
@item
-The ability for @code{RS} to be a regexp
-(@pxref{Records, , How Input is Split into Records}).
+The @code{strftime} function acquired a default time format,
+allowing it to be called with no arguments
+(@pxref{Time Functions, ,Using @command{gawk}'s Timestamp Functions}).
@item
-The @code{RT} variable
-(@pxref{Records, , How Input is Split into Records}).
+The ability for @code{FS} and for the third
+argument to @code{split} to be null strings
+(@pxref{Single Character Fields, , Making Each Character a Separate Field}).
@item
-The @code{gensub} function for more powerful text manipulation
-(@pxref{String Functions, , Built-in Functions for String Manipulation}).
+The ability for @code{RS} to be a regexp
+(@pxref{Records, ,How Input Is Split into Records}).
@item
-The @code{strftime} function acquired a default time format,
-allowing it to be called with no arguments
-(@pxref{Time Functions, , Functions for Dealing with Time Stamps}).
+The @code{next file} statement became @code{nextfile}
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
@item
-Full support for both POSIX and GNU regexps
-(@pxref{Regexp, , Regular Expressions}).
+The @option{--lint-old} option to
+warn about constructs that are not available in
+the original Version 7 Unix version of @command{awk}
+(@pxref{V7/SVR3.1, ,Major Changes Between V7 and SVR3.1}).
@item
-The @samp{--re-interval} option to provide interval expressions in regexps
-(@pxref{Regexp Operators, , Regular Expression Operators}).
+The @option{-m} option and the @code{fflush} function from the
+Bell Laboratories research version of @command{awk}
+(@pxref{Options, ,Command-Line Options}; also
+@pxref{I/O Functions, ,Input/Output Functions}).
@item
-@code{IGNORECASE} changed, now applying to string comparison as well
-as regexp operations
-(@pxref{Case-sensitivity, ,Case-sensitivity in Matching}).
+The @option{--re-interval} option to provide interval expressions in regexps
+(@pxref{Regexp Operators, , Regular Expression Operators}).
@item
-The @samp{-m} option and the @code{fflush} function from the
-Bell Labs research version of @code{awk}
-(@pxref{Options, ,Command Line Options}; also
-@pxref{I/O Functions, ,Built-in Functions for Input/Output}).
+The @option{--traditional} option was added as a better name for
+@option{--compat} (@pxref{Options, ,Command-Line Options}).
@item
The use of GNU Autoconf to control the configuration process
-(@pxref{Quick Installation, , Compiling @code{gawk} for Unix}).
+(@pxref{Quick Installation, , Compiling @command{gawk} for Unix}).
@item
Amiga support
-(@pxref{Amiga Installation, ,Installing @code{gawk} on an Amiga}).
-
-@c XXX ADD MORE STUFF HERE
+(@pxref{Amiga Installation, ,Installing @command{gawk} on an Amiga}).
@end itemize
-@node Gawk Summary, Installation, Language History, Top
-@appendix @code{gawk} Summary
-
-This appendix provides a brief summary of the @code{gawk} command line and the
-@code{awk} language. It is designed to serve as ``quick reference.'' It is
-therefore terse, but complete.
-
-@menu
-* Command Line Summary:: Recapitulation of the command line.
-* Language Summary:: A terse review of the language.
-* Variables/Fields:: Variables, fields, and arrays.
-* Rules Summary:: Patterns and Actions, and their component
- parts.
-* Actions Summary:: Quick overview of actions.
-* Functions Summary:: Defining and calling functions.
-* Historical Features:: Some undocumented but supported ``features''.
-@end menu
-
-@node Command Line Summary, Language Summary, Gawk Summary, Gawk Summary
-@appendixsec Command Line Options Summary
-
-The command line consists of options to @code{gawk} itself, the
-@code{awk} program text (if not supplied via the @samp{-f} option), and
-values to be made available in the @code{ARGC} and @code{ARGV}
-predefined @code{awk} variables:
-
-@example
-gawk @r{[@var{POSIX or GNU style options}]} -f @var{source-file} @r{[@code{--}]} @var{file} @dots{}
-gawk @r{[@var{POSIX or GNU style options}]} @r{[@code{--}]} '@var{program}' @var{file} @dots{}
-@end example
-
-The options that @code{gawk} accepts are:
-
-@table @code
-@item -F @var{fs}
-@itemx --field-separator @var{fs}
-Use @var{fs} for the input field separator (the value of the @code{FS}
-predefined variable).
-
-@item -f @var{program-file}
-@itemx --file @var{program-file}
-Read the @code{awk} program source from the file @var{program-file}, instead
-of from the first command line argument.
-
-@item -mf @var{NNN}
-@itemx -mr @var{NNN}
-The @samp{f} flag sets
-the maximum number of fields, and the @samp{r} flag sets the maximum
-record size. These options are ignored by @code{gawk}, since @code{gawk}
-has no predefined limits; they are only for compatibility with the
-Bell Labs research version of Unix @code{awk}.
-
-@item -v @var{var}=@var{val}
-@itemx --assign @var{var}=@var{val}
-Assign the variable @var{var} the value @var{val} before program execution
-begins.
-
-@item -W traditional
-@itemx -W compat
-@itemx --traditional
-@itemx --compat
-Use compatibility mode, in which @code{gawk} extensions are turned
-off.
-
-@item -W copyleft
-@itemx -W copyright
-@itemx --copyleft
-@itemx --copyright
-Print the short version of the General Public License on the standard
-output, and exit. This option may disappear in a future version of @code{gawk}.
-
-@item -W help
-@itemx -W usage
-@itemx --help
-@itemx --usage
-Print a relatively short summary of the available options on the standard
-output, and exit.
-
-@item -W lint
-@itemx --lint
-Give warnings about dubious or non-portable @code{awk} constructs.
-
-@item -W lint-old
-@itemx --lint-old
-Warn about constructs that are not available in
-the original Version 7 Unix version of @code{awk}.
+Version 3.1 of @command{gawk} introduced the following features:
-@item -W posix
-@itemx --posix
-Use POSIX compatibility mode, in which @code{gawk} extensions
-are turned off and additional restrictions apply.
-
-@item -W re-interval
-@itemx --re-interval
-Allow interval expressions
-(@pxref{Regexp Operators, , Regular Expression Operators}),
-in regexps.
-
-@item -W source=@var{program-text}
-@itemx --source @var{program-text}
-Use @var{program-text} as @code{awk} program source code. This option allows
-mixing command line source code with source code from files, and is
-particularly useful for mixing command line programs with library functions.
-
-@item -W version
-@itemx --version
-Print version information for this particular copy of @code{gawk} on the error
-output.
-
-@item --
-Signal the end of options. This is useful to allow further arguments to the
-@code{awk} program itself to start with a @samp{-}. This is mainly for
-consistency with POSIX argument parsing conventions.
-@end table
-
-Any other options are flagged as invalid, but are otherwise ignored.
-@xref{Options, ,Command Line Options}, for more details.
-
-@node Language Summary, Variables/Fields, Command Line Summary, Gawk Summary
-@appendixsec Language Summary
-
-An @code{awk} program consists of a sequence of zero or more pattern-action
-statements and optional function definitions. One or the other of the
-pattern and action may be omitted.
-
-@example
-@var{pattern} @{ @var{action statements} @}
-@var{pattern}
- @{ @var{action statements} @}
-
-function @var{name}(@var{parameter list}) @{ @var{action statements} @}
-@end example
-
-@code{gawk} first reads the program source from the
-@var{program-file}(s), if specified, or from the first non-option
-argument on the command line. The @samp{-f} option may be used multiple
-times on the command line. @code{gawk} reads the program text from all
-the @var{program-file} files, effectively concatenating them in the
-order they are specified. This is useful for building libraries of
-@code{awk} functions, without having to include them in each new
-@code{awk} program that uses them. To use a library function in a file
-from a program typed in on the command line, specify
-@samp{--source '@var{program}'}, and type your program in between the single
-quotes.
-@xref{Options, ,Command Line Options}.
-
-The environment variable @code{AWKPATH} specifies a search path to use
-when finding source files named with the @samp{-f} option. The default
-path, which is
-@samp{.:/usr/local/share/awk}@footnote{The path may use a directory
-other than @file{/usr/local/share/awk}, depending upon how @code{gawk}
-was built and installed.} is used if @code{AWKPATH} is not set.
-If a file name given to the @samp{-f} option contains a @samp{/} character,
-no path search is performed.
-@xref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}.
-
-@code{gawk} compiles the program into an internal form, and then proceeds to
-read each file named in the @code{ARGV} array.
-The initial values of @code{ARGV} come from the command line arguments.
-If there are no files named
-on the command line, @code{gawk} reads the standard input.
-
-If a ``file'' named on the command line has the form
-@samp{@var{var}=@var{val}}, it is treated as a variable assignment: the
-variable @var{var} is assigned the value @var{val}.
-If any of the files have a value that is the null string, that
-element in the list is skipped.
-
-For each record in the input, @code{gawk} tests to see if it matches any
-@var{pattern} in the @code{awk} program. For each pattern that the record
-matches, the associated @var{action} is executed.
-
-@node Variables/Fields, Rules Summary, Language Summary, Gawk Summary
-@appendixsec Variables and Fields
-
-@code{awk} variables are not declared; they come into existence when they are
-first used. Their values are either floating-point numbers or strings.
-@code{awk} also has one-dimensional arrays; multiple-dimensional arrays
-may be simulated. There are several predefined variables that
-@code{awk} sets as a program runs; these are summarized below.
-
-@menu
-* Fields Summary:: Input field splitting.
-* Built-in Summary:: @code{awk}'s built-in variables.
-* Arrays Summary:: Using arrays.
-* Data Type Summary:: Values in @code{awk} are numbers or strings.
-@end menu
-
-@node Fields Summary, Built-in Summary, Variables/Fields, Variables/Fields
-@appendixsubsec Fields
-
-As each input line is read, @code{gawk} splits the line into
-@var{fields}, using the value of the @code{FS} variable as the field
-separator. If @code{FS} is a single character, fields are separated by
-that character. Otherwise, @code{FS} is expected to be a full regular
-expression. In the special case that @code{FS} is a single space,
-fields are separated by runs of spaces, tabs and/or newlines.@footnote{In
-POSIX @code{awk}, newline does not separate fields.}
-If @code{FS} is the null string (@code{""}), then each individual
-character in the record becomes a separate field.
-Note that the value
-of @code{IGNORECASE} (@pxref{Case-sensitivity, ,Case-sensitivity in Matching})
-also affects how fields are split when @code{FS} is a regular expression.
-
-Each field in the input line may be referenced by its position, @code{$1},
-@code{$2}, and so on. @code{$0} is the whole line. The value of a field may
-be assigned to as well. Field numbers need not be constants:
-
-@example
-n = 5
-print $n
-@end example
-
-@noindent
-prints the fifth field in the input line. The variable @code{NF} is set to
-the total number of fields in the input line.
-
-References to non-existent fields (i.e.@: fields after @code{$NF}) return
-the null string. However, assigning to a non-existent field (e.g.,
-@code{$(NF+2) = 5}) increases the value of @code{NF}, creates any
-intervening fields with the null string as their value, and causes the
-value of @code{$0} to be recomputed, with the fields being separated by
-the value of @code{OFS}.
-Decrementing @code{NF} causes the values of fields past the new value to
-be lost, and the value of @code{$0} to be recomputed, with the fields being
-separated by the value of @code{OFS}.
-@xref{Reading Files, ,Reading Input Files}.
-
-@node Built-in Summary, Arrays Summary, Fields Summary, Variables/Fields
-@appendixsubsec Built-in Variables
-
-@code{gawk}'s built-in variables are:
-
-@table @code
-@item ARGC
-The number of elements in @code{ARGV}. See below for what is actually
-included in @code{ARGV}.
-
-@item ARGIND
-The index in @code{ARGV} of the current file being processed.
-When @code{gawk} is processing the input data files,
-it is always true that @samp{FILENAME == ARGV[ARGIND]}.
-
-@item ARGV
-The array of command line arguments. The array is indexed from zero to
-@code{ARGC} @minus{} 1. Dynamically changing @code{ARGC} and
-the contents of @code{ARGV}
-can control the files used for data. A null-valued element in
-@code{ARGV} is ignored. @code{ARGV} does not include the options to
-@code{awk} or the text of the @code{awk} program itself.
-
-@item CONVFMT
-The conversion format to use when converting numbers to strings.
-
-@item FIELDWIDTHS
-A space separated list of numbers describing the fixed-width input data.
-
-@item ENVIRON
-An array of environment variable values. The array
-is indexed by variable name, each element being the value of that
-variable. Thus, the environment variable @code{HOME} is
-@code{ENVIRON["HOME"]}. One possible value might be @file{/home/arnold}.
-
-Changing this array does not affect the environment seen by programs
-which @code{gawk} spawns via redirection or the @code{system} function.
-(This may change in a future version of @code{gawk}.)
-
-Some operating systems do not have environment variables.
-The @code{ENVIRON} array is empty when running on these systems.
-
-@item ERRNO
-The system error message when an error occurs using @code{getline}
-or @code{close}.
-
-@item FILENAME
-The name of the current input file. If no files are specified on the command
-line, the value of @code{FILENAME} is the null string.
-
-@item FNR
-The input record number in the current input file.
-
-@item FS
-The input field separator, a space by default.
-
-@item IGNORECASE
-The case-sensitivity flag for string comparisons and regular expression
-operations. If @code{IGNORECASE} has a non-zero value, then pattern
-matching in rules, record separating with @code{RS}, field splitting
-with @code{FS}, regular expression matching with @samp{~} and
-@samp{!~}, and the @code{gensub}, @code{gsub}, @code{index},
-@code{match}, @code{split} and @code{sub} built-in functions all
-ignore case when doing regular expression operations, and all string
-comparisons are done ignoring case.
-The value of @code{IGNORECASE} does @emph{not} affect array subscripting.
-
-@item NF
-The number of fields in the current input record.
-
-@item NR
-The total number of input records seen so far.
-
-@item OFMT
-The output format for numbers for the @code{print} statement,
-@code{"%.6g"} by default.
-
-@item OFS
-The output field separator, a space by default.
-
-@item ORS
-The output record separator, by default a newline.
-
-@item RS
-The input record separator, by default a newline.
-If @code{RS} is set to the null string, then records are separated by
-blank lines. When @code{RS} is set to the null string, then the newline
-character always acts as a field separator, in addition to whatever value
-@code{FS} may have. If @code{RS} is set to a multi-character
-string, it denotes a regexp; input text matching the regexp
-separates records.
-
-@item RT
-The input text that matched the text denoted by @code{RS},
-the record separator.
-
-@item RSTART
-The index of the first character last matched by @code{match}; zero if no match.
-
-@item RLENGTH
-The length of the string last matched by @code{match}; @minus{}1 if no match.
-
-@item SUBSEP
-The string used to separate multiple subscripts in array elements, by
-default @code{"\034"}.
-@end table
-
-@xref{Built-in Variables}, for more information.
-
-@node Arrays Summary, Data Type Summary, Built-in Summary, Variables/Fields
-@appendixsubsec Arrays
-
-Arrays are subscripted with an expression between square brackets
-(@samp{[} and @samp{]}). Array subscripts are @emph{always} strings;
-numbers are converted to strings as necessary, following the standard
-conversion rules
-(@pxref{Conversion, ,Conversion of Strings and Numbers}).
-
-If you use multiple expressions separated by commas inside the square
-brackets, then the array subscript is a string consisting of the
-concatenation of the individual subscript values, converted to strings,
-separated by the subscript separator (the value of @code{SUBSEP}).
-
-The special operator @code{in} may be used in a conditional context
-to see if an array has an index consisting of a particular value.
-
-@example
-if (val in array)
- print array[val]
-@end example
-
-If the array has multiple subscripts, use @samp{(i, j, @dots{}) in @var{array}}
-to test for existence of an element.
-
-The @code{in} construct may also be used in a @code{for} loop to iterate
-over all the elements of an array.
-@xref{Scanning an Array, ,Scanning All Elements of an Array}.
-
-You can remove an element from an array using the @code{delete} statement.
-
-You can clear an entire array using @samp{delete @var{array}}.
-
-@xref{Arrays, ,Arrays in @code{awk}}.
-
-@node Data Type Summary, , Arrays Summary, Variables/Fields
-@appendixsubsec Data Types
-
-The value of an @code{awk} expression is always either a number
-or a string.
-
-Some contexts (such as arithmetic operators) require numeric
-values. They convert strings to numbers by interpreting the text
-of the string as a number. If the string does not look like a
-number, it converts to zero.
-
-Other contexts (such as concatenation) require string values.
-They convert numbers to strings by effectively printing them
-with @code{sprintf}.
-@xref{Conversion, ,Conversion of Strings and Numbers}, for the details.
-
-To force conversion of a string value to a number, simply add zero
-to it. If the value you start with is already a number, this
-does not change it.
-
-To force conversion of a numeric value to a string, concatenate it with
-the null string.
-
-Comparisons are done numerically if both operands are numeric, or if
-one is numeric and the other is a numeric string. Otherwise one or
-both operands are converted to strings and a string comparison is
-performed. Fields, @code{getline} input, @code{FILENAME}, @code{ARGV}
-elements, @code{ENVIRON} elements and the elements of an array created
-by @code{split} are the only items that can be numeric strings. String
-constants, such as @code{"3.1415927"} are not numeric strings, they are
-string constants. The full rules for comparisons are described in
-@ref{Typing and Comparison, ,Variable Typing and Comparison Expressions}.
-
-Uninitialized variables have the string value @code{""} (the null, or
-empty, string). In contexts where a number is required, this is
-equivalent to zero.
-
-@xref{Variables}, for more information on variable naming and initialization;
-@pxref{Conversion, ,Conversion of Strings and Numbers}, for more information
-on how variable values are interpreted.
-
-@node Rules Summary, Actions Summary, Variables/Fields, Gawk Summary
-@appendixsec Patterns
-
-@menu
-* Pattern Summary:: Quick overview of patterns.
-* Regexp Summary:: Quick overview of regular expressions.
-@end menu
-
-An @code{awk} program is mostly composed of rules, each consisting of a
-pattern followed by an action. The action is enclosed in @samp{@{} and
-@samp{@}}. Either the pattern may be missing, or the action may be
-missing, but not both. If the pattern is missing, the
-action is executed for every input record. A missing action is
-equivalent to @samp{@w{@{ print @}}}, which prints the entire line.
-
-@c These paragraphs repeated for both patterns and actions. I don't
-@c like this, but I also don't see any way around it. Update both copies
-@c if they need fixing.
-Comments begin with the @samp{#} character, and continue until the end of the
-line. Blank lines may be used to separate statements. Statements normally
-end with a newline; however, this is not the case for lines ending in a
-@samp{,}, @samp{@{}, @samp{?}, @samp{:}, @samp{&&}, or @samp{||}. Lines
-ending in @code{do} or @code{else} also have their statements automatically
-continued on the following line. In other cases, a line can be continued by
-ending it with a @samp{\}, in which case the newline is ignored.
-
-Multiple statements may be put on one line by separating each one with
-a @samp{;}.
-This applies to both the statements within the action part of a rule (the
-usual case), and to the rule statements.
-
-@xref{Comments, ,Comments in @code{awk} Programs}, for information on
-@code{awk}'s commenting convention;
-@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}, for a
-description of the line continuation mechanism in @code{awk}.
-
-@node Pattern Summary, Regexp Summary, Rules Summary, Rules Summary
-@appendixsubsec Pattern Summary
-
-@code{awk} patterns may be one of the following:
-
-@example
-/@var{regular expression}/
-@var{relational expression}
-@var{pattern} && @var{pattern}
-@var{pattern} || @var{pattern}
-@var{pattern} ? @var{pattern} : @var{pattern}
-(@var{pattern})
-! @var{pattern}
-@var{pattern1}, @var{pattern2}
-BEGIN
-END
-@end example
-
-@code{BEGIN} and @code{END} are two special kinds of patterns that are not
-tested against the input. The action parts of all @code{BEGIN} rules are
-concatenated as if all the statements had been written in a single @code{BEGIN}
-rule. They are executed before any of the input is read. Similarly, all the
-@code{END} rules are concatenated, and executed when all the input is exhausted (or
-when an @code{exit} statement is executed). @code{BEGIN} and @code{END}
-patterns cannot be combined with other patterns in pattern expressions.
-@code{BEGIN} and @code{END} rules cannot have missing action parts.
-
-For @code{/@var{regular-expression}/} patterns, the associated statement is
-executed for each input record that matches the regular expression. Regular
-expressions are summarized below.
-
-A @var{relational expression} may use any of the operators defined below in
-the section on actions. These generally test whether certain fields match
-certain regular expressions.
-
-The @samp{&&}, @samp{||}, and @samp{!} operators are logical ``and,''
-logical ``or,'' and logical ``not,'' respectively, as in C. They do
-short-circuit evaluation, also as in C, and are used for combining more
-primitive pattern expressions. As in most languages, parentheses may be
-used to change the order of evaluation.
-
-The @samp{?:} operator is like the same operator in C. If the first
-pattern matches, then the second pattern is matched against the input
-record; otherwise, the third is matched. Only one of the second and
-third patterns is matched.
-
-The @samp{@var{pattern1}, @var{pattern2}} form of a pattern is called a
-range pattern. It matches all input lines starting with a line that
-matches @var{pattern1}, and continuing until a line that matches
-@var{pattern2}, inclusive. A range pattern cannot be used as an operand
-of any of the pattern operators.
-
-@xref{Pattern Overview, ,Pattern Elements}.
-
-@node Regexp Summary, , Pattern Summary, Rules Summary
-@appendixsubsec Regular Expressions
-
-Regular expressions are based on POSIX EREs (extended regular expressions).
-The escape sequences allowed in string constants are also valid in
-regular expressions (@pxref{Escape Sequences}).
-Regexps are composed of characters as follows:
-
-@table @code
-@item @var{c}
-matches the character @var{c} (assuming @var{c} is none of the characters
-listed below).
-
-@item \@var{c}
-matches the literal character @var{c}.
-
-@item .
-matches any character, @emph{including} newline.
-In strict POSIX mode, @samp{.} does not match the @sc{nul}
-character, which is a character with all bits equal to zero.
-
-@item ^
-matches the beginning of a string.
-
-@item $
-matches the end of a string.
-
-@item [@var{abc}@dots{}]
-matches any of the characters @var{abc}@dots{} (character list).
-
-@item [[:@var{class}:]]
-matches any character in the character class @var{class}. Allowable classes
-are @code{alnum}, @code{alpha}, @code{blank}, @code{cntrl},
-@code{digit}, @code{graph}, @code{lower}, @code{print}, @code{punct},
-@code{space}, @code{upper}, and @code{xdigit}.
-
-@item [[.@var{symbol}.]]
-matches the multi-character collating symbol @var{symbol}.
-@code{gawk} does not currently support collating symbols.
-
-@item [[=@var{classname}=]]
-matches any of the equivalent characters in the current locale named by the
-equivalence class @var{classname}.
-@code{gawk} does not currently support equivalence classes.
-
-@item [^@var{abc}@dots{}]
-matches any character except @var{abc}@dots{} (negated
-character list).
-
-@item @var{r1}|@var{r2}
-matches either @var{r1} or @var{r2} (alternation).
-
-@item @var{r1r2}
-matches @var{r1}, and then @var{r2} (concatenation).
-
-@item @var{r}+
-matches one or more @var{r}'s.
-
-@item @var{r}*
-matches zero or more @var{r}'s.
-
-@item @var{r}?
-matches zero or one @var{r}'s.
-
-@item (@var{r})
-matches @var{r} (grouping).
-
-@item @var{r}@{@var{n}@}
-@itemx @var{r}@{@var{n},@}
-@itemx @var{r}@{@var{n},@var{m}@}
-matches at least @var{n}, @var{n} to any number, or @var{n} to @var{m}
-occurrences of @var{r} (interval expressions).
-
-@item \y
-matches the empty string at either the beginning or the
-end of a word.
-
-@item \B
-matches the empty string within a word.
-
-@item \<
-matches the empty string at the beginning of a word.
-
-@item \>
-matches the empty string at the end of a word.
-
-@item \w
-matches any word-constituent character (alphanumeric characters and
-the underscore).
-
-@item \W
-matches any character that is not word-constituent.
-
-@item \`
-matches the empty string at the beginning of a buffer (same as a string
-in @code{gawk}).
-
-@item \'
-matches the empty string at the end of a buffer.
-@end table
-
-The various command line options
-control how @code{gawk} interprets characters in regexps.
-
-@c NOTE!!! Keep this in sync with the same table in the regexp chapter!
-@table @asis
-@item No options
-In the default case, @code{gawk} provide all the facilities of
-POSIX regexps and the GNU regexp operators described above.
-However, interval expressions are not supported.
-
-@item @code{--posix}
-Only POSIX regexps are supported, the GNU operators are not special
-(e.g., @samp{\w} matches a literal @samp{w}). Interval expressions
-are allowed.
-
-@item @code{--traditional}
-Traditional Unix @code{awk} regexps are matched. The GNU operators
-are not special, interval expressions are not available, and neither
-are the POSIX character classes (@code{[[:alnum:]]} and so on).
-Characters described by octal and hexadecimal escape sequences are
-treated literally, even if they represent regexp metacharacters.
-
-@item @code{--re-interval}
-Allow interval expressions in regexps, even if @samp{--traditional}
-has been provided.
-@end table
-
-@xref{Regexp, ,Regular Expressions}.
-
-@node Actions Summary, Functions Summary, Rules Summary, Gawk Summary
-@appendixsec Actions
-
-Action statements are enclosed in braces, @samp{@{} and @samp{@}}.
-A missing action statement is equivalent to @samp{@w{@{ print @}}}.
-
-Action statements consist of the usual assignment, conditional, and looping
-statements found in most languages. The operators, control statements,
-and Input/Output statements available are similar to those in C.
-
-@c These paragraphs repeated for both patterns and actions. I don't
-@c like this, but I also don't see any way around it. Update both copies
-@c if they need fixing.
-Comments begin with the @samp{#} character, and continue until the end of the
-line. Blank lines may be used to separate statements. Statements normally
-end with a newline; however, this is not the case for lines ending in a
-@samp{,}, @samp{@{}, @samp{?}, @samp{:}, @samp{&&}, or @samp{||}. Lines
-ending in @code{do} or @code{else} also have their statements automatically
-continued on the following line. In other cases, a line can be continued by
-ending it with a @samp{\}, in which case the newline is ignored.
-
-Multiple statements may be put on one line by separating each one with
-a @samp{;}.
-This applies to both the statements within the action part of a rule (the
-usual case), and to the rule statements.
-
-@xref{Comments, ,Comments in @code{awk} Programs}, for information on
-@code{awk}'s commenting convention;
-@pxref{Statements/Lines, ,@code{awk} Statements Versus Lines}, for a
-description of the line continuation mechanism in @code{awk}.
-
-@menu
-* Operator Summary:: @code{awk} operators.
-* Control Flow Summary:: The control statements.
-* I/O Summary:: The I/O statements.
-* Printf Summary:: A summary of @code{printf}.
-* Special File Summary:: Special file names interpreted internally.
-* Built-in Functions Summary:: Built-in numeric and string functions.
-* Time Functions Summary:: Built-in time functions.
-* String Constants Summary:: Escape sequences in strings.
-@end menu
-
-@node Operator Summary, Control Flow Summary, Actions Summary, Actions Summary
-@appendixsubsec Operators
-
-The operators in @code{awk}, in order of decreasing precedence, are:
-
-@table @code
-@item (@dots{})
-Grouping.
-
-@item $
-Field reference.
-
-@item ++ --
-Increment and decrement, both prefix and postfix.
-
-@item ^
-Exponentiation (@samp{**} may also be used, and @samp{**=} for the assignment
-operator, but they are not specified in the POSIX standard).
-
-@item + - !
-Unary plus, unary minus, and logical negation.
-
-@item * / %
-Multiplication, division, and modulus.
-
-@item + -
-Addition and subtraction.
-
-@item @var{space}
-String concatenation.
-
-@item < <= > >= != ==
-The usual relational operators.
-
-@item ~ !~
-Regular expression match, negated match.
-
-@item in
-Array membership.
-
-@item &&
-Logical ``and''.
-
-@item ||
-Logical ``or''.
-
-@item ?:
-A conditional expression. This has the form @samp{@var{expr1} ?
-@var{expr2} : @var{expr3}}. If @var{expr1} is true, the value of the
-expression is @var{expr2}; otherwise it is @var{expr3}. Only one of
-@var{expr2} and @var{expr3} is evaluated.
-
-@item = += -= *= /= %= ^=
-Assignment. Both absolute assignment (@code{@var{var}=@var{value}})
-and operator assignment (the other forms) are supported.
-@end table
-
-@xref{Expressions}.
-
-@node Control Flow Summary, I/O Summary, Operator Summary, Actions Summary
-@appendixsubsec Control Statements
-
-The control statements are as follows:
-
-@example
-if (@var{condition}) @var{statement} @r{[} else @var{statement} @r{]}
-while (@var{condition}) @var{statement}
-do @var{statement} while (@var{condition})
-for (@var{expr1}; @var{expr2}; @var{expr3}) @var{statement}
-for (@var{var} in @var{array}) @var{statement}
-break
-continue
-delete @var{array}[@var{index}]
-delete @var{array}
-exit @r{[} @var{expression} @r{]}
-@{ @var{statements} @}
-@end example
-
-@xref{Statements, ,Control Statements in Actions}.
-
-@node I/O Summary, Printf Summary, Control Flow Summary, Actions Summary
-@appendixsubsec I/O Statements
-
-The Input/Output statements are as follows:
-
-@table @code
-@item getline
-Set @code{$0} from next input record; set @code{NF}, @code{NR}, @code{FNR}.
-@xref{Getline, ,Explicit Input with @code{getline}}.
-
-@item getline <@var{file}
-Set @code{$0} from next record of @var{file}; set @code{NF}.
-
-@item getline @var{var}
-Set @var{var} from next input record; set @code{NR}, @code{FNR}.
-
-@item getline @var{var} <@var{file}
-Set @var{var} from next record of @var{file}.
-
-@item @var{command} | getline
-Run @var{command}, piping its output into @code{getline}; sets @code{$0},
-@code{NF}, @code{NR}.
-
-@item @var{command} | getline @code{var}
-Run @var{command}, piping its output into @code{getline}; sets @var{var}.
-
-@item next
-Stop processing the current input record. The next input record is read and
-processing starts over with the first pattern in the @code{awk} program.
-If the end of the input data is reached, the @code{END} rule(s), if any,
-are executed.
-@xref{Next Statement, ,The @code{next} Statement}.
-
-@item nextfile
-Stop processing the current input file. The next input record read comes
-from the next input file. @code{FILENAME} is updated, @code{FNR} is set to one,
-@code{ARGIND} is incremented,
-and processing starts over with the first pattern in the @code{awk} program.
-If the end of the input data is reached, the @code{END} rule(s), if any,
-are executed.
-Earlier versions of @code{gawk} used @samp{next file}; this usage is still
-supported, but is considered to be deprecated.
-@xref{Nextfile Statement, ,The @code{nextfile} Statement}.
-
-@item print
-Prints the current record.
-@xref{Printing, ,Printing Output}.
-
-@item print @var{expr-list}
-Prints expressions.
-
-@item print @var{expr-list} > @var{file}
-Prints expressions to @var{file}. If @var{file} does not exist, it is
-created. If it does exist, its contents are deleted the first time the
-@code{print} is executed.
-
-@item print @var{expr-list} >> @var{file}
-Prints expressions to @var{file}. The previous contents of @var{file}
-are retained, and the output of @code{print} is appended to the file.
-
-@item print @var{expr-list} | @var{command}
-Prints expressions, sending the output down a pipe to @var{command}.
-The pipeline to the command stays open until the @code{close} function
-is called.
-
-@item printf @var{fmt}, @var{expr-list}
-Format and print.
-
-@item printf @var{fmt}, @var{expr-list} > @var{file}
-Format and print to @var{file}. If @var{file} does not exist, it is
-created. If it does exist, its contents are deleted the first time the
-@code{printf} is executed.
-
-@item printf @var{fmt}, @var{expr-list} >> @var{file}
-Format and print to @var{file}. The previous contents of @var{file}
-are retained, and the output of @code{printf} is appended to the file.
-
-@item printf @var{fmt}, @var{expr-list} | @var{command}
-Format and print, sending the output down a pipe to @var{command}.
-The pipeline to the command stays open until the @code{close} function
-is called.
-@end table
-
-@code{getline} returns zero on end of file, and @minus{}1 on an error.
-In the event of an error, @code{getline} will set @code{ERRNO} to
-the value of a system-dependent string that describes the error.
-
-@node Printf Summary, Special File Summary, I/O Summary, Actions Summary
-@appendixsubsec @code{printf} Summary
-
-Conversion specification have the form
-@code{%}[@var{flag}][@var{width}][@code{.}@var{prec}]@var{format}.
-@c whew!
-Items in brackets are optional.
-
-The @code{awk} @code{printf} statement and @code{sprintf} function
-accept the following conversion specification formats:
-
-@table @code
-@item %c
-An ASCII character. If the argument used for @samp{%c} is numeric, it is
-treated as a character and printed. Otherwise, the argument is assumed to
-be a string, and the only first character of that string is printed.
-
-@item %d
-@itemx %i
-A decimal number (the integer part).
-
-@item %e
-@itemx %E
-A floating point number of the form
-@samp{@r{[}-@r{]}d.dddddde@r{[}+-@r{]}dd}.
-The @samp{%E} format uses @samp{E} instead of @samp{e}.
-
-@item %f
-A floating point number of the form
-@r{[}@code{-}@r{]}@code{ddd.dddddd}.
-
-@item %g
-@itemx %G
-Use either the @samp{%e} or @samp{%f} formats, whichever produces a shorter
-string, with non-significant zeros suppressed.
-@samp{%G} will use @samp{%E} instead of @samp{%e}.
-
-@item %o
-An unsigned octal number (also an integer).
-
-@item %u
-An unsigned decimal number (again, an integer).
-
-@item %s
-A character string.
-
-@item %x
-@itemx %X
-An unsigned hexadecimal number (an integer).
-The @samp{%X} format uses @samp{A} through @samp{F} instead of
-@samp{a} through @samp{f} for decimal 10 through 15.
-
-@item %%
-A single @samp{%} character; no argument is converted.
-@end table
-
-There are optional, additional parameters that may lie between the @samp{%}
-and the control letter:
-
-@table @code
-@item -
-The expression should be left-justified within its field.
-
-@item @var{space}
-For numeric conversions, prefix positive values with a space, and
-negative values with a minus sign.
-
-@item +
-The plus sign, used before the width modifier (see below),
-says to always supply a sign for numeric conversions, even if the data
-to be formatted is positive. The @samp{+} overrides the space modifier.
-
-@item #
-Use an ``alternate form'' for certain control letters.
-For @samp{o}, supply a leading zero.
-For @samp{x}, and @samp{X}, supply a leading @samp{0x} or @samp{0X} for
-a non-zero result.
-For @samp{e}, @samp{E}, and @samp{f}, the result will always contain a
-decimal point.
-For @samp{g}, and @samp{G}, trailing zeros are not removed from the result.
-
-@item 0
-A leading @samp{0} (zero) acts as a flag, that indicates output should be
-padded with zeros instead of spaces.
-This applies even to non-numeric output formats.
-This flag only has an effect when the field width is wider than the
-value to be printed.
-
-@item @var{width}
-The field should be padded to this width. The field is normally padded
-with spaces. If the @samp{0} flag has been used, it is padded with zeros.
-
-@item .@var{prec}
-A number that specifies the precision to use when printing.
-For the @samp{e}, @samp{E}, and @samp{f} formats, this specifies the
-number of digits you want printed to the right of the decimal point.
-For the @samp{g}, and @samp{G} formats, it specifies the maximum number
-of significant digits. For the @samp{d}, @samp{o}, @samp{i}, @samp{u},
-@samp{x}, and @samp{X} formats, it specifies the minimum number of
-digits to print. For the @samp{s} format, it specifies the maximum number of
-characters from the string that should be printed.
-@end table
-
-Either or both of the @var{width} and @var{prec} values may be specified
-as @samp{*}. In that case, the particular value is taken from the argument
-list.
-
-@xref{Printf, ,Using @code{printf} Statements for Fancier Printing}.
-
-@node Special File Summary, Built-in Functions Summary, Printf Summary, Actions Summary
-@appendixsubsec Special File Names
-
-When doing I/O redirection from either @code{print} or @code{printf} into a
-file, or via @code{getline} from a file, @code{gawk} recognizes certain special
-file names internally. These file names allow access to open file descriptors
-inherited from @code{gawk}'s parent process (usually the shell). The
-file names are:
-
-@table @file
-@item /dev/stdin
-The standard input.
-
-@item /dev/stdout
-The standard output.
-
-@item /dev/stderr
-The standard error output.
-
-@item /dev/fd/@var{n}
-The file denoted by the open file descriptor @var{n}.
-@end table
-
-In addition, reading the following files provides process related information
-about the running @code{gawk} program. All returned records are terminated
-with a newline.
-
-@table @file
-@item /dev/pid
-Returns the process ID of the current process.
-
-@item /dev/ppid
-Returns the parent process ID of the current process.
-
-@item /dev/pgrpid
-Returns the process group ID of the current process.
-
-@item /dev/user
-At least four space-separated fields, containing the return values of
-the @code{getuid}, @code{geteuid}, @code{getgid}, and @code{getegid}
-system calls.
-If there are any additional fields, they are the group IDs returned by
-@code{getgroups} system call.
-(Multiple groups may not be supported on all systems.)
-@end table
+@itemize @bullet
+@item
+The @code{BINMODE} special variable for non-POSIX systems,
+which allows binary I/O for input and/or output files
+(@pxref{PC Using, ,Using @command{gawk} on PC Operating Systems}).
-@noindent
-These file names may also be used on the command line to name data files.
-These file names are only recognized internally if you do not
-actually have files with these names on your system.
+@item
+The @code{LINT} special variable, which dynamically controls lint warnings
+(@pxref{Built-in Variables}).
-@xref{Special Files, ,Special File Names in @code{gawk}}, for a longer description that
-provides the motivation for this feature.
+@item
+The @code{PROCINFO} array for providing process-related information
+(@pxref{Built-in Variables}).
-@node Built-in Functions Summary, Time Functions Summary, Special File Summary, Actions Summary
-@appendixsubsec Built-in Functions
+@item
+The @code{TEXTDOMAIN} special variable for setting an application's
+internationalization text domain
+(@pxref{Built-in Variables},
+and
+@ref{Internationalization, ,Internationalization with @command{gawk}}).
-@code{awk} provides a number of built-in functions for performing
-numeric operations, string related operations, and I/O related operations.
+@item
+The ability to use octal and hexadecimal constants in @command{awk}
+program source code
+(@pxref{Non-decimal-numbers, ,Octal and Hexadecimal Numbers}).
-@c NEEDED
-@page
-The built-in arithmetic functions are:
+@item
+The @samp{|&} operator for two-way I/O to a coprocess
+(@pxref{Two-way I/O, ,Two-Way Communications with Another Process}).
-@table @code
-@item atan2(@var{y}, @var{x})
-the arctangent of @var{y/x} in radians.
+@item
+The @file{/inet} special files for TCP/IP networking using @samp{|&}
+(@pxref{TCP/IP Networking, , Using @command{gawk} for Network Programming}).
-@item cos(@var{expr})
-the cosine of @var{expr}, which is in radians.
+@item
+The optional second argument to @code{close} that allows closing one end
+of a two-way pipe to a coprocess
+(@pxref{Two-way I/O, ,Two-Way Communications with Another Process}).
-@item exp(@var{expr})
-the exponential function (@code{e ^ @var{expr}}).
+@item
+The optional third argument to the @code{match} function
+for capturing text-matching subexpressions within a regexp
+(@pxref{String Functions, , String Manipulation Functions}).
-@item int(@var{expr})
-truncates to integer.
+@item
+Positional specifiers in @code{printf} formats for
+making translations easier
+(@pxref{Printf Ordering, , Rearranging @code{printf} Arguments}).
-@item log(@var{expr})
-the natural logarithm of @code{expr}.
+@item
+The @code{asort} function for sorting arrays
+(@pxref{Array Sorting, ,Sorting Array Values and Indices with @command{gawk}}).
-@item rand()
-a random number between zero and one.
+@item
+The @code{bindtextdomain} and @code{dcgettext} functions
+for internationalization
+(@pxref{Programmer i18n, ,Internationalizing @command{awk} Programs}).
-@item sin(@var{expr})
-the sine of @var{expr}, which is in radians.
+@item
+The @code{extension} built-in function and the ability to add
+new built-in functions dynamically
+(@pxref{Dynamic Extensions, , Adding New Built-in Functions to @command{gawk}}).
-@item sqrt(@var{expr})
-the square root function.
+@item
+The @code{mktime} built-in function for creating timestamps
+(@pxref{Time Functions, ,Using @command{gawk}'s Timestamp Functions}).
-@item srand(@r{[}@var{expr}@r{]})
-use @var{expr} as a new seed for the random number generator. If no @var{expr}
-is provided, the time of day is used. The return value is the previous
-seed for the random number generator.
-@end table
+@item
+The
+@code{and},
+@code{or},
+@code{xor},
+@code{compl},
+@code{lshift},
+@code{rshift},
+and
+@code{strtonum} built-in
+functions
+(@pxref{Bitwise Functions, ,Using @command{gawk}'s Bit Manipulation Functions}).
-@code{awk} has the following built-in string functions:
+@item
+@cindex @code{next file} statement
+The support for @samp{next file} as two words was removed completely
+(@pxref{Nextfile Statement, ,Using @command{gawk}'s @code{nextfile} Statement}).
-@table @code
-@item gensub(@var{regex}, @var{subst}, @var{how} @r{[}, @var{target}@r{]})
-If @var{how} is a string beginning with @samp{g} or @samp{G}, then
-replace each match of @var{regex} in @var{target} with @var{subst}.
-Otherwise, replace the @var{how}'th occurrence. If @var{target} is not
-supplied, use @code{$0}. The return value is the changed string; the
-original @var{target} is not modified. Within @var{subst},
-@samp{\@var{n}}, where @var{n} is a digit from one to nine, can be used to
-indicate the text that matched the @var{n}'th parenthesized
-subexpression.
-This function is @code{gawk}-specific.
-
-@item gsub(@var{regex}, @var{subst} @r{[}, @var{target}@r{]})
-for each substring matching the regular expression @var{regex} in the string
-@var{target}, substitute the string @var{subst}, and return the number of
-substitutions. If @var{target} is not supplied, use @code{$0}.
-
-@item index(@var{str}, @var{search})
-returns the index of the string @var{search} in the string @var{str}, or
-zero if
-@var{search} is not present.
-
-@item length(@r{[}@var{str}@r{]})
-returns the length of the string @var{str}. The length of @code{$0}
-is returned if no argument is supplied.
-
-@item match(@var{str}, @var{regex})
-returns the position in @var{str} where the regular expression @var{regex}
-occurs, or zero if @var{regex} is not present, and sets the values of
-@code{RSTART} and @code{RLENGTH}.
-
-@item split(@var{str}, @var{arr} @r{[}, @var{regex}@r{]})
-splits the string @var{str} into the array @var{arr} on the regular expression
-@var{regex}, and returns the number of elements. If @var{regex} is omitted,
-@code{FS} is used instead. @var{regex} can be the null string, causing
-each character to be placed into its own array element.
-The array @var{arr} is cleared first.
-
-@item sprintf(@var{fmt}, @var{expr-list})
-prints @var{expr-list} according to @var{fmt}, and returns the resulting string.
-
-@item sub(@var{regex}, @var{subst} @r{[}, @var{target}@r{]})
-just like @code{gsub}, but only the first matching substring is replaced.
-
-@item substr(@var{str}, @var{index} @r{[}, @var{len}@r{]})
-returns the @var{len}-character substring of @var{str} starting at @var{index}.
-If @var{len} is omitted, the rest of @var{str} is used.
-
-@item tolower(@var{str})
-returns a copy of the string @var{str}, with all the upper-case characters in
-@var{str} translated to their corresponding lower-case counterparts.
-Non-alphabetic characters are left unchanged.
-
-@item toupper(@var{str})
-returns a copy of the string @var{str}, with all the lower-case characters in
-@var{str} translated to their corresponding upper-case counterparts.
-Non-alphabetic characters are left unchanged.
-@end table
+@item
+The @option{--dump-variables} option to print a list of all global variables
+(@pxref{Options, ,Command-Line Options}).
-The I/O related functions are:
+@item
+The @option{--gen-po} command-line option and the use of a leading
+underscore to mark strings that should be translated
+(@pxref{String Extraction, ,Extracting Marked Strings}).
-@table @code
-@item close(@var{expr})
-Close the open file or pipe denoted by @var{expr}.
+@item
+The @option{--non-decimal-data} option to allow non-decimal
+input data
+(@pxref{Non-decimal Data, ,Allowing Non-Decimal Input Data}).
-@item fflush(@r{[}@var{expr}@r{]})
-Flush any buffered output for the output file or pipe denoted by @var{expr}.
-If @var{expr} is omitted, standard output is flushed.
-If @var{expr} is the null string (@code{""}), all output buffers are flushed.
+@item
+The @option{--profile} option and @command{pgawk}, the
+profiling version of @command{gawk}, for producing execution
+profiles of @command{awk} programs
+(@pxref{Profiling, ,Profiling Your @command{awk} Programs}).
-@item system(@var{cmd-line})
-Execute the command @var{cmd-line}, and return the exit status.
-If your operating system does not support @code{system}, calling it will
-generate a fatal error.
+@item
+The @option{--enable-portals} configuration option to enable special treatment of
+pathnames that begin with @file{/p} as BSD portals
+(@pxref{Portal Files, , Using @command{gawk} with BSD Portals}).
-@samp{system("")} can be used to force @code{awk} to flush any pending
-output. This is more portable, but less obvious, than calling @code{fflush}.
-@end table
+@item
+The use of GNU Automake to help in standardizing the configuration process
+(@pxref{Quick Installation, , Compiling @command{gawk} for Unix}).
-@node Time Functions Summary, String Constants Summary, Built-in Functions Summary, Actions Summary
-@appendixsubsec Time Functions
+@item
+The use of GNU @code{gettext} for @command{gawk}'s own message output
+(@pxref{Gawk I18N, ,@command{gawk} Can Speak Your Language}).
-The following two functions are available for getting the current
-time of day, and for formatting time stamps.
-They are specific to @code{gawk}.
+@item
+BeOS support
+(@pxref{BeOS Installation, , Installing @command{gawk} on BeOS}).
-@table @code
-@item systime()
-returns the current time of day as the number of seconds since a particular
-epoch (Midnight, January 1, 1970 UTC, on POSIX systems).
-
-@item strftime(@r{[}@var{format}@r{[}, @var{timestamp}@r{]]})
-formats @var{timestamp} according to the specification in @var{format}.
-The current time of day is used if no @var{timestamp} is supplied.
-A default format equivalent to the output of the @code{date} utility is used if
-no @var{format} is supplied.
-@xref{Time Functions, ,Functions for Dealing with Time Stamps}, for the
-details on the conversion specifiers that @code{strftime} accepts.
-@end table
+@item
+Tandem support
+(@pxref{Tandem Installation, ,Installing @command{gawk} on a Tandem}).
-@iftex
-@xref{Built-in, ,Built-in Functions}, for a description of all of
-@code{awk}'s built-in functions.
-@end iftex
+@item
+The Atari port became officially unsupported
+(@pxref{Atari Installation, ,Installing @command{gawk} on the Atari ST}).
-@node String Constants Summary, , Time Functions Summary, Actions Summary
-@appendixsubsec String Constants
+@item
+The source code now uses new-style function definitions, with
+@command{ansi2knr} to convert the code on systems with old compilers.
-String constants in @code{awk} are sequences of characters enclosed
-in double quotes (@code{"}). Within strings, certain @dfn{escape sequences}
-are recognized, as in C. These are:
+@end itemize
-@table @code
-@item \\
-A literal backslash.
+@c XXX ADD MORE STUFF HERE
-@item \a
-The ``alert'' character; usually the ASCII BEL character.
+@node Contributors, , POSIX/GNU, Language History
+@appendixsec Major Contributors to @command{gawk}
+@cindex contributors to @command{gawk}
+@quotation
+@i{Always give credit where credit is due.}@*
+Anonymous
+@end quotation
-@item \b
-Backspace.
+This @value{SECTION} names the major contributors to @command{gawk}
+and/or this @value{DOCUMENT}, in approximate chronological order:
-@item \f
-Formfeed.
+@itemize @bullet
+@item
+@cindex Aho, Alfred
+@cindex Weinberger, Peter
+@cindex Kernighan, Brian
+Dr.@: Alfred V.@: Aho,
+Dr.@: Peter J.@: Weinberger, and
+Dr.@: Brian W.@: Kernighan, all of Bell Laboratories,
+designed and implemented Unix @command{awk},
+from which @command{gawk} gets the majority of its feature set.
-@item \n
-Newline.
+@item
+@cindex Rubin, Paul
+Paul Rubin
+did the initial design and implementation in 1986, and wrote
+the first draft (around 40 pages) of this @value{DOCUMENT}.
-@item \r
-Carriage return.
+@item
+@cindex Fenlason, Jay
+Jay Fenlason
+finished the initial implementation.
-@item \t
-Horizontal tab.
+@item
+@cindex Close, Diane
+Diane Close
+revised the first draft of this @value{DOCUMENT}, bringing it
+to around 90 pages.
-@item \v
-Vertical tab.
-
-@item \x@var{hex digits}
-The character represented by the string of hexadecimal digits following
-the @samp{\x}. As in ANSI C, all following hexadecimal digits are
-considered part of the escape sequence. E.g., @code{"\x1B"} is a
-string containing the ASCII ESC (escape) character. (The @samp{\x}
-escape sequence is not in POSIX @code{awk}.)
-
-@item \@var{ddd}
-The character represented by the one, two, or three digit sequence of octal
-digits. Thus, @code{"\033"} is also a string containing the ASCII ESC
-(escape) character.
-
-@item \@var{c}
-The literal character @var{c}, if @var{c} is not one of the above.
-@end table
+@item
+@cindex Stallman, Richard
+Richard Stallman
+helped finish the implementation and the initial draft of this
+@value{DOCUMENT}.
+He is also the founder of the FSF and the GNU project.
-The escape sequences may also be used inside constant regular expressions
-(e.g., the regexp @code{@w{/[@ \t\f\n\r\v]/}} matches whitespace
-characters).
+@item
+@cindex Woods, John
+John Woods
+contributed parts of the code (mostly fixes) in
+the initial version of @command{gawk}.
-@xref{Escape Sequences}.
+@item
+@cindex Trueman, David
+In 1988,
+David Trueman
+took over primary maintenance of @command{gawk},
+making it compatible with ``new'' @command{awk}, and
+greatly improving its performance.
-@node Functions Summary, Historical Features, Actions Summary, Gawk Summary
-@appendixsec User-defined Functions
+@item
+@cindex Rankin, Pat
+Pat Rankin
+provided the VMS port and its documentation.
-Functions in @code{awk} are defined as follows:
+@item
+@cindex Kwok, Conrad
+@cindex Garfinkle, Scott
+@cindex Williams, Kent
+Conrad Kwok,
+Scott Garfinkle,
+and
+Kent Williams
+did the initial ports to MS-DOS with various versions of MSC.
-@example
-function @var{name}(@var{parameter list}) @{ @var{statements} @}
-@end example
+@item
+@cindex Peterson, Hal
+Hal Peterson
+provided help in porting @command{gawk} to Cray systems.
-Actual parameters supplied in the function call are used to instantiate
-the formal parameters declared in the function. Arrays are passed by
-reference, other variables are passed by value.
+@item
+@cindex Rommel, Kai Uwe
+Kai Uwe Rommel
+provided the port to OS/2 and its documentation.
-If there are fewer arguments passed than there are names in @var{parameter-list},
-the extra names are given the null string as their value. Extra names have the
-effect of local variables.
+@item
+@cindex Jaegermann, Michal
+Michal Jaegermann
+provided the port to Atari systems and its documentation.
+He continues to provide portability checking with DEC Alpha
+systems, and has done a lot of work to make sure @command{gawk}
+works on non-32-bit systems.
-The open-parenthesis in a function call of a user-defined function must
-immediately follow the function name, without any intervening white space.
-This is to avoid a syntactic ambiguity with the concatenation operator.
+@item
+@cindex Fish, Fred
+Fred Fish
+provided the port to Amiga systems and its documentation.
-The word @code{func} may be used in place of @code{function} (but not in
-POSIX @code{awk}).
+@item
+@cindex Deifik, Scott
+Scott Deifik
+currently maintains the MS-DOS port.
-Use the @code{return} statement to return a value from a function.
+@item
+@cindex Grigera, Juan
+Juan Grigera
+maintains the port to Win32 systems.
-@xref{User-defined, ,User-defined Functions}.
+@item
+@cindex Hankerson, Darrel
+Dr.@: Darrel Hankerson
+acts as coordinator for the various ports to different PC platforms
+and creates binary distributions for various PC operating systems.
+He is also instrumental in keeping the documentation up to date for
+the various PC platforms.
-@node Historical Features, , Functions Summary, Gawk Summary
-@appendixsec Historical Features
+@item
+@cindex Zoulas, Christos
+Christos Zoulas
+provided the @code{extension}
+built-in function for dynamically adding new modules.
-@cindex historical features
-There are two features of historical @code{awk} implementations that
-@code{gawk} supports.
+@item
+@cindex Kahrs, J@"urgen
+J@"urgen Kahrs
+contributed the initial version of the TCP/IP networking
+code and documentation, and motivated the inclusion of the @samp{|&} operator.
-First, it is possible to call the @code{length} built-in function not only
-with no arguments, but even without parentheses!
+@item
+@cindex Davies, Stephen
+Stephen Davies
+provided the port to Tandem systems and its documentation.
-@example
-a = length
-@end example
+@item
+@cindex Brown, Martin
+Martin Brown
+provided the port to BeOS and its documentation.
-@noindent
-is the same as either of
+@item
+@cindex Peters, Arno
+Arno Peters
+did the initial work to convert @command{gawk} to use
+GNU Automake and @code{gettext}.
-@example
-a = length()
-a = length($0)
-@end example
+@item
+@cindex Broder, Alan J.@:
+Alan J.@: Broder
+provided the initial version of the @code{asort} function
+as well as the code for the new optional third argument to the @code{match} function.
-@noindent
-For example:
+@item
+@cindex Robbins, Arnold
+Arnold Robbins
+has been working on @command{gawk} since 1988, at first
+helping David Trueman, and as the primary maintainer since around 1994.
+@end itemize
-@example
-$ echo abcdef | awk '@{ print length @}'
-@print{} 6
-@end example
+@node Installation, Notes, Language History, Top
+@appendix Installing @command{gawk}
-@noindent
-This feature is marked as ``deprecated'' in the POSIX standard, and
-@code{gawk} will issue a warning about its use if @samp{--lint} is
-specified on the command line.
-(The ability to use @code{length} this way was actually an accident of the
-original Unix @code{awk} implementation. If any built-in function used
-@code{$0} as its default argument, it was possible to call that function
-without the parentheses. In particular, it was common practice to use
-the @code{length} function in this fashion, and this usage was documented
-in the @code{awk} manual page.)
-
-The other historical feature is the use of either the @code{break} statement,
-or the @code{continue} statement
-outside the body of a @code{while}, @code{for}, or @code{do} loop. Traditional
-@code{awk} implementations have treated such usage as equivalent to the
-@code{next} statement. More recent versions of Unix @code{awk} do not allow
-it. @code{gawk} supports this usage if @samp{--traditional} has been
-specified.
-
-@xref{Options, ,Command Line Options}, for more information about the
-@samp{--posix} and @samp{--lint} options.
-
-@node Installation, Notes, Gawk Summary, Top
-@appendix Installing @code{gawk}
-
-This appendix provides instructions for installing @code{gawk} on the
+@cindex Linux
+@cindex GNU/Linux
+This appendix provides instructions for installing @command{gawk} on the
various platforms that are supported by the developers. The primary
-developers support Unix (and one day, GNU), while the other ports were
-contributed. The file @file{ACKNOWLEDGMENT} in the @code{gawk}
-distribution lists the electronic mail addresses of the people who did
-the respective ports, and they are also provided in
-@ref{Bugs, , Reporting Problems and Bugs}.
+developer supports GNU/Linux (and Unix), whereas the other ports are
+contributed.
+@xref{Bugs, , Reporting Problems and Bugs},
+for the electronic mail addresses of the people who did
+the respective ports.
@menu
-* Gawk Distribution:: What is in the @code{gawk} distribution.
-* Unix Installation:: Installing @code{gawk} under various versions
- of Unix.
-* VMS Installation:: Installing @code{gawk} on VMS.
-* PC Installation:: Installing and Compiling @code{gawk} on MS-DOS
- and OS/2
-* Atari Installation:: Installing @code{gawk} on the Atari ST.
-* Amiga Installation:: Installing @code{gawk} on an Amiga.
+* Gawk Distribution:: What is in the @command{gawk} distribution.
+* Unix Installation:: Installing @command{gawk} under various
+ versions of Unix.
+* Non-Unix Installation:: Installation on Other Operating Systems.
+* Unsupported:: Systems whose ports are no longer supported.
* Bugs:: Reporting Problems and Bugs.
-* Other Versions:: Other freely available @code{awk}
+* Other Versions:: Other freely available @command{awk}
implementations.
@end menu
@node Gawk Distribution, Unix Installation, Installation, Installation
-@appendixsec The @code{gawk} Distribution
+@appendixsec The @command{gawk} Distribution
-This section first describes how to get the @code{gawk}
+This @value{SECTION} describes how to get the @command{gawk}
distribution, how to extract it, and then what is in the various files and
subdirectories.
@@ -18647,228 +21545,135 @@ subdirectories.
@end menu
@node Getting, Extracting, Gawk Distribution, Gawk Distribution
-@appendixsubsec Getting the @code{gawk} Distribution
-@cindex getting @code{gawk}
-@cindex anonymous @code{ftp}
-@cindex @code{ftp}, anonymous
-@cindex Free Software Foundation
-There are three ways you can get GNU software.
+@appendixsubsec Getting the @command{gawk} Distribution
+@cindex getting @command{gawk}
+@cindex anonymous @command{ftp}
+@cindex @command{ftp}, anonymous
+@cindex source code, @command{gawk}
+@cindex @command{gawk}, source code
+There are three ways to get GNU software:
-@enumerate
+@itemize @bullet
@item
-You can copy it from someone else who already has it.
+Copy it from someone else who already has it.
+@cindex FSF
@cindex Free Software Foundation
@item
-You can order @code{gawk} directly from the Free Software Foundation.
+Order @command{gawk} directly from the Free Software Foundation.
Software distributions are available for Unix, MS-DOS, and VMS, on
-tape and CD-ROM. The address is:
+tape and CD-ROM. Their address is:
-@quotation
-Free Software Foundation @*
-59 Temple Place---Suite 330 @*
-Boston, MA 02111-1307 USA @*
-Phone: +1-617-542-5942 @*
-Fax (including Japan): +1-617-542-2652 @*
-Email: @code{gnu@@gnu.org} @*
-URL: @code{http://www.gnu.org/} @*
-@end quotation
+@display
+Free Software Foundation
+59 Temple Place, Suite 330
+Boston, MA 02111-1307 USA
+Phone: +1-617-542-5942
+Fax (including Japan): +1-617-542-2652
+Email: @email{gnu@@gnu.org}
+URL: @uref{http://www.gnu.org/}
+@end display
@noindent
Ordering from the FSF directly contributes to the support of the foundation
and to the production of more free software.
@item
-You can get @code{gawk} by using anonymous @code{ftp} to the Internet host
+Retrieve @command{gawk} by using anonymous @command{ftp} to the Internet host
@code{gnudist.gnu.org}, in the directory @file{/gnu/gawk}.
+@end itemize
-Here is a list of alternate @code{ftp} sites from which you can obtain GNU
-software. When a site is listed as ``@var{site}@code{:}@var{directory}'' the
-@var{directory} indicates the directory where GNU software is kept.
-You should use a site that is geographically close to you.
-
-@table @asis
-@item Asia:
-@table @code
-@item cair-archive.kaist.ac.kr:/pub/gnu
-@itemx ftp.cs.titech.ac.jp
-@itemx ftp.nectec.or.th:/pub/mirrors/gnu
-@itemx utsun.s.u-tokyo.ac.jp:/ftpsync/prep
-@end table
-
-@c NEEDED
-@page
-@item Australia:
-@table @code
-@item archie.au:/gnu
-(@code{archie.oz} or @code{archie.oz.au} for ACSnet)
-@end table
-
-@item Africa:
-@table @code
-@item ftp.sun.ac.za:/pub/gnu
-@end table
-
-@item Middle East:
-@table @code
-@item ftp.technion.ac.il:/pub/unsupported/gnu
-@end table
-
-@item Europe:
-@table @code
-@item archive.eu.net
-@itemx ftp.denet.dk
-@itemx ftp.eunet.ch
-@itemx ftp.funet.fi:/pub/gnu
-@itemx ftp.ieunet.ie:pub/gnu
-@itemx ftp.informatik.rwth-aachen.de:/pub/gnu
-@itemx ftp.informatik.tu-muenchen.de
-@itemx ftp.luth.se:/pub/unix/gnu
-@itemx ftp.mcc.ac.uk
-@itemx ftp.stacken.kth.se
-@itemx ftp.sunet.se:/pub/gnu
-@itemx ftp.univ-lyon1.fr:pub/gnu
-@itemx ftp.win.tue.nl:/pub/gnu
-@itemx irisa.irisa.fr:/pub/gnu
-@itemx isy.liu.se
-@itemx nic.switch.ch:/mirror/gnu
-@itemx src.doc.ic.ac.uk:/gnu
-@itemx unix.hensa.ac.uk:/pub/uunet/systems/gnu
-@end table
-
-@item South America:
-@table @code
-@item ftp.inf.utfsm.cl:/pub/gnu
-@itemx ftp.unicamp.br:/pub/gnu
-@end table
-
-@item Western Canada:
-@table @code
-@item ftp.cs.ubc.ca:/mirror2/gnu
-@end table
-
-@item USA:
-@table @code
-@item col.hp.com:/mirrors/gnu
-@itemx f.ms.uky.edu:/pub3/gnu
-@itemx ftp.cc.gatech.edu:/pub/gnu
-@itemx ftp.cs.columbia.edu:/archives/gnu/prep
-@itemx ftp.digex.net:/pub/gnu
-@itemx ftp.hawaii.edu:/mirrors/gnu
-@itemx ftp.kpc.com:/pub/mirror/gnu
-@end table
-
-@c NEEDED
-@page
-@item USA (continued):
-@table @code
-@itemx ftp.uu.net:/systems/gnu
-@itemx gatekeeper.dec.com:/pub/GNU
-@itemx jaguar.utah.edu:/gnustuff
-@itemx labrea.stanford.edu
-@itemx mrcnext.cso.uiuc.edu:/pub/gnu
-@itemx vixen.cso.uiuc.edu:/gnu
-@itemx wuarchive.wustl.edu:/systems/gnu
-@end table
-@end table
-@end enumerate
+The GNU software archive is mirrored around the world.
+The up-to-date list of mirror sites is available from
+@uref{http://www.gnu.org/order/ftp.html, the main FSF web site}.
+Try to use one of the mirrors; they
+will be less busy, and you can usually find one closer to your site.
@node Extracting, Distribution contents, Getting, Gawk Distribution
@appendixsubsec Extracting the Distribution
-@code{gawk} is distributed as a @code{tar} file compressed with the
+@command{gawk} is distributed as a @code{tar} file compressed with the
GNU Zip program, @code{gzip}.
Once you have the distribution (for example,
-@file{gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz}), first use @code{gzip} to expand the
-file, and then use @code{tar} to extract it. You can use the following
-pipeline to produce the @code{gawk} distribution:
+@file{gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz}),
+use @code{gzip} to expand the
+file and then use @code{tar} to extract it. You can use the following
+pipeline to produce the @command{gawk} distribution:
@example
-# Under System V, add 'o' to the tar flags
+# Under System V, add 'o' to the tar options
gzip -d -c gawk-@value{VERSION}.@value{PATCHLEVEL}.tar.gz | tar -xvpf -
@end example
@noindent
-This will create a directory named @file{gawk-@value{VERSION}.@value{PATCHLEVEL}} in the current
-directory.
+This creates a directory named @file{gawk-@value{VERSION}.@value{PATCHLEVEL}}
+in the current directory.
-The distribution file name is of the form
-@file{gawk-@var{V}.@var{R}.@var{n}.tar.gz}.
-The @var{V} represents the major version of @code{gawk},
+The distribution @value{FN} is of the form
+@file{gawk-@var{V}.@var{R}.@var{P}.tar.gz}.
+The @var{V} represents the major version of @command{gawk},
the @var{R} represents the current release of version @var{V}, and
-the @var{n} represents a @dfn{patch level}, meaning that minor bugs have
+the @var{P} represents a @dfn{patch level}, meaning that minor bugs have
been fixed in the release. The current patch level is @value{PATCHLEVEL},
-but when
-retrieving distributions, you should get the version with the highest
-version, release, and patch level. (Note that release levels greater than
-or equal to 90 denote ``beta,'' or non-production software; you may not wish
+but when retrieving distributions, you should get the version with the highest
+version, release, and patch level. (Note, however, that patch levels greater than
+or equal to 80 denote ``beta'' or non-production software; you might not want
to retrieve such a version unless you don't mind experimenting.)
-
-If you are not on a Unix system, you will need to make other arrangements
-for getting and extracting the @code{gawk} distribution. You should consult
+If you are not on a Unix system, you need to make other arrangements
+for getting and extracting the @command{gawk} distribution. You should consult
a local expert.
-@node Distribution contents, , Extracting, Gawk Distribution
-@appendixsubsec Contents of the @code{gawk} Distribution
+@node Distribution contents, , Extracting, Gawk Distribution
+@appendixsubsec Contents of the @command{gawk} Distribution
-The @code{gawk} distribution has a number of C source files,
+The @command{gawk} distribution has a number of C source files,
documentation files,
-subdirectories and files related to the configuration process
-(@pxref{Unix Installation, ,Compiling and Installing @code{gawk} on Unix}),
-and several subdirectories related to different, non-Unix,
-operating systems.
+subdirectories, and files related to the configuration process
+(@pxref{Unix Installation, ,Compiling and Installing @command{gawk} on Unix}),
+as well as several subdirectories related to different non-Unix
+operating systems:
@table @asis
-@item various @samp{.c}, @samp{.y}, and @samp{.h} files
-These files are the actual @code{gawk} source code.
+@item Various @samp{.c}, @samp{.y}, and @samp{.h} files:
+These files are the actual @command{gawk} source code.
@end table
@table @file
@item README
@itemx README_d/README.*
-Descriptive files: @file{README} for @code{gawk} under Unix, and the
+Descriptive files: @file{README} for @command{gawk} under Unix and the
rest for the various hardware and software combinations.
@item INSTALL
A file providing an overview of the configuration and installation process.
-@item PORTS
-A list of systems to which @code{gawk} has been ported, and which
-have successfully run the test suite.
-
-@item ACKNOWLEDGMENT
-A list of the people who contributed major parts of the code or documentation.
-
@item ChangeLog
A detailed list of source code changes as bugs are fixed or improvements made.
@item NEWS
-A list of changes to @code{gawk} since the last release or patch.
+A list of changes to @command{gawk} since the last release or patch.
@item COPYING
The GNU General Public License.
@item FUTURES
-A brief list of features and/or changes being contemplated for future
+A brief list of features and changes being contemplated for future
releases, with some indication of the time frame for the feature, based
on its difficulty.
@item LIMITATIONS
-A list of those factors that limit @code{gawk}'s performance.
+A list of those factors that limit @command{gawk}'s performance.
Most of these depend on the hardware or operating system software, and
-are not limits in @code{gawk} itself.
+are not limits in @command{gawk} itself.
@item POSIX.STD
-A description of one area where the POSIX standard for @code{awk} is
-incorrect, and how @code{gawk} handles the problem.
+A description of one area where the POSIX standard for @command{awk} is
+incorrect as well as how @command{gawk} handles the problem.
-@item PROBLEMS
-A file describing known problems with the current release.
-
-@cindex artificial intelligence, using @code{gawk}
-@cindex AI programming, using @code{gawk}
+@cindex artificial intelligence, using @command{gawk}
+@cindex AI programming, using @command{gawk}
@item doc/awkforai.txt
-A short article describing why @code{gawk} is a good language for
+A short article describing why @command{gawk} is a good language for
AI (Artificial Intelligence) programming.
@item doc/README.card
@@ -18879,25 +21684,41 @@ AI (Artificial Intelligence) programming.
@itemx doc/macros
@itemx doc/no.colors
@itemx doc/setter.outline
-The @code{troff} source for a five-color @code{awk} reference card.
-A modern version of @code{troff}, such as GNU Troff (@code{groff}) is
+The @command{troff} source for a five-color @command{awk} reference card.
+A modern version of @command{troff} such as GNU @command{troff} (@command{groff}) is
needed to produce the color version. See the file @file{README.card}
-for instructions if you have an older @code{troff}.
+for instructions if you have an older @command{troff}.
@item doc/gawk.1
-The @code{troff} source for a manual page describing @code{gawk}.
+The @command{troff} source for a manual page describing @command{gawk}.
This is distributed for the convenience of Unix users.
+@cindex Texinfo
@item doc/gawk.texi
The Texinfo source file for this @value{DOCUMENT}.
It should be processed with @TeX{} to produce a printed document, and
-with @code{makeinfo} to produce an Info file.
+with @command{makeinfo} to produce an Info or HTML file.
@item doc/gawk.info
The generated Info file for this @value{DOCUMENT}.
+@item doc/gawkinet.texi
+The Texinfo source file for
+@ifinfo
+@xref{Top}.
+@end ifinfo
+@ifnotinfo
+@cite{TCP/IP Internetworking with @command{gawk}}.
+@end ifnotinfo
+It should be processed with @TeX{} to produce a printed document and
+with @command{makeinfo} to produce an Info or HTML file.
+
+@item doc/gawkinet.info
+The generated Info file for
+@cite{TCP/IP Internetworking with @command{gawk}}.
+
@item doc/igawk.1
-The @code{troff} source for a manual page describing the @code{igawk}
+The @command{troff} source for a manual page describing the @command{igawk}
program presented in
@ref{Igawk Program, ,An Easy Way to Use Library Functions}.
@@ -18905,86 +21726,113 @@ program presented in
The input file used during the configuration process to generate the
actual @file{Makefile} for creating the documentation.
+@item Makefile.am
+@itemx */Makefile.am
+Files used by the GNU @command{automake} software for generating
+the @file{Makefile.in} files used by @command{autoconf} and
+@command{configure}.
+
@item Makefile.in
@itemx acconfig.h
+@itemx acinclude.m4
@itemx aclocal.m4
@itemx configh.in
@itemx configure.in
@itemx configure
@itemx custom.h
-@itemx missing/*
-These files and subdirectory are used when configuring @code{gawk}
-for various Unix systems. They are explained in detail in
-@ref{Unix Installation, ,Compiling and Installing @code{gawk} on Unix}.
+@itemx missing_d/*
+@itemx m4/*
+These files and subdirectories are used when configuring @command{gawk}
+for various Unix systems. They are explained in
+@ref{Unix Installation, ,Compiling and Installing @command{gawk} on Unix}.
+
+@item intl/*
+@itemx po/*
+The @file{intl} directory provides the GNU @code{gettext} library, which implements
+@command{gawk}'s internationalization features, while the @file{po} library
+contains message translations.
@item awklib/extract.awk
+@itemx awklib/Makefile.am
@itemx awklib/Makefile.in
+@itemx awklib/eg/*
The @file{awklib} directory contains a copy of @file{extract.awk}
(@pxref{Extract Program, ,Extracting Programs from Texinfo Source Files}),
which can be used to extract the sample programs from the Texinfo
-source file for this @value{DOCUMENT}, and a @file{Makefile.in} file, which
-@code{configure} uses to generate a @file{Makefile}.
-As part of the process of building @code{gawk}, the library functions from
-@ref{Library Functions, , A Library of @code{awk} Functions},
-and the @code{igawk} program from
+source file for this @value{DOCUMENT}. It also contains a @file{Makefile.in} file, which
+@command{configure} uses to generate a @file{Makefile}.
+@file{Makefile.am} is used by GNU Automake to create @file{Makefile.in}.
+The library functions from
+@ref{Library Functions, , A Library of @command{awk} Functions},
+and the @command{igawk} program from
@ref{Igawk Program, , An Easy Way to Use Library Functions},
-are extracted into ready to use files.
+are included as ready-to-use files in the @command{gawk} distribution.
They are installed as part of the installation process.
+The rest of the programs in this @value{DOCUMENT} are available in appropriate
+subdirectories of @file{awklib/eg}.
+
+@item unsupported/atari/*
+Files needed for building @command{gawk} on an Atari ST
+(@pxref{Atari Installation, ,Installing @command{gawk} on the Atari ST}, for details).
-@item atari/*
-Files needed for building @code{gawk} on an Atari ST.
-@xref{Atari Installation, ,Installing @code{gawk} on the Atari ST}, for details.
+@item unsupported/tandem/*
+Files needed for building @command{gawk} on a Tandem
+(@pxref{Tandem Installation, ,Installing @command{gawk} on a Tandem}, for details).
+
+@item posix/*
+Files needed for building @command{gawk} on POSIX-compliant systems.
@item pc/*
-Files needed for building @code{gawk} under MS-DOS and OS/2.
-@xref{PC Installation, ,MS-DOS and OS/2 Installation and Compilation}, for details.
+Files needed for building @command{gawk} under MS-DOS, MS Windows and OS/2
+(@pxref{PC Installation, ,Installation on PC Operating Systems}, for details).
@item vms/*
-Files needed for building @code{gawk} under VMS.
-@xref{VMS Installation, ,How to Compile and Install @code{gawk} on VMS}, for details.
+Files needed for building @command{gawk} under VMS
+(@pxref{VMS Installation, ,How to Compile and Install @command{gawk} on VMS}, for details).
@item test/*
A test suite for
-@code{gawk}. You can use @samp{make check} from the top level @code{gawk}
-directory to run your version of @code{gawk} against the test suite.
-If @code{gawk} successfully passes @samp{make check} then you can
+@command{gawk}. You can use @samp{make check} from the top-level @command{gawk}
+directory to run your version of @command{gawk} against the test suite.
+If @command{gawk} successfully passes @samp{make check}, then you can
be confident of a successful port.
@end table
-@node Unix Installation, VMS Installation, Gawk Distribution, Installation
-@appendixsec Compiling and Installing @code{gawk} on Unix
+@node Unix Installation, Non-Unix Installation, Gawk Distribution, Installation
+@appendixsec Compiling and Installing @command{gawk} on Unix
-Usually, you can compile and install @code{gawk} by typing only two
-commands. However, if you do use an unusual system, you may need
-to configure @code{gawk} for your system yourself.
+Usually, you can compile and install @command{gawk} by typing only two
+commands. However, if you use an unusual system, you may need
+to configure @command{gawk} for your system yourself.
@menu
-* Quick Installation:: Compiling @code{gawk} under Unix.
-* Configuration Philosophy:: How it's all supposed to work.
+* Quick Installation:: Compiling @command{gawk} under Unix.
+* Additional Configuration Options:: Other compile-time options.
+* Configuration Philosophy:: How it's all supposed to work.
@end menu
-@node Quick Installation, Configuration Philosophy, Unix Installation, Unix Installation
-@appendixsubsec Compiling @code{gawk} for Unix
+@node Quick Installation, Additional Configuration Options, Unix Installation, Unix Installation
+@appendixsubsec Compiling @command{gawk} for Unix
@cindex installation, unix
-After you have extracted the @code{gawk} distribution, @code{cd}
+After you have extracted the @command{gawk} distribution, @command{cd}
to @file{gawk-@value{VERSION}.@value{PATCHLEVEL}}. Like most GNU software,
-@code{gawk} is configured
-automatically for your Unix system by running the @code{configure} program.
-This program is a Bourne shell script that was generated automatically using
-GNU @code{autoconf}.
-@iftex
-(The @code{autoconf} software is
+@command{gawk} is configured
+automatically for your Unix system by running the @command{configure} program.
+This program is a Bourne shell script that is generated automatically using
+GNU @command{autoconf}.
+@ifnotinfo
+(The @command{autoconf} software is
described fully in
@cite{Autoconf---Generating Automatic Configuration Scripts},
which is available from the Free Software Foundation.)
-@end iftex
+@end ifnotinfo
@ifinfo
-(The @code{autoconf} software is described fully starting with
-@ref{Top, , Introduction, autoconf, Autoconf---Generating Automatic Configuration Scripts}.)
+(The @command{autoconf} software is described fully starting with
+@ref{Top}.)
@end ifinfo
-To configure @code{gawk}, simply run @code{configure}:
+To configure @command{gawk}, simply run @command{configure}:
@example
sh ./configure
@@ -18992,24 +21840,24 @@ sh ./configure
This produces a @file{Makefile} and @file{config.h} tailored to your system.
The @file{config.h} file describes various facts about your system.
-You may wish to edit the @file{Makefile} to
+You might want to edit the @file{Makefile} to
change the @code{CFLAGS} variable, which controls
-the command line options that are passed to the C compiler (such as
-optimization levels, or compiling for debugging).
+the command-line options that are passed to the C compiler (such as
+optimization levels or compiling for debugging).
-Alternatively, you can add your own values for most @code{make}
-variables, such as @code{CC} and @code{CFLAGS}, on the command line when
-running @code{configure}:
+Alternatively, you can add your own values for most @command{make}
+variables on the command line, such as @code{CC} and @code{CFLAGS}, when
+running @command{configure}:
@example
CC=cc CFLAGS=-g sh ./configure
@end example
@noindent
-See the file @file{INSTALL} in the @code{gawk} distribution for
+See the file @file{INSTALL} in the @command{gawk} distribution for
all the details.
-After you have run @code{configure}, and possibly edited the @file{Makefile},
+After you have run @command{configure} and possibly edited the @file{Makefile},
type:
@example
@@ -19017,91 +21865,406 @@ make
@end example
@noindent
-and shortly thereafter, you should have an executable version of @code{gawk}.
+Shortly thereafter, you should have an executable version of @command{gawk}.
That's all there is to it!
-(If these steps do not work, please send in a bug report;
-@pxref{Bugs, ,Reporting Problems and Bugs}.)
+To verify that @command{gawk} is working properly,
+run @samp{make check}. All of the tests should succeed.
+If these steps do not work, or if any of the tests fail,
+check the files in the @file{README_d} directory to see if you've
+found a known problem. If the failure is not described there,
+please send in a bug report
+(@pxref{Bugs, ,Reporting Problems and Bugs}.)
+
+@node Additional Configuration Options, Configuration Philosophy, Quick Installation, Unix Installation
+@appendixsubsec Additional Configuration Options
-@node Configuration Philosophy, , Quick Installation, Unix Installation
+There are several additional options you may use on the @command{configure}
+command line when compiling @command{gawk} from scratch.
+
+@table @code
+@cindex @code{--enable-portals} configuration option
+@cindex configuration option, @code{--enable-portals}
+@item --enable-portals
+This option causes @command{gawk} to treat pathnames that begin
+with @file{/p} as BSD portal files when doing two-way I/O with
+the @samp{|&} operator
+(@pxref{Portal Files, , Using @command{gawk} with BSD Portals}).
+
+@cindex Linux
+@cindex GNU/Linux
+@cindex @code{--with-included-gettext} configuration option
+@cindex configuration option, @code{--with-included-gettext}
+@item --with-included-gettext
+Use the version of the @code{gettext} library that comes with @command{gawk}.
+This option should be used on systems that do @emph{not} use @value{PVERSION} 2 (or later)
+of the GNU C library.
+All known modern GNU/Linux systems use Glibc 2. Use this option on any other system.
+
+@cindex @code{--disable-nls} configuration option
+@cindex configuration option, @code{--disable-nls}
+@item --disable-nls
+Disable all message translation facilities.
+This is usually not desirable, but it may bring you some slight performance
+improvement.
+You should also use this option if @option{--with-included-gettext}
+doesn't work on your system.
+@end table
+
+@node Configuration Philosophy, , Additional Configuration Options, Unix Installation
@appendixsubsec The Configuration Process
-@cindex configuring @code{gawk}
-(This section is of interest only if you know something about using the
-C language and the Unix operating system.)
+@cindex configuring @command{gawk}
+This @value{SECTION} is of interest only if you know something about using the
+C language and the Unix operating system.
-The source code for @code{gawk} generally attempts to adhere to formal
-standards wherever possible. This means that @code{gawk} uses library
-routines that are specified by the ANSI C standard and by the POSIX
-operating system interface standard. When using an ANSI C compiler,
+The source code for @command{gawk} generally attempts to adhere to formal
+standards wherever possible. This means that @command{gawk} uses library
+routines that are specified by the ISO C standard and by the POSIX
+operating system interface standard. When using an ISO C compiler,
function prototypes are used to help improve the compile-time checking.
-Many Unix systems do not support all of either the ANSI or the
-POSIX standards. The @file{missing} subdirectory in the @code{gawk}
-distribution contains replacement versions of those subroutines that are
+Many Unix systems do not support all of either the ISO or the
+POSIX standards. The @file{missing_d} subdirectory in the @command{gawk}
+distribution contains replacement versions of those functions that are
most likely to be missing.
-The @file{config.h} file that is created by the @code{configure} program
-contains definitions that describe features of the particular operating
-system where you are attempting to compile @code{gawk}. The three things
-described by this file are what header files are available, so that
-they can be correctly included,
-what (supposedly) standard functions are actually available in your C
-libraries, and
-other miscellaneous facts about your
-variant of Unix. For example, there may not be an @code{st_blksize}
-element in the @code{stat} structure. In this case @samp{HAVE_ST_BLKSIZE}
-would be undefined.
+The @file{config.h} file that @command{configure} creates contains
+definitions that describe features of the particular operating system
+where you are attempting to compile @command{gawk}. The three things
+described by this file are: what header files are available, so that
+they can be correctly included, what (supposedly) standard functions
+are actually available in your C libraries, and various miscellaneous
+facts about your variant of Unix. For example, there may not be an
+@code{st_blksize} element in the @code{stat} structure. In this case,
+@samp{HAVE_ST_BLKSIZE} is undefined.
@cindex @code{custom.h} configuration file
-It is possible for your C compiler to lie to @code{configure}. It may
+It is possible for your C compiler to lie to @command{configure}. It may
do so by not exiting with an error when a library function is not
-available. To get around this, you can edit the file @file{custom.h}.
+available. To get around this, edit the file @file{custom.h}.
Use an @samp{#ifdef} that is appropriate for your system, and either
-@code{#define} any constants that @code{configure} should have defined but
-didn't, or @code{#undef} any constants that @code{configure} defined and
+@code{#define} any constants that @command{configure} should have defined but
+didn't, or @code{#undef} any constants that @command{configure} defined and
should not have. @file{custom.h} is automatically included by
@file{config.h}.
-It is also possible that the @code{configure} program generated by
-@code{autoconf}
-will not work on your system in some other fashion. If you do have a problem,
-the file
-@file{configure.in} is the input for @code{autoconf}. You may be able to
-change this file, and generate a new version of @code{configure} that will
-work on your system. @xref{Bugs, ,Reporting Problems and Bugs}, for
-information on how to report problems in configuring @code{gawk}. The same
-mechanism may be used to send in updates to @file{configure.in} and/or
-@file{custom.h}.
+It is also possible that the @command{configure} program generated by
+@command{autoconf} will not work on your system in some other fashion.
+If you do have a problem, the file @file{configure.in} is the input for
+@command{autoconf}. You may be able to change this file and generate a
+new version of @command{configure} that works on your system
+(@pxref{Bugs, ,Reporting Problems and Bugs},
+for information on how to report problems in configuring @command{gawk}).
+The same mechanism may be used to send in updates to @file{configure.in}
+and/or @file{custom.h}.
+
+@node Non-Unix Installation, Unsupported, Unix Installation, Installation
+@appendixsec Installation on Other Operating Systems
+
+This @value{SECTION} describes how to install @command{gawk} on
+various non-Unix systems.
+
+@menu
+* Amiga Installation:: Installing @command{gawk} on an Amiga.
+* BeOS Installation:: Installing @command{gawk} on BeOS.
+* PC Installation:: Installing and Compiling @command{gawk} on
+ MS-DOS and OS/2.
+* VMS Installation:: Installing @command{gawk} on VMS.
+@end menu
+
+@node Amiga Installation, BeOS Installation, Non-Unix Installation, Non-Unix Installation
+@appendixsubsec Installing @command{gawk} on an Amiga
+
+@cindex amiga
+@cindex installation, amiga
+You can install @command{gawk} on an Amiga system using a Unix emulation
+environment, available via anonymous @command{ftp} from
+@code{ftp.ninemoons.com} in the directory @file{pub/ade/current}.
+This includes a shell based on @command{pdksh}. The primary component of
+this environment is a Unix emulation library, @file{ixemul.lib}.
+@c could really use more background here, who wrote this, etc.
+
+A more complete distribution for the Amiga is available on
+the Geek Gadgets CD-ROM, available from:
-@node VMS Installation, PC Installation, Unix Installation, Installation
-@appendixsec How to Compile and Install @code{gawk} on VMS
+@display
+CRONUS
+1840 E. Warner Road #105-265
+Tempe, AZ 85284 USA
+US Toll Free: (800) 804-0833
+Phone: +1-602-491-0442
+FAX: +1-602-491-0048
+Email: @email{info@@ninemoons.com}
+WWW: @uref{http://www.ninemoons.com}
+Anonymous @command{ftp} site: @code{ftp.ninemoons.com}
+@end display
+
+Once you have the distribution, you can configure @command{gawk} simply by
+running @command{configure}:
+
+@example
+configure -v m68k-amigaos
+@end example
+
+Then run @command{make} and you should be all set!
+If these steps do not work, please send in a bug report
+(@pxref{Bugs, ,Reporting Problems and Bugs}).
+
+@node BeOS Installation, PC Installation, Amiga Installation, Non-Unix Installation
+@appendixsubsec Installing @command{gawk} on BeOS
+@cindex BeOS
+@cindex installation, beos
+
+@c From email contributed by Martin Brown, mc@whoever.com
+Since BeOS DR9, all the tools that you should need to build @code{gawk} are
+included with BeOS. The process is basically identical to the Unix process
+of running @command{configure} and then @command{make}. Full instructions are given below.
+
+You can compile @command{gawk} under BeOS by extracting the standard sources
+and running @command{configure}. You @emph{must} specify the location
+prefix for the installation directory. For BeOS DR9 and beyond, the best directory to
+use is @file{/boot/home/config}, so the @command{configure} command is:
+
+@example
+configure --prefix=/boot/home/config
+@end example
+
+This installs the compiled application into @file{/boot/home/config/bin},
+which is already specified in the standard @env{PATH}.
+
+Once the configuration process is completed, you can run @command{make},
+and then @samp{make install}:
+
+@example
+$ make
+@dots{}
+$ make install
+@end example
+
+BeOS uses @command{bash} as its shell; thus, you use @command{gawk} the same way you would
+under Unix.
+If these steps do not work, please send in a bug report
+(@pxref{Bugs, ,Reporting Problems and Bugs}).
+
+@c Rewritten by Scott Deifik <scottd@amgen.com>
+@c and Darrel Hankerson <hankedr@mail.auburn.edu>
+
+@node PC Installation, VMS Installation, BeOS Installation, Non-Unix Installation
+@appendixsubsec Installation on PC Operating Systems
+
+@cindex installation, pc operating systems
+This @value{SECTION} covers installation and usage of @command{gawk} on x86 machines
+running DOS, any version of Windows, or OS/2.
+In this @value{SECTION}, the term ``Win32''
+refers to any of Windows-95/98/ME/NT/2000.
+
+The limitations of DOS (and DOS shells under Windows or OS/2) has meant
+that various ``DOS extenders'' are often used with programs such as
+@command{gawk}. The varying capabilities of Microsoft Windows 3.1
+and Win32 can add to the confusion. For an overview of the
+considerations, please refer to @file{README_d/README.pc} in the
+distribution.
+
+@menu
+* PC Binary Installation:: Installing a prepared distribution.
+* PC Compiling:: Compiling @command{gawk} for MS-DOS, Win32,
+ and OS/2.
+* PC Using:: Running @command{gawk} on MS-DOS, Win32 and
+ OS/2.
+@end menu
+
+@node PC Binary Installation, PC Compiling, PC Installation, PC Installation
+@appendixsubsubsec Installing a Prepared Distribution for PC Systems
+
+If you have received a binary distribution prepared by the DOS
+maintainers, then @command{gawk} and the necessary support files appear
+under the @file{gnu} directory, with executables in @file{gnu/bin},
+libraries in @file{gnu/lib/awk}, and manual pages under @file{gnu/man}.
+This is designed for easy installation to a @file{/gnu} directory on your
+drive---however, the files can be installed anywhere provided @env{AWKPATH} is
+set properly. Regardless of the installation directory, the first line of
+@file{igawk.cmd} and @file{igawk.bat} (in @file{gnu/bin}) may need to be
+edited.
+
+The binary distribution contains a separate file describing the
+contents. In particular, it may include more than one version of the
+@command{gawk} executable. OS/2 binary distributions may have a
+different arrangement, but installation is similar.
+
+@node PC Compiling, PC Using, PC Binary Installation, PC Installation
+@appendixsubsubsec Compiling @command{gawk} for PC Operating Systems
+
+@command{gawk} can be compiled for MS-DOS, Win32, and OS/2 using the GNU
+development tools from DJ Delorie (DJGPP; MS-DOS only) or Eberhard
+Mattes (EMX; MS-DOS, Win32 and OS/2). Microsoft Visual C/C++ can be used
+to build a Win32 version, and Microsoft C/C++ can be
+used to build 16-bit versions for MS-DOS and OS/2. The file
+@file{README_d/README.pc} in the @command{gawk} distribution contains
+additional notes, and @file{pc/Makefile} contains important information on
+compilation options.
+
+To build @command{gawk}, copy the files in the @file{pc} directory
+(@emph{except} for @file{ChangeLog}) to the directory with the rest of
+the @command{gawk} sources. The @file{Makefile} contains a configuration
+section with comments and may need to be edited in order to work with
+your @command{make} utility.
+
+The @file{Makefile} contains a number of targets for building various MS-DOS,
+Win32, and OS/2 versions. A list of targets is printed if the @command{make}
+command is given without a target. As an example, to build @command{gawk}
+using the DJGPP tools, enter @samp{make djgpp}.
+
+Using @command{make} to run the standard tests and to install @command{gawk}
+requires additional Unix-like tools, including @command{sh}, @command{sed}, and
+@command{cp}. In order to run the tests, the @file{test/*.ok} files may need to
+be converted so that they have the usual DOS-style end-of-line markers. Most
+of the tests work properly with Stewartson's shell along with the
+companion utilities or appropriate GNU utilities. However, some editing of
+@file{test/Makefile} is required. It is recommended that you copy the file
+@file{pc/Makefile.tst} over the file @file{test/Makefile} as a
+replacement. Details can be found in @file{README_d/README.pc}
+and in the file @file{pc/Makefile.tst}.
+
+@node PC Using, , PC Compiling, PC Installation
+@appendixsubsubsec Using @command{gawk} on PC Operating Systems
+
+@cindex search path
+@cindex directory search
+@cindex path, search
+@cindex search path, for source files
+The OS/2 and MS-DOS versions of @command{gawk} search for program files as
+described in @ref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}.
+However, semicolons (rather than colons) separate elements
+in the @env{AWKPATH} variable. If @env{AWKPATH} is not set or is empty,
+then the default search path is @code{@w{".;c:/lib/awk;c:/gnu/lib/awk"}}.
+
+An @command{sh}-like shell (as opposed to @command{command.com} under MS-DOS
+or @command{cmd.exe} under OS/2) may be useful for @command{awk} programming.
+Ian Stewartson has written an excellent shell for MS-DOS and OS/2,
+Daisuke Aoyama has ported GNU @command{bash} to MS-DOS using the DJGPP tools,
+and several shells are available for OS/2, including @command{ksh}. The file
+@file{README_d/README.pc} in the @command{gawk} distribution contains
+information on these shells. Users of Stewartson's shell on DOS should
+examine its documentation for handling command lines; in particular,
+the setting for @command{gawk} in the shell configuration may need to be
+changed and the @code{ignoretype} option may also be of interest.
+
+@cindex @code{BINMODE} variable
+Under OS/2 and DOS, @command{gawk} (and many other text programs) silently
+translate end-of-line @code{"\r\n"} to @code{"\n"} on input and @code{"\n"}
+to @code{"\r\n"} on output. A special @code{BINMODE} variable allows
+control over these translations and is interpreted as follows.
+
+@itemize @bullet
+@item
+If @code{BINMODE} is @samp{"r"}, or
+@code{(BINMODE & 1)} is nonzero, then
+binary mode is set on read (i.e., no translations on reads).
+
+@item
+If @code{BINMODE} is @code{"w"}, or
+@code{(BINMODE & 2)} is nonzero, then
+binary mode is set on write (i.e., no translations on writes).
+
+@item
+If @code{BINMODE} is @code{"rw"} or @code{"wr"},
+binary mode is set for both read and write
+(same as @code{(BINMODE & 3)}).
+
+@item
+@code{BINMODE=@var{non-null-string}} is
+the same as @samp{BINMODE=3} (i.e., no translations on
+reads or writes). However, @command{gawk} issues a warning
+message if the string is not one of @code{"rw"} or @code{"wr"}.
+@end itemize
+
+@noindent
+The modes for standard input and standard output are set one time
+only (after the
+command line is read, but before processing any of the @command{awk} program).
+Setting @code{BINMODE} for standard input or
+standard output is accomplished by using an
+appropriate @samp{-v BINMODE=@var{N}} option on the command line.
+@code{BINMODE} is set at the time a file or pipe is opened and cannot be
+changed mid-stream.
+
+The name @code{BINMODE} was chosen to match @command{mawk}
+(@pxref{Other Versions, , Other Freely Available @command{awk} Implementations}).
+Both @command{mawk} and @command{gawk} handle @code{BINMODE} similarly; however,
+@command{mawk} adds a @samp{-W BINMODE=@var{N}} option and an environment
+variable that can set @code{BINMODE}, @code{RS}, and @code{ORS}. The
+files @file{binmode[1-3].awk} (under @file{gnu/lib/awk} in some of the
+prepared distributions) have been chosen to match @command{mawk}'s @samp{-W
+BINMODE=@var{N}} option. These can be changed or discarded; in particular,
+the setting of @code{RS} giving the fewest ``surprises'' is open to debate.
+@command{mawk} uses @samp{RS = "\r\n"} if binary mode is set on read, which is
+appropriate for files with the DOS-style end-of-line.
+
+To Illustrate, the following examples set binary mode on writes for standard
+output and other files, and set @code{ORS} as the ``usual'' DOS-style
+end-of-line:
+
+@example
+gawk -v BINMODE=2 -v ORS="\r\n" @dots{}
+@end example
+
+@noindent
+or:
+
+@example
+gawk -v BINMODE=w -f binmode2.awk @dots{}
+@end example
+
+@noindent
+These give the same result as the @samp{-W BINMODE=2} option in
+@command{mawk}.
+The following changes the record separator to @code{"\r\n"} and sets binary
+mode on reads, but does not affect the mode on standard input:
+
+@example
+gawk -v RS="\r\n" --source "BEGIN @{ BINMODE = 1 @}" @dots{}
+@end example
+
+@noindent
+or:
+
+@example
+gawk -f binmode1.awk @dots{}
+@end example
+
+@noindent
+With proper quoting, in the first example the setting of @code{RS} can be
+moved into the @code{BEGIN} rule.
+
+@node VMS Installation, , PC Installation, Non-Unix Installation
+@appendixsubsec How to Compile and Install @command{gawk} on VMS
@c based on material from Pat Rankin <rankin@eql.caltech.edu>
@cindex installation, vms
-This section describes how to compile and install @code{gawk} under VMS.
+This @value{SUBSECTION} describes how to compile and install @command{gawk} under VMS.
@menu
-* VMS Compilation:: How to compile @code{gawk} under VMS.
-* VMS Installation Details:: How to install @code{gawk} under VMS.
-* VMS Running:: How to run @code{gawk} under VMS.
+* VMS Compilation:: How to compile @command{gawk} under VMS.
+* VMS Installation Details:: How to install @command{gawk} under VMS.
+* VMS Running:: How to run @command{gawk} under VMS.
* VMS POSIX:: Alternate instructions for VMS POSIX.
@end menu
@node VMS Compilation, VMS Installation Details, VMS Installation, VMS Installation
-@appendixsubsec Compiling @code{gawk} on VMS
+@appendixsubsubsec Compiling @command{gawk} on VMS
-To compile @code{gawk} under VMS, there is a @code{DCL} command procedure that
-will issue all the necessary @code{CC} and @code{LINK} commands, and there is
+To compile @command{gawk} under VMS, there is a @code{DCL} command procedure that
+issues all the necessary @code{CC} and @code{LINK} commands. There is
also a @file{Makefile} for use with the @code{MMS} utility. From the source
-directory, use either
+directory, use either:
@example
$ @@[.VMS]VMSBUILD.COM
@end example
@noindent
-or
+or:
@example
$ MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK
@@ -19125,21 +22288,21 @@ and comment out or delete the two lines @samp{#define __STDC__ 0} and
@item GNU C
Edit @file{vmsbuild.com} or @file{descrip.mms}; the changes are different
-from those for VAX C V2.x, but equally straightforward. No changes to
-@file{config.h} should be needed.
+from those for VAX C V2.x but equally straightforward. No changes to
+@file{config.h} are needed.
@item DEC C
Edit @file{vmsbuild.com} or @file{descrip.mms} according to their comments.
-No changes to @file{config.h} should be needed.
+No changes to @file{config.h} are needed.
@end table
-@code{gawk} has been tested under VAX/VMS 5.5-1 using VAX C V3.2,
+@command{gawk} has been tested under VAX/VMS 5.5-1 using VAX C V3.2, and
GNU C 1.40 and 2.3. It should work without modifications for VMS V4.6 and up.
@node VMS Installation Details, VMS Running, VMS Compilation, VMS Installation
-@appendixsubsec Installing @code{gawk} on VMS
+@appendixsubsubsec Installing @command{gawk} on VMS
-To install @code{gawk}, all you need is a ``foreign'' command, which is
+To install @command{gawk}, all you need is a ``foreign'' command, which is
a @code{DCL} symbol whose value begins with a dollar sign. For example:
@example
@@ -19147,13 +22310,13 @@ $ GAWK :== $disk1:[gnubin]GAWK
@end example
@noindent
-(Substitute the actual location of @code{gawk.exe} for
-@samp{$disk1:[gnubin]}.) The symbol should be placed in the
-@file{login.com} of any user who wishes to run @code{gawk},
-so that it will be defined every time the user logs on.
+Substitute the actual location of @command{gawk.exe} for
+@samp{$disk1:[gnubin]}. The symbol should be placed in the
+@file{login.com} of any user who wants to run @command{gawk},
+so that it is defined every time the user logs on.
Alternatively, the symbol may be placed in the system-wide
-@file{sylogin.com} procedure, which will allow all users
-to run @code{gawk}.
+@file{sylogin.com} procedure, which allows all users
+to run @command{gawk}.
Optionally, the help entry can be loaded into a VMS help library:
@@ -19164,31 +22327,32 @@ $ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP
@noindent
(You may want to substitute a site-specific help library rather than
the standard VMS library @samp{HELPLIB}.) After loading the help text,
+the command:
@example
$ HELP GAWK
@end example
@noindent
-will provide information about both the @code{gawk} implementation and the
-@code{awk} programming language.
+provides information about both the @command{gawk} implementation and the
+@command{awk} programming language.
The logical name @samp{AWK_LIBRARY} can designate a default location
-for @code{awk} program files. For the @samp{-f} option, if the specified
-filename has no device or directory path information in it, @code{gawk}
-will look in the current directory first, then in the directory specified
-by the translation of @samp{AWK_LIBRARY} if the file was not found.
-If after searching in both directories, the file still is not found,
-then @code{gawk} appends the suffix @samp{.awk} to the filename and the
-file search will be re-tried. If @samp{AWK_LIBRARY} is not defined, that
-portion of the file search will fail benignly.
+for @command{awk} program files. For the @option{-f} option, if the specified
+@value{FN} has no device or directory path information in it, @command{gawk}
+looks in the current directory first, then in the directory specified
+by the translation of @samp{AWK_LIBRARY} if the file is not found.
+If, after searching in both directories, the file still is not found,
+@command{gawk} appends the suffix @samp{.awk} to the filename and retries
+the file search. If @samp{AWK_LIBRARY} is not defined, that
+portion of the file search fails benignly.
@node VMS Running, VMS POSIX, VMS Installation Details, VMS Installation
-@appendixsubsec Running @code{gawk} on VMS
+@appendixsubsubsec Running @command{gawk} on VMS
-Command line parsing and quoting conventions are significantly different
+Command-line parsing and quoting conventions are significantly different
on VMS, so examples in this @value{DOCUMENT} or from other sources often need minor
-changes. They @emph{are} minor though, and all @code{awk} programs
+changes. They @emph{are} minor though, and all @command{awk} programs
should run correctly.
Here are a couple of trivial tests:
@@ -19200,284 +22364,246 @@ $ gawk -"W" version
@end example
@noindent
-Note that upper-case and mixed-case text must be quoted.
+Note that uppercase and mixed-case text must be quoted.
-The VMS port of @code{gawk} includes a @code{DCL}-style interface in addition
+The VMS port of @command{gawk} includes a @code{DCL}-style interface in addition
to the original shell-style interface (see the help entry for details).
-One side-effect of dual command line parsing is that if there is only a
+One side effect of dual command-line parsing is that if there is only a
single parameter (as in the quoted string program above), the command
-becomes ambiguous. To work around this, the normally optional @samp{--}
+becomes ambiguous. To work around this, the normally optional @option{--}
flag is required to force Unix style rather than @code{DCL} parsing. If any
-other dash-type options (or multiple parameters such as data files to be
-processed) are present, there is no ambiguity and @samp{--} can be omitted.
+other dash-type options (or multiple parameters such as @value{DF}s to
+process) are present, there is no ambiguity and @option{--} can be omitted.
-The default search path when looking for @code{awk} program files specified
-by the @samp{-f} option is @code{"SYS$DISK:[],AWK_LIBRARY:"}. The logical
+@cindex search path
+@cindex directory search
+@cindex path, search
+@cindex search path, for source files
+The default search path, when looking for @command{awk} program files specified
+by the @option{-f} option, is @code{"SYS$DISK:[],AWK_LIBRARY:"}. The logical
name @samp{AWKPATH} can be used to override this default. The format
of @samp{AWKPATH} is a comma-separated list of directory specifications.
When defining it, the value should be quoted so that it retains a single
-translation, and not a multi-translation @code{RMS} searchlist.
+translation and not a multitranslation @code{RMS} searchlist.
-@node VMS POSIX, , VMS Running, VMS Installation
-@appendixsubsec Building and Using @code{gawk} on VMS POSIX
+@node VMS POSIX, , VMS Running, VMS Installation
+@appendixsubsubsec Building and Using @command{gawk} on VMS POSIX
Ignore the instructions above, although @file{vms/gawk.hlp} should still
be made available in a help library. The source tree should be unpacked
-into a container file subsystem rather than into the ordinary VMS file
-system. Make sure that the two scripts, @file{configure} and
+into a container file subsystem rather than into the ordinary VMS filesystem.
+Make sure that the two scripts, @file{configure} and
@file{vms/posix-cc.sh}, are executable; use @samp{chmod +x} on them if
necessary. Then execute the following two commands:
@example
-@group
psx> CC=vms/posix-cc.sh configure
psx> make CC=c89 gawk
-@end group
@end example
@noindent
-The first command will construct files @file{config.h} and @file{Makefile} out
-of templates, using a script to make the C compiler fit @code{configure}'s
-expectations. The second command will compile and link @code{gawk} using
-the C compiler directly; ignore any warnings from @code{make} about being
-unable to redefine @code{CC}. @code{configure} will take a very long
-time to execute, but at least it provides incremental feedback as it
-runs.
+The first command constructs files @file{config.h} and @file{Makefile} out
+of templates, using a script to make the C compiler fit @command{configure}'s
+expectations. The second command compiles and links @command{gawk} using
+the C compiler directly; ignore any warnings from @command{make} about being
+unable to redefine @code{CC}. @command{configure} takes a very long
+time to execute, but at least it provides incremental feedback as it runs.
This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C V5.2.
-Once built, @code{gawk} will work like any other shell utility. Unlike
-the normal VMS port of @code{gawk}, no special command line manipulation is
+Once built, @command{gawk} works like any other shell utility. Unlike
+the normal VMS port of @command{gawk}, no special command-line manipulation is
needed in the VMS POSIX environment.
-@c Rewritten by Scott Deifik <scottd@amgen.com>
-@c and Darrel Hankerson <hankedr@mail.auburn.edu>
-@node PC Installation, Atari Installation, VMS Installation, Installation
-@appendixsec MS-DOS and OS/2 Installation and Compilation
+@node Unsupported, Bugs, Non-Unix Installation, Installation
+@appendixsec Unsupported Operating System Ports
-@cindex installation, MS-DOS and OS/2
-If you have received a binary distribution prepared by the DOS
-maintainers, then @code{gawk} and the necessary support files will appear
-under the @file{gnu} directory, with executables in @file{gnu/bin},
-libraries in @file{gnu/lib/awk}, and manual pages under @file{gnu/man}.
-This is designed for easy installation to a @file{/gnu} directory on your
-drive, but the files can be installed anywhere provided @code{AWKPATH} is
-set properly. Regardless of the installation directory, the first line of
-@file{igawk.cmd} and @file{igawk.bat} (in @file{gnu/bin}) may need to be
-edited.
+This sections describes systems for which
+the @command{gawk} port is no longer supported.
-The binary distribution will contain a separate file describing the
-contents. In particular, it may include more than one version of the
-@code{gawk} executable. OS/2 binary distributions may have a
-different arrangement, but installation is similar.
-
-The OS/2 and MS-DOS versions of @code{gawk} search for program files as
-described in @ref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}.
-However, semicolons (rather than colons) separate elements
-in the @code{AWKPATH} variable. If @code{AWKPATH} is not set or is empty,
-then the default search path is @code{@w{".;c:/lib/awk;c:/gnu/lib/awk"}}.
+@menu
+* Atari Installation:: Installing @command{gawk} on the Atari ST.
+* Tandem Installation:: Installing @command{gawk} on a Tandem.
+@end menu
-An @code{sh}-like shell (as opposed to @code{command.com} under MS-DOS
-or @code{cmd.exe} under OS/2) may be useful for @code{awk} programming.
-Ian Stewartson has written an excellent shell for MS-DOS and OS/2, and a
-@code{ksh} clone and GNU Bash are available for OS/2. The file
-@file{README_d/README.pc} in the @code{gawk} distribution contains
-information on these shells. Users of Stewartson's shell on DOS should
-examine its documentation on handling of command-lines. In particular,
-the setting for @code{gawk} in the shell configuration may need to be
-changed, and the @code{ignoretype} option may also be of interest.
-
-@code{gawk} can be compiled for MS-DOS and OS/2 using the GNU development tools
-from DJ Delorie (DJGPP, MS-DOS-only) or Eberhard Mattes (EMX, MS-DOS and OS/2).
-Microsoft C can be used to build 16-bit versions for MS-DOS and OS/2. The file
-@file{README_d/README.pc} in the @code{gawk} distribution contains additional
-notes, and @file{pc/Makefile} contains important notes on compilation options.
-
-To build @code{gawk}, copy the files in the @file{pc} directory (@emph{except}
-for @file{ChangeLog}) to the
-directory with the rest of the @code{gawk} sources. The @file{Makefile}
-contains a configuration section with comments, and may need to be
-edited in order to work with your @code{make} utility.
-
-The @file{Makefile} contains a number of targets for building various MS-DOS
-and OS/2 versions. A list of targets will be printed if the @code{make}
-command is given without a target. As an example, to build @code{gawk}
-using the DJGPP tools, enter @samp{make djgpp}.
+@node Atari Installation, Tandem Installation, Unsupported, Unsupported
+@appendixsubsec Installing @command{gawk} on the Atari ST
-Using @code{make} to run the standard tests and to install @code{gawk}
-requires additional Unix-like tools, including @code{sh}, @code{sed}, and
-@code{cp}. In order to run the tests, the @file{test/*.ok} files may need to
-be converted so that they have the usual DOS-style end-of-line markers. Most
-of the tests will work properly with Stewartson's shell along with the
-companion utilities or appropriate GNU utilities. However, some editing of
-@file{test/Makefile} is required. It is recommended that the file
-@file{pc/Makefile.tst} be copied to @file{test/Makefile} as a
-replacement. Details can be found in @file{README_d/README.pc}.
-
-@node Atari Installation, Amiga Installation, PC Installation, Installation
-@appendixsec Installing @code{gawk} on the Atari ST
+The Atari port is no longer supported. It is
+included for those who might want to use it but it is no longer being
+actively maintained.
@c based on material from Michal Jaegermann <michal@gortel.phys.ualberta.ca>
-
@cindex atari
@cindex installation, atari
-There are no substantial differences when installing @code{gawk} on
-various Atari models. Compiled @code{gawk} executables do not require
-a large amount of memory with most @code{awk} programs and should run on all
-Motorola processor based models (called further ST, even if that is not
+There are no substantial differences when installing @command{gawk} on
+various Atari models. Compiled @command{gawk} executables do not require
+a large amount of memory with most @command{awk} programs, and should run on all
+Motorola processor-based models (called further ST, even if that is not
exactly right).
-In order to use @code{gawk}, you need to have a shell, either text or
+In order to use @command{gawk}, you need to have a shell, either text or
graphics, that does not map all the characters of a command line to
-upper-case. Maintaining case distinction in option flags is very
-important (@pxref{Options, ,Command Line Options}).
-These days this is the default, and it may only be a problem for some
+uppercase. Maintaining case distinction in option flags is very
+important (@pxref{Options, ,Command-Line Options}).
+These days this is the default and it may only be a problem for some
very old machines. If your system does not preserve the case of option
-flags, you will need to upgrade your tools. Support for I/O
-redirection is necessary to make it easy to import @code{awk} programs
-from other environments. Pipes are nice to have, but not vital.
+flags, you need to upgrade your tools. Support for I/O
+redirection is necessary to make it easy to import @command{awk} programs
+from other environments. Pipes are nice to have but not vital.
@menu
-* Atari Compiling:: Compiling @code{gawk} on Atari
-* Atari Using:: Running @code{gawk} on Atari
+* Atari Compiling:: Compiling @command{gawk} on Atari.
+* Atari Using:: Running @command{gawk} on Atari.
@end menu
@node Atari Compiling, Atari Using, Atari Installation, Atari Installation
-@appendixsubsec Compiling @code{gawk} on the Atari ST
+@appendixsubsubsec Compiling @command{gawk} on the Atari ST
-A proper compilation of @code{gawk} sources when @code{sizeof(int)}
-differs from @code{sizeof(void *)} requires an ANSI C compiler. An initial
-port was done with @code{gcc}. You may actually prefer executables
-where @code{int}s are four bytes wide, but the other variant works as well.
+A proper compilation of @command{gawk} sources when @code{sizeof(int)}
+differs from @code{sizeof(void *)} requires an ISO C compiler. An initial
+port was done with @command{gcc}. You may actually prefer executables
+where @code{int}s are four bytes wide but the other variant works as well.
-You may need quite a bit of memory when trying to recompile the @code{gawk}
+You may need quite a bit of memory when trying to recompile the @command{gawk}
sources, as some source files (@file{regex.c} in particular) are quite
big. If you run out of memory compiling such a file, try reducing the
-optimization level for this particular file; this may help.
+optimization level for this particular file, which may help.
@cindex Linux
-With a reasonable shell (Bash will do), and in particular if you run
-Linux, MiNT or a similar operating system, you have a pretty good
-chance that the @code{configure} utility will succeed. Otherwise
+@cindex GNU/Linux
+With a reasonable shell (@command{bash} will do), you have a pretty good chance
+that the @command{configure} utility will succeed, and in particular if
+you run GNU/Linux, MiNT or a similar operating system. Otherwise
sample versions of @file{config.h} and @file{Makefile.st} are given in the
@file{atari} subdirectory and can be edited and copied to the
corresponding files in the main source directory. Even if
-@code{configure} produced something, it might be advisable to compare
+@command{configure} produces something, it might be advisable to compare
its results with the sample versions and possibly make adjustments.
-Some @code{gawk} source code fragments depend on a preprocessor define
-@samp{atarist}. This basically assumes the TOS environment with @code{gcc}.
+Some @command{gawk} source code fragments depend on a preprocessor define
+@samp{atarist}. This basically assumes the TOS environment with @command{gcc}.
Modify these sections as appropriate if they are not right for your
-environment. Also see the remarks about @code{AWKPATH} and @code{envsep} in
-@ref{Atari Using, ,Running @code{gawk} on the Atari ST}.
+environment. Also see the remarks about @env{AWKPATH} and @code{envsep} in
+@ref{Atari Using, ,Running @command{gawk} on the Atari ST}.
As shipped, the sample @file{config.h} claims that the @code{system}
function is missing from the libraries, which is not true, and an
alternative implementation of this function is provided in
-@file{atari/system.c}. Depending upon your particular combination of
-shell and operating system, you may wish to change the file to indicate
+@file{unsupported/atari/system.c}.
+Depending upon your particular combination of
+shell and operating system, you might want to change the file to indicate
that @code{system} is available.
@node Atari Using, , Atari Compiling, Atari Installation
-@appendixsubsec Running @code{gawk} on the Atari ST
+@appendixsubsubsec Running @command{gawk} on the Atari ST
-An executable version of @code{gawk} should be placed, as usual,
-anywhere in your @code{PATH} where your shell can find it.
+An executable version of @command{gawk} should be placed, as usual,
+anywhere in your @env{PATH} where your shell can find it.
-While executing, @code{gawk} creates a number of temporary files. When
-using @code{gcc} libraries for TOS, @code{gawk} looks for either of
-the environment variables @code{TEMP} or @code{TMPDIR}, in that order.
+While executing, the Atari version of @command{gawk} creates a number of temporary files. When
+using @command{gcc} libraries for TOS, @command{gawk} looks for either of
+the environment variables, @env{TEMP} or @env{TMPDIR}, in that order.
If either one is found, its value is assumed to be a directory for
temporary files. This directory must exist, and if you can spare the
memory, it is a good idea to put it on a RAM drive. If neither
-@code{TEMP} nor @code{TMPDIR} are found, then @code{gawk} uses the
+@env{TEMP} nor @env{TMPDIR} are found, then @command{gawk} uses the
current directory for its temporary files.
-The ST version of @code{gawk} searches for its program files as described in
-@ref{AWKPATH Variable, ,The @code{AWKPATH} Environment Variable}.
-The default value for the @code{AWKPATH} variable is taken from
-@code{DEFPATH} defined in @file{Makefile}. The sample @code{gcc}/TOS
+The ST version of @command{gawk} searches for its program files, as described in
+@ref{AWKPATH Variable, ,The @env{AWKPATH} Environment Variable}.
+The default value for the @env{AWKPATH} variable is taken from
+@code{DEFPATH} defined in @file{Makefile}. The sample @command{gcc}/TOS
@file{Makefile} for the ST in the distribution sets @code{DEFPATH} to
@code{@w{".,c:\lib\awk,c:\gnu\lib\awk"}}. The search path can be
-modified by explicitly setting @code{AWKPATH} to whatever you wish.
+modified by explicitly setting @env{AWKPATH} to whatever you want.
Note that colons cannot be used on the ST to separate elements in the
-@code{AWKPATH} variable, since they have another, reserved, meaning.
+@env{AWKPATH} variable, since they have another reserved meaning.
Instead, you must use a comma to separate elements in the path. When
recompiling, the separating character can be modified by initializing
-the @code{envsep} variable in @file{atari/gawkmisc.atr} to another
+the @code{envsep} variable in @file{unsupported/atari/gawkmisc.atr} to another
value.
-Although @code{awk} allows great flexibility in doing I/O redirections
+Although @command{awk} allows great flexibility in doing I/O redirections
from within a program, this facility should be used with care on the ST
-running under TOS. In some circumstances the OS routines for file
-handle pool processing lose track of certain events, causing the
-computer to crash, and requiring a reboot. Often a warm reboot is
-sufficient. Fortunately, this happens infrequently, and in rather
+running under TOS. In some circumstances, the OS routines for file-handle
+pool processing lose track of certain events, causing the
+computer to crash and requiring a reboot. Often a warm reboot is
+sufficient. Fortunately, this happens infrequently and in rather
esoteric situations. In particular, avoid having one part of an
-@code{awk} program using @code{print} statements explicitly redirected
-to @code{"/dev/stdout"}, while other @code{print} statements use the
+@command{awk} program using @code{print} statements explicitly redirected
+to @file{/dev/stdout}, while other @code{print} statements use the
default standard output, and a calling shell has redirected standard
output to a file.
+@c 10/2000: Is this still true, now that gawk does /dev/stdout internally?
-When @code{gawk} is compiled with the ST version of @code{gcc} and its
-usual libraries, it will accept both @samp{/} and @samp{\} as path separators.
-While this is convenient, it should be remembered that this removes one,
-technically valid, character (@samp{/}) from your file names, and that
-it may create problems for external programs, called via the @code{system}
+When @command{gawk} is compiled with the ST version of @command{gcc} and its
+usual libraries, it accepts both @samp{/} and @samp{\} as path separators.
+While this is convenient, it should be remembered that this removes one
+technically valid character (@samp{/}) from your @value{FN}.
+It may also create problems for external programs called via the @code{system}
function, which may not support this convention. Whenever it is possible
-that a file created by @code{gawk} will be used by some other program,
-use only backslashes. Also remember that in @code{awk}, backslashes in
+that a file created by @command{gawk} will be used by some other program,
+use only backslashes. Also remember that in @command{awk}, backslashes in
strings have to be doubled in order to get literal backslashes
(@pxref{Escape Sequences}).
-@node Amiga Installation, Bugs, Atari Installation, Installation
-@appendixsec Installing @code{gawk} on an Amiga
-
-@cindex amiga
-@cindex installation, amiga
-You can install @code{gawk} on an Amiga system using a Unix emulation
-environment available via anonymous @code{ftp} from
-@code{ftp.ninemoons.com} in the directory @file{pub/ade/current}.
-This includes a shell based on @code{pdksh}. The primary component of
-this environment is a Unix emulation library, @file{ixemul.lib}.
-@c could really use more background here, who wrote this, etc.
-
-A more complete distribution for the Amiga is available on
-the Geek Gadgets CD-ROM from:
-
-@quotation
-CRONUS @*
-1840 E. Warner Road #105-265 @*
-Tempe, AZ 85284 USA @*
-US Toll Free: (800) 804-0833 @*
-Phone: +1-602-491-0442 @*
-FAX: +1-602-491-0048 @*
-Email: @code{info@@ninemoons.com} @*
-WWW: @code{http://www.ninemoons.com} @*
-Anonymous @code{ftp} site: @code{ftp.ninemoons.com} @*
-@end quotation
-
-Once you have the distribution, you can configure @code{gawk} simply by
-running @code{configure}:
-
-@example
-configure -v m68k-amigaos
-@end example
+@node Tandem Installation, , Atari Installation, Unsupported
+@appendixsubsec Installing @command{gawk} on a Tandem
+@cindex tandem
+@cindex installation, tandem
-Then run @code{make}, and you should be all set!
-(If these steps do not work, please send in a bug report;
-@pxref{Bugs, ,Reporting Problems and Bugs}.)
+The Tandem port is only minimally supported.
+The port's contributor no longer has access to a Tandem system.
-@node Bugs, Other Versions, Amiga Installation, Installation
+@c This section based on README.Tandem by Stephen Davies (scldad@sdc.com.au)
+The Tandem port was done on a Cyclone machine running D20.
+The port is pretty clean and all facilities seem to work except for
+the I/O piping facilities
+(@pxref{Getline/Pipe, , Using @code{getline} from a Pipe},
+@ref{Getline/Variable/Pipe, ,Using @code{getline} into a Variable from a Pipe},
+and
+@ref{Redirection, ,Redirecting Output of @code{print} and @code{printf}}),
+which is just too foreign a concept for Tandem.
+
+To build a Tandem executable from source, download all of the files so
+that the @value{FN}s on the Tandem box conform to the restrictions of D20.
+For example, @file{array.c} becomes @file{ARRAYC}, and @file{awk.h}
+becomes @file{AWKH}. The totally Tandem-specific files are in the
+@file{tandem} ``subvolume'' (@file{unsupported/tandem} in the @command{gawk}
+distribution) and should be copied to the main source directory before
+building @command{gawk}.
+
+The file @file{compit} can then be used to compile and bind an executable.
+Alas, there is no @command{configure} or @command{make}.
+
+Usage is the same as for Unix, except that D20 requires all @samp{@{} and
+@samp{@}} characters to be escaped with @samp{~} on the command line
+(but @emph{not} in script files). Also, the standard Tandem syntax for
+@samp{/in filename,out filename/} must be used instead of the usual
+Unix @samp{<} and @samp{>} for file redirection. (Redirection options
+on @code{getline}, @code{print} etc., are supported.)
+
+The @samp{-mr @var{val}} option
+(@pxref{Options, ,Command-Line Options})
+has been ``stolen'' to enable Tandem users to process fixed-length
+records with no ``end-of-line'' character. That is, @samp{-mr 74} tells
+@command{gawk} to read the input file as fixed 74-byte records.
+
+@node Bugs, Other Versions, Unsupported, Installation
@appendixsec Reporting Problems and Bugs
-@display
-@i{There is nothing more dangerous than a bored archeologist.}
+@cindex archeologists
+@quotation
+@i{There is nothing more dangerous than a bored archeologist.}@*
The Hitchhiker's Guide to the Galaxy
+@end quotation
@c the radio show, not the book. :-)
-@end display
-@sp 1
-If you have problems with @code{gawk} or think that you have found a bug,
+@cindex bug reports
+@cindex problem reports
+@cindex reporting bugs
+@cindex reporting problems
+If you have problems with @command{gawk} or think that you have found a bug,
please report it to the developers; we cannot promise to do anything
but we might well want to fix it.
@@ -19487,74 +22613,114 @@ what you're trying to do. If it's not clear whether you should be able
to do something or not, report that too; it's a bug in the documentation!
Before reporting a bug or trying to fix it yourself, try to isolate it
-to the smallest possible @code{awk} program and input data file that
-reproduces the problem. Then send us the program and data file,
-some idea of what kind of Unix system you're using, and the exact results
-@code{gawk} gave you. Also say what you expected to occur; this will help
-us decide whether the problem was really in the documentation.
-
+to the smallest possible @command{awk} program and input @value{DF} that
+reproduces the problem. Then send us the program and @value{DF},
+some idea of what kind of Unix system you're using,
+the compiler you used to compile @command{gawk}, and the exact results
+@command{gawk} gave you. Also say what you expected to occur; this helps
+us decide whether the problem is really in the documentation.
+
+@cindex @code{bug-gawk@@gnu.org} bug reporting address
+@cindex emaill address for bug reports, @code{bug-gawk@@gnu.org}
+@cindex bug reports, email address, @code{bug-gawk@@gnu.org}
Once you have a precise problem, send email to @email{bug-gawk@@gnu.org}.
-Please include the version number of @code{gawk} you are using.
+@cindex Robbins, Arnold
+Please include the version number of @command{gawk} you are using.
You can get this information with the command @samp{gawk --version}.
-Using this address will automatically send a carbon copy of your
-mail to Arnold Robbins. If necessary, he can be reached directly at
-@email{arnold@@gnu.org}.
-
-@cindex @code{comp.lang.awk}
-@strong{Important!} Do @emph{not} try to report bugs in @code{gawk} by
+Using this address automatically sends a carbon copy of your
+mail to me. If necessary, I can be reached directly at
+@email{arnold@@gnu.org}. The bug reporting address is preferred since the
+email list is archived at the GNU Project.
+@emph{All email should be in English, since that is my native language.}
+
+@cindex @code{comp.lang.awk} Usenet news group
+@strong{Caution:} Do @emph{not} try to report bugs in @command{gawk} by
posting to the Usenet/Internet newsgroup @code{comp.lang.awk}.
-While the @code{gawk} developers do occasionally read this newsgroup,
+While the @command{gawk} developers do occasionally read this newsgroup,
there is no guarantee that we will see your posting. The steps described
-above are the official, recognized ways for reporting bugs.
+above are the official recognized ways for reporting bugs.
Non-bug suggestions are always welcome as well. If you have questions
about things that are unclear in the documentation or are just obscure
-features, ask Arnold Robbins; he will try to help you out, although he
-may not have the time to fix the problem. You can send him electronic
-mail at the Internet address above.
+features, ask me; I will try to help you out, although I
+may not have the time to fix the problem. You can send me electronic
+mail at the Internet address noted previously.
-If you find bugs in one of the non-Unix ports of @code{gawk}, please send
+If you find bugs in one of the non-Unix ports of @command{gawk}, please send
an electronic mail message to the person who maintains that port. They
-are listed below, and also in the @file{README} file in the @code{gawk}
+are named in the following list, as well as in the @file{README} file in the @command{gawk}
distribution. Information in the @file{README} file should be considered
authoritative if it conflicts with this @value{DOCUMENT}.
-@c NEEDED for looks
-@page
-The people maintaining the non-Unix ports of @code{gawk} are:
+The people maintaining the non-Unix ports of @command{gawk} are
+as follows:
-@cindex Deifik, Scott
+@ignore
+@table @asis
@cindex Fish, Fred
+@item Amiga
+Fred Fish, @email{fnf@@ninemoons.com}.
+
+@cindex Brown, Martin
+@item BeOS
+Martin Brown, @email{mc@@whoever.com}.
+
+@cindex Deifik, Scott
@cindex Hankerson, Darrel
-@cindex Jaegermann, Michal
-@cindex Rankin, Pat
-@cindex Rommel, Kai Uwe
-@table @asis
@item MS-DOS
-Scott Deifik, @samp{scottd@@amgen.com}, and
-Darrel Hankerson, @samp{hankedr@@mail.auburn.edu}.
+Scott Deifik, @email{scottd@@amgen.com} and
+Darrel Hankerson, @email{hankedr@@mail.auburn.edu}.
+@cindex Grigera, Juan
+@item MS-Windows
+Juan Grigera, @email{juan@@biophnet.unlp.edu.ar}.
+
+@cindex Rommel, Kai Uwe
@item OS/2
-Kai Uwe Rommel, @samp{rommel@@ars.de}.
+Kai Uwe Rommel, @email{rommel@@ars.de}.
+@cindex Davies, Stephen
+@item Tandem
+Stephen Davies, @email{scldad@@sdc.com.au}.
+
+@cindex Rankin, Pat
@item VMS
-Pat Rankin, @samp{rankin@@eql.caltech.edu}.
+Pat Rankin, @email{rankin@@eql.caltech.edu}.
+@end table
+@end ignore
-@item Atari ST
-Michal Jaegermann, @samp{michal@@gortel.phys.ualberta.ca}.
+@multitable {MS-Windows} {123456789012345678901234567890123456789001234567890}
+@cindex Fish, Fred
+@item Amiga @tab Fred Fish, @email{fnf@@ninemoons.com}.
-@item Amiga
-Fred Fish, @samp{fnf@@ninemoons.com}.
-@end table
+@cindex Brown, Martin
+@item BeOS @tab Martin Brown, @email{mc@@whoever.com}.
+
+@cindex Deifik, Scott
+@cindex Hankerson, Darrel
+@item MS-DOS @tab Scott Deifik, @email{scottd@@amgen.com} and
+Darrel Hankerson, @email{hankedr@@mail.auburn.edu}.
+
+@cindex Grigera, Juan
+@item MS-Windows @tab Juan Grigera, @email{juan@@biophnet.unlp.edu.ar}.
+
+@cindex Rommel, Kai Uwe
+@item OS/2 @tab Kai Uwe Rommel, @email{rommel@@ars.de}.
+
+@cindex Davies, Stephen
+@item Tandem @tab Stephen Davies, @email{scldad@@sdc.com.au}.
-If your bug is also reproducible under Unix, please send copies of your
-report to the general GNU bug list, as well as to Arnold Robbins, at the
-addresses listed above.
+@cindex Rankin, Pat
+@item VMS @tab Pat Rankin, @email{rankin@@eql.caltech.edu}.
+@end multitable
+
+If your bug is also reproducible under Unix, please send a copy of your
+report to the @email{bug-gawk@@gnu.org} email list as well.
@node Other Versions, , Bugs, Installation
-@appendixsec Other Freely Available @code{awk} Implementations
-@cindex Brennan, Michael
+@appendixsec Other Freely Available @command{awk} Implementations
+@cindex other @command{awk} implementations
@ignore
From: emory!amc.com!brennan (Michael Brennan)
Subject: C++ comments in awk programs
@@ -19562,77 +22728,168 @@ To: arnold@gnu.ai.mit.edu (Arnold Robbins)
Date: Wed, 4 Sep 1996 08:11:48 -0700 (PDT)
@end ignore
-@display
-@i{It's kind of fun to put comments like this in your awk code.}
- @code{// Do C++ comments work? answer: yes! of course}
+@cindex Brennan, Michael
+@quotation
+@i{It's kind of fun to put comments like this in your awk code.}@*
+@ @ @ @ @ @ @code{// Do C++ comments work? answer: yes! of course}@*
Michael Brennan
-@end display
-@sp 1
+@end quotation
-There are two other freely available @code{awk} implementations.
-This section briefly describes where to get them.
+There are three other freely available @command{awk} implementations.
+This @value{SECTION} briefly describes where to get them:
@table @asis
@cindex Kernighan, Brian
-@cindex anonymous @code{ftp}
-@cindex @code{ftp}, anonymous
-@item Unix @code{awk}
-Brian Kernighan has been able to make his implementation of
-@code{awk} freely available. You can get it via anonymous @code{ftp}
-to the host @code{@w{netlib.bell-labs.com}}. Change directory to
-@file{/netlib/research}. Use ``binary'' or ``image'' mode, and
-retrieve @file{awk.bundle.gz}.
-
-This is a shell archive that has been compressed with the GNU @code{gzip}
-utility. It can be uncompressed with the @code{gunzip} utility.
-
-You can also retrieve this version via the World Wide Web from his
-@uref{http://cm.bell-labs.com/who/bwk, home page}.
-
-This version requires an ANSI C compiler; GCC (the GNU C compiler)
+@cindex Unix @command{awk}, source code
+@cindex source code, Unix @command{awk}
+@item Unix @command{awk}
+Brian Kernighan has made his implementation of
+@command{awk} freely available.
+You can retrieve this version via the World Wide Web from
+his home page.@footnote{@uref{http://cm.bell-labs.com/who/bwk}}
+It is available in several archive formats:
+
+@table @asis
+@item Shell archive
+@uref{http://cm.bell-labs.com/who/bwk/awk.shar}
+
+@item Compressed @command{tar} file
+@uref{http://cm.bell-labs.com/who/bwk/awk.tar.gz}
+
+@item Zip file
+@uref{http://cm.bell-labs.com/who/bwk/awk.zip}
+@end table
+
+This version requires an ISO C (1990 standard) compiler;
+the C compiler from
+GCC (the GNU Compiler Collection)
works quite nicely.
+@xref{BTL, ,Extensions in the Bell Laboratories @command{awk}},
+for a list of extensions in this @command{awk} that are not in POSIX @command{awk}.
+
+@cindex GPL
+@cindex General Public License
+@cindex GNU General Public License
@cindex Brennan, Michael
-@cindex @code{mawk}
-@item @code{mawk}
-Michael Brennan has written an independent implementation of @code{awk},
-called @code{mawk}. It is available under the GPL
-(@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE}),
-just as @code{gawk} is.
-
-You can get it via anonymous @code{ftp} to the host
+@cindex @command{mawk}, source code
+@cindex source code, @command{mawk}
+@item @command{mawk}
+Michael Brennan has written an independent implementation of @command{awk},
+called @command{mawk}. It is available under the GPL
+(@pxref{Copying, ,GNU General Public License}),
+just as @command{gawk} is.
+
+You can get it via anonymous @command{ftp} to the host
@code{@w{ftp.whidbey.net}}. Change directory to @file{/pub/brennan}.
Use ``binary'' or ``image'' mode, and retrieve @file{mawk1.3.3.tar.gz}
(or the latest version that is there).
-@code{gunzip} may be used to decompress this file. Installation
-is similar to @code{gawk}'s
-(@pxref{Unix Installation, , Compiling and Installing @code{gawk} on Unix}).
+@command{gunzip} may be used to decompress this file. Installation
+is similar to @command{gawk}'s
+(@pxref{Unix Installation, , Compiling and Installing @command{gawk} on Unix}).
+
+@cindex extensions, @command{mawk}
+@command{mawk} has the following extensions that are not in POSIX @command{awk}:
+
+@itemize @bullet
+@item
+The @code{fflush} built-in function for flushing buffered output
+(@pxref{I/O Functions, ,Input/Output Functions}).
+
+@item
+The @samp{**} and @samp{**=} operators
+(@pxref{Arithmetic Ops, ,Arithmetic Operators}
+and also see
+@ref{Assignment Ops, ,Assignment Expressions}).
+
+@item
+The use of @code{func} as an abbreviation for @code{function}
+(@pxref{Definition Syntax, ,Function Definition Syntax}).
+
+@item
+The @samp{\x} escape sequence
+(@pxref{Escape Sequences}).
+
+@item
+The @file{/dev/stdout}, and @file{/dev/stderr}
+special files
+(@pxref{Special Files, ,Special @value{FFN}s in @command{gawk}}).
+Use @code{"-"} instead of @code{"/dev/stdin"} with @command{mawk}.
+
+@item
+The ability for @code{FS} and for the third
+argument to @code{split} to be null strings
+(@pxref{Single Character Fields, , Making Each Character a Separate Field}).
+
+@item
+The ability to delete all of an array at once with @samp{delete @var{array}}
+(@pxref{Delete, ,The @code{delete} Statement}).
+
+@item
+The ability for @code{RS} to be a regexp
+(@pxref{Records, ,How Input Is Split into Records}).
+
+@item
+The @code{BINMODE} special variable for non-Unix operating systems
+(@pxref{PC Using, ,Using @command{gawk} on PC Operating Systems}).
+@end itemize
+
+The next version of @command{mawk} will support @code{nextfile}.
+
+@cindex Sumner, Andrew
+@cindex @command{awka} compiler for @command{awk} programs
+@cindex @command{awka}, source code
+@cindex source code, @command{awka}
+@item @command{awka}
+Written by Andrew Sumner,
+@command{awka} translates @command{awk} programs into C, compiles them,
+and links them with a library of functions that provides the core
+@command{awk} functionality.
+It also has a number of extensions.
+
+@cindex GPL
+@cindex General Public License
+@cindex GNU General Public License
+@cindex LGPL
+@cindex Lesser General Public License
+@cindex GNU Lesser General Public License
+The @command{awk} translator is released under the GPL, and the library
+is under the LGPL.
+
+@ignore
+To get @command{awka}, go to its home page at
+Go to @uref{http://awka.sourceforge.net}.
+@end ignore
+To get @command{awka}, go to @uref{http://awka.sourceforge.net}.
+You can reach Andrew Sumner at @email{andrew_sumner@@bigfoot.com}.
@end table
-@node Notes, Glossary, Installation, Top
+@node Notes, Basic Concepts, Installation, Top
@appendix Implementation Notes
This appendix contains information mainly of interest to implementors and
-maintainers of @code{gawk}. Everything in it applies specifically to
-@code{gawk}, and not to other implementations.
+maintainers of @command{gawk}. Everything in it applies specifically to
+@command{gawk} and not to other implementations.
@menu
-* Compatibility Mode:: How to disable certain @code{gawk} extensions.
-* Additions:: Making Additions To @code{gawk}.
+* Compatibility Mode:: How to disable certain @command{gawk}
+ extensions.
+* Additions:: Making Additions To @command{gawk}.
+* Dynamic Extensions:: Adding new built-in functions to
+ @command{gawk}.
* Future Extensions:: New features that may be implemented one day.
-* Improvements:: Suggestions for improvements by volunteers.
@end menu
@node Compatibility Mode, Additions, Notes, Notes
@appendixsec Downward Compatibility and Debugging
-@xref{POSIX/GNU, ,Extensions in @code{gawk} Not in POSIX @code{awk}},
-for a summary of the GNU extensions to the @code{awk} language and program.
-All of these features can be turned off by invoking @code{gawk} with the
-@samp{--traditional} option, or with the @samp{--posix} option.
+@xref{POSIX/GNU, ,Extensions in @command{gawk} Not in POSIX @command{awk}},
+for a summary of the GNU extensions to the @command{awk} language and program.
+All of these features can be turned off by invoking @command{gawk} with the
+@option{--traditional} option or with the @option{--posix} option.
-If @code{gawk} is compiled for debugging with @samp{-DDEBUG}, then there
+If @command{gawk} is compiled for debugging with @samp{-DDEBUG}, then there
is one more option available on the command line:
@table @code
@@ -19641,70 +22898,82 @@ is one more option available on the command line:
Print out the parse stack information as the program is being parsed.
@end table
-This option is intended only for serious @code{gawk} developers,
+This option is intended only for serious @command{gawk} developers
and not for the casual user. It probably has not even been compiled into
-your version of @code{gawk}, since it slows down execution.
+your version of @command{gawk}, since it slows down execution.
-@node Additions, Future Extensions, Compatibility Mode, Notes
-@appendixsec Making Additions to @code{gawk}
+@node Additions, Dynamic Extensions, Compatibility Mode, Notes
+@appendixsec Making Additions to @command{gawk}
-If you should find that you wish to enhance @code{gawk} in a significant
+If you find that you want to enhance @command{gawk} in a significant
fashion, you are perfectly free to do so. That is the point of having
-free software; the source code is available, and you are free to change
-it as you wish (@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE}).
+free software; the source code is available and you are free to change
+it as you want (@pxref{Copying, ,GNU General Public License}).
-This section discusses the ways you might wish to change @code{gawk},
-and any considerations you should bear in mind.
+This @value{SECTION} discusses the ways you might want to change @command{gawk}
+as well as any considerations you should bear in mind.
@menu
-* Adding Code:: Adding code to the main body of @code{gawk}.
-* New Ports:: Porting @code{gawk} to a new operating system.
+* Adding Code:: Adding code to the main body of
+ @command{gawk}.
+* New Ports:: Porting @command{gawk} to a new operating
+ system.
@end menu
@node Adding Code, New Ports, Additions, Additions
@appendixsubsec Adding New Features
@cindex adding new features
-@cindex features, adding
-You are free to add any new features you like to @code{gawk}.
-However, if you want your changes to be incorporated into the @code{gawk}
+@cindex features, adding to @command{gawk}
+You are free to add any new features you like to @command{gawk}.
+However, if you want your changes to be incorporated into the @command{gawk}
distribution, there are several steps that you need to take in order to
-make it possible for me to include your changes.
+make it possible for me to include your changes:
@enumerate 1
@item
+Before building the new feature into @command{gawk} itself,
+consider writing it as an extension module
+(@pxref{Dynamic Extensions, ,Adding New Built-in Functions to @command{gawk}}).
+If that's not possible, continue with the rest of the steps in this list.
+
+@item
Get the latest version.
It is much easier for me to integrate changes if they are relative to
-the most recent distributed version of @code{gawk}. If your version of
-@code{gawk} is very old, I may not be able to integrate them at all.
-@xref{Getting, ,Getting the @code{gawk} Distribution},
-for information on getting the latest version of @code{gawk}.
+the most recent distributed version of @command{gawk}. If your version of
+@command{gawk} is very old, I may not be able to integrate them at all.
+(@xref{Getting, ,Getting the @command{gawk} Distribution},
+for information on getting the latest version of @command{gawk}.)
@item
-@iftex
+@ifnotinfo
Follow the @cite{GNU Coding Standards}.
-@end iftex
+@end ifnotinfo
@ifinfo
See @inforef{Top, , Version, standards, GNU Coding Standards}.
@end ifinfo
This document describes how GNU software should be written. If you haven't
-read it, please do so, preferably @emph{before} starting to modify @code{gawk}.
-(The @cite{GNU Coding Standards} are available as part of the Autoconf
-distribution, from the FSF.)
-
-@cindex @code{gawk} coding style
-@cindex coding style used in @code{gawk}
+read it, please do so, preferably @emph{before} starting to modify @command{gawk}.
+(The @cite{GNU Coding Standards} are available from
+the GNU Project's
+@command{ftp}
+site, at
+@uref{ftp://gnudist.gnu.org/gnu/GNUInfo/standards.text}.
+Texinfo, Info, and DVI versions are also available.)
+
+@cindex @command{gawk}, coding style
+@cindex coding style used in @command{gawk}
@item
-Use the @code{gawk} coding style.
-The C code for @code{gawk} follows the instructions in the
+Use the @command{gawk} coding style.
+The C code for @command{gawk} follows the instructions in the
@cite{GNU Coding Standards}, with minor exceptions. The code is formatted
-using the traditional ``K&R'' style, particularly as regards the placement
-of braces and the use of tabs. In brief, the coding rules for @code{gawk}
-are:
+using the traditional ``K&R'' style, particularly as regards to the placement
+of braces and the use of tabs. In brief, the coding rules for @command{gawk}
+are as follows:
@itemize @bullet
@item
-Use old style (non-prototype) function headers when defining functions.
+Use ANSI/ISO style (prototype) function headers when defining functions.
@item
Put the name of the function at the beginning of its own line.
@@ -19714,21 +22983,18 @@ Put the return type of the function, even if it is @code{int}, on the
line above the line with the name and arguments of the function.
@item
-The declarations for the function arguments should not be indented.
-
-@item
Put spaces around parentheses used in control structures
-(@code{if}, @code{while}, @code{for}, @code{do}, @code{switch}
+(@code{if}, @code{while}, @code{for}, @code{do}, @code{switch},
and @code{return}).
@item
Do not put spaces in front of parentheses used in function calls.
@item
-Put spaces around all C operators, and after commas in function calls.
+Put spaces around all C operators and after commas in function calls.
@item
-Do not use the comma operator to produce multiple side-effects, except
+Do not use the comma operator to produce multiple side effects, except
in @code{for} loop initialization and increment parts, and in macro bodies.
@item
@@ -19739,16 +23005,21 @@ Use the ``K&R'' brace layout style.
@item
Use comparisons against @code{NULL} and @code{'\0'} in the conditions of
-@code{if}, @code{while} and @code{for} statements, and in the @code{case}s
+@code{if}, @code{while}, and @code{for} statements, as well as in the @code{case}s
of @code{switch} statements, instead of just the
plain pointer or character value.
@item
-Use the @code{TRUE}, @code{FALSE}, and @code{NULL} symbolic constants,
+Use the @code{TRUE}, @code{FALSE} and @code{NULL} symbolic constants
and the character constant @code{'\0'} where appropriate, instead of @code{1}
and @code{0}.
@item
+Use the @code{ISALPHA}, @code{ISDIGIT}, etc.@: macros, instead of the
+traditional lowercase versions; these macros are better behaved for
+non-ASCII character sets.
+
+@item
Provide one-line descriptive comments for each function.
@item
@@ -19756,104 +23027,113 @@ Do not use @samp{#elif}. Many older Unix C compilers cannot handle it.
@item
Do not use the @code{alloca} function for allocating memory off the stack.
-Its use causes more portability trouble than the minor benefit of not having
+Its use causes more portability trouble than is worth the minor benefit of not having
to free the storage. Instead, use @code{malloc} and @code{free}.
@end itemize
+@strong{Note:}
If I have to reformat your code to follow the coding style used in
-@code{gawk}, I may not bother.
+@command{gawk}, I may not bother to integrate your changes at all.
@item
Be prepared to sign the appropriate paperwork.
In order for the FSF to distribute your changes, you must either place
-those changes in the public domain, and submit a signed statement to that
+those changes in the public domain and submit a signed statement to that
effect, or assign the copyright in your changes to the FSF.
-Both of these actions are easy to do, and @emph{many} people have done so
+Both of these actions are easy to do and @emph{many} people have done so
already. If you have questions, please contact me
(@pxref{Bugs, , Reporting Problems and Bugs}),
-or @code{gnu@@gnu.org}.
+or @email{gnu@@gnu.org}.
+@cindex Texinfo
@item
Update the documentation.
-Along with your new code, please supply new sections and or chapters
+Along with your new code, please supply new sections and/or chapters
for this @value{DOCUMENT}. If at all possible, please use real
Texinfo, instead of just supplying unformatted ASCII text (although
even that is better than no documentation at all).
Conventions to be followed in @cite{@value{TITLE}} are provided
-after the @samp{@@bye} at the end of the Texinfo source file.
-If possible, please update the man page as well.
+after the @samp{@@bye} at the end of the Texinfo source file.
+If possible, please update the @command{man} page as well.
You will also have to sign paperwork for your documentation changes.
@item
Submit changes as context diffs or unified diffs.
Use @samp{diff -c -r -N} or @samp{diff -u -r -N} to compare
-the original @code{gawk} source tree with your version.
-(I find context diffs to be more readable, but unified diffs are
+the original @command{gawk} source tree with your version.
+(I find context diffs to be more readable but unified diffs are
more compact.)
-I recommend using the GNU version of @code{diff}.
-Send the output produced by either run of @code{diff} to me when you
+I recommend using the GNU version of @command{diff}.
+Send the output produced by either run of @command{diff} to me when you
submit your changes.
-@xref{Bugs, , Reporting Problems and Bugs}, for the electronic mail
-information.
+(@xref{Bugs, , Reporting Problems and Bugs}, for the electronic mail
+information.)
Using this format makes it easy for me to apply your changes to the
-master version of the @code{gawk} source code (using @code{patch}).
+master version of the @command{gawk} source code (using @code{patch}).
If I have to apply the changes manually, using a text editor, I may
not do so, particularly if there are lots of changes.
@item
Include an entry for the @file{ChangeLog} file with your submission.
-This further helps minimize the amount of work I have to do,
+This helps further minimize the amount of work I have to do,
making it easier for me to accept patches.
@end enumerate
Although this sounds like a lot of work, please remember that while you
-may write the new code, I have to maintain it and support it, and if it
+may write the new code, I have to maintain it and support it. If it
isn't possible for me to do that with a minimum of extra work, then I
probably will not.
-
@node New Ports, , Adding Code, Additions
-@appendixsubsec Porting @code{gawk} to a New Operating System
+@appendixsubsec Porting @command{gawk} to a New Operating System
-@cindex porting @code{gawk}
-If you wish to port @code{gawk} to a new operating system, there are
-several steps to follow.
+@cindex porting @command{gawk}
+If you want to port @command{gawk} to a new operating system, there are
+several steps to follow:
@enumerate 1
@item
Follow the guidelines in
+@ifinfo
@ref{Adding Code, ,Adding New Features},
+@end ifinfo
+@ifnotinfo
+the previous @value{SECTION}
+@end ifnotinfo
concerning coding style, submission of diffs, and so on.
@item
When doing a port, bear in mind that your code must co-exist peacefully
-with the rest of @code{gawk}, and the other ports. Avoid gratuitous
+with the rest of @command{gawk} and the other ports. Avoid gratuitous
changes to the system-independent parts of the code. If at all possible,
avoid sprinkling @samp{#ifdef}s just for your port throughout the
code.
+@cindex GPL
+@cindex General Public License
+@cindex GNU General Public License
If the changes needed for a particular system affect too much of the
-code, I probably will not accept them. In such a case, you will, of course,
-be able to distribute your changes on your own, as long as you comply
+code, I probably will not accept them. In such a case, you can, of course,
+distribute your changes on your own, as long as you comply
with the GPL
-(@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE}).
+(@pxref{Copying, ,GNU General Public License}).
@item
-A number of the files that come with @code{gawk} are maintained by other
+A number of the files that come with @command{gawk} are maintained by other
people at the Free Software Foundation. Thus, you should not change them
-unless it is for a very good reason. I.e.@: changes are not out of the
-question, but changes to these files will be scrutinized extra carefully.
-The files are @file{alloca.c}, @file{getopt.h}, @file{getopt.c},
+unless it is for a very good reason; i.e., changes are not out of the
+question, but changes to these files are scrutinized extra carefully.
+The files are @file{getopt.h}, @file{getopt.c},
@file{getopt1.c}, @file{regex.h}, @file{regex.c}, @file{dfa.h},
@file{dfa.c}, @file{install-sh}, and @file{mkinstalldirs}.
@item
Be willing to continue to maintain the port.
Non-Unix operating systems are supported by volunteers who maintain
-the code needed to compile and run @code{gawk} on their systems. If no-one
-volunteers to maintain a port, that port becomes unsupported, and it may
+the code needed to compile and run @command{gawk} on their systems. If noone
+volunteers to maintain a port, it becomes unsupported and it may
be necessary to remove it from the distribution.
@item
@@ -19866,15 +23146,15 @@ the main source directory includes the appropriate
Be sure to update it as well.
Each port's @file{gawkmisc.???} file has a suffix reminiscent of the machine
-or operating system for the port. For example, @file{pc/gawkmisc.pc} and
+or operating system for the port---for example, @file{pc/gawkmisc.pc} and
@file{vms/gawkmisc.vms}. The use of separate suffixes, instead of plain
@file{gawkmisc.c}, makes it possible to move files from a port's subdirectory
into the main subdirectory, without accidentally destroying the real
-@file{gawkmisc.c} file. (Currently, this is only an issue for the MS-DOS
-and OS/2 ports.)
+@file{gawkmisc.c} file. (Currently, this is only an issue for the
+PC operating system ports.)
@item
-Supply a @file{Makefile} and any other C source and header files that are
+Supply a @file{Makefile} as well as any other C source and header files that are
necessary for your operating system. All your code should be in a
separate subdirectory, with a name that is the same as, or reminiscent
of, either your operating system or the computer system. If possible,
@@ -19886,38 +23166,705 @@ duplicate the names of files in the main source directory.
@item
Update the documentation.
Please write a section (or sections) for this @value{DOCUMENT} describing the
-installation and compilation steps needed to install and/or compile
-@code{gawk} for your system.
+installation and compilation steps needed to compile and/or install
+@command{gawk} for your system.
@item
Be prepared to sign the appropriate paperwork.
In order for the FSF to distribute your code, you must either place
-your code in the public domain, and submit a signed statement to that
+your code in the public domain and submit a signed statement to that
effect, or assign the copyright in your code to the FSF.
@ifinfo
-Both of these actions are easy to do, and @emph{many} people have done so
+Both of these actions are easy to do and @emph{many} people have done so
already. If you have questions, please contact me, or
-@code{gnu@@gnu.org}.
+@email{gnu@@gnu.org}.
@end ifinfo
@end enumerate
-Following these steps will make it much easier to integrate your changes
-into @code{gawk}, and have them co-exist happily with the code for other
-operating systems that is already there.
+Following these steps makes it much easier to integrate your changes
+into @command{gawk} and have them co-exist happily with other
+operating systems' code that is already there.
-In the code that you supply, and that you maintain, feel free to use a
+In the code that you supply and maintain, feel free to use a
coding style and brace layout that suits your taste.
-@node Future Extensions, Improvements, Additions, Notes
+@node Dynamic Extensions, Future Extensions, Additions, Notes
+@appendixsec Adding New Built-in Functions to @command{gawk}
+@cindex Robinson, Will
+@cindex robot, the
+@cindex Lost In Space
+@quotation
+@i{Danger Will Robinson! Danger!!@*
+Warning! Warning!}@*
+The Robot
+@end quotation
+
+@cindex Linux
+@cindex GNU/Linux
+Beginning with @command{gawk} 3.1, it is possible to add new built-in
+functions to @command{gawk} using dynamically loaded libraries. This
+facility is available on systems (such as GNU/Linux) that support
+the @code{dlopen} and @code{dlsym} functions.
+This @value{SECTION} describes how to write and use dynamically
+loaded extentions for @command{gawk}.
+Experience with programming in
+C or C++ is necessary when reading this @value{SECTION}.
+
+@strong{Caution:} The facilities described in this @value{SECTION}
+are very much subject to change in the next @command{gawk} release.
+Be aware that you may have to re-do everything, perhaps from scratch,
+upon the next release.
+
+@menu
+* Internals:: A brief look at some @command{gawk} internals.
+* Sample Library:: A example of new functions.
+@end menu
+
+@node Internals, Sample Library, Dynamic Extensions, Dynamic Extensions
+@appendixsubsec A Minimal Introduction to @command{gawk} Internals
+
+The truth is that @command{gawk} was not designed for simple extensibility.
+The facilities for adding functions using shared libraries work, but
+are something of a ``bag on the side.'' Thus, this tour is
+brief and simplistic; would-be @command{gawk} hackers are encouraged to
+spend some time reading the source code before trying to write
+extensions based on the material presented here. Of particular note
+are the files @file{awk.h}, @file{builtin.c}, and @file{eval.c}.
+Reading @file{awk.y} in order to see how the parse tree is built
+would also be of use.
+
+With the disclaimers out of the way, the following types, structure
+members, functions, and macros are declared in @file{awk.h} and are of
+use when writing extensions. The next @value{SECTION}
+shows how they are used:
+
+@table @code
+@cindex @code{AWKNUM} internal type
+@cindex internal type, @code{AWKNUM}
+@item AWKNUM
+An @code{AWKNUM} is the internal type of @command{awk}
+floating-point numbers. Typically, it is a C @code{double}.
+
+@cindex @code{NODE} internal type
+@cindex internal type, @code{NODE}
+@item NODE
+Just about everything is done using objects of type @code{NODE}.
+These contain both strings and numbers, as well as variables and arrays.
+
+@cindex @code{force_number} internal function
+@cindex internal function, @code{force_number}
+@item AWKNUM force_number(NODE *n)
+This macro forces a value to be numeric. It returns the actual
+numeric value contained in the node.
+It may end up calling an internal @command{gawk} function.
+
+@cindex @code{force_string} internal function
+@cindex internal function, @code{force_string}
+@item void force_string(NODE *n)
+This macro guarantees that a @code{NODE}'s string value is current.
+It may end up calling an internal @command{gawk} function.
+It also guarantees that the string is zero-terminated.
+
+@cindex @code{param_cnt} internal variable
+@cindex internal variable, @code{param_cnt}
+@item n->param_cnt
+The number of parameters actually passed in a function call at runtime.
+
+@cindex @code{stptr} internal variable
+@cindex @code{stlen} internal variable
+@cindex internal variable, @code{stptr}
+@cindex internal variable, @code{stlen}
+@item n->stptr
+@itemx n->stlen
+The data and length of a @code{NODE}'s string value, respectively.
+The string is @emph{not} guaranteed to be zero-terminated.
+If you need to pass the string value to a C library function, save
+the value in @code{n->stptr[n->stlen]}, assign @code{'\0'} to it,
+call the routine, and then restore the value.
+
+@cindex @code{type} internal variable
+@cindex internal variable, @code{type}
+@item n->type
+The type of the @code{NODE}. This is a C @code{enum}. Values should
+be either @code{Node_var} or @code{Node_var_array} for function
+parameters.
+
+@cindex @code{vname} internal variable
+@cindex internal variable, @code{vname}
+@item n->vname
+The ``variable name'' of a node. This is not of much use inside
+externally written extensions.
+
+@cindex @code{assoc_clear} internal function
+@cindex internal function, @code{assoc_clear}
+@item void assoc_clear(NODE *n)
+Clears the associative array pointed to by @code{n}.
+Make sure that @samp{n->type == Node_var_array} first.
+
+@cindex @code{assoc_lookup} internal function
+@cindex internal function, @code{assoc_lookup}
+@item NODE **assoc_lookup(NODE *symbol, NODE *subs, int reference)
+Finds, and installs if necessary, array elements.
+@code{symbol} is the array, @code{subs} is the subscript.
+This is usually a value created with @code{tmp_string} (see below).
+@code{reference} should be @code{TRUE} if it is an error to use the
+value before it is created. Typically, @code{FALSE} is the
+correct value to use from extension functions.
+
+@cindex @code{make_string} internal function
+@cindex internal function, @code{make_string}
+@item NODE *make_string(char *s, size_t len)
+Take a C string and turn it into a pointer to a @code{NODE} that
+can be stored appropriately. This is permanent storage; understanding
+of @command{gawk} memory management is helpful.
+
+@cindex @code{make_number} internal function
+@cindex internal function, @code{make_number}
+@item NODE *make_number(AWKNUM val)
+Take an @code{AWKNUM} and turn it into a pointer to a @code{NODE} that
+can be stored appropriately. This is permanent storage; understanding
+of @command{gawk} memory management is helpful.
+
+@cindex @code{tmp_string} internal function
+@item NODE *tmp_string(char *s, size_t len);
+@cindex internal function, @code{tmp_string}
+Take a C string and turn it into a pointer to a @code{NODE} that
+can be stored appropriately. This is temporary storage; understanding
+of @command{gawk} memory management is helpful.
+
+@cindex @code{tmp_number} internal function
+@item NODE *tmp_number(AWKNUM val)
+@cindex internal function, @code{tmp_number}
+Take an @code{AWKNUM} and turn it into a pointer to a @code{NODE} that
+can be stored appropriately. This is temporary storage;
+understanding of @command{gawk} memory management is helpful.
+
+@cindex @code{dupnode} internal function
+@cindex internal function, @code{dupnode}
+@item NODE *dupnode(NODE *n)
+Duplicate a node. In most cases, this increments an internal
+reference count instead of actually duplicating the entire @code{NODE};
+understanding of @command{gawk} memory management is helpful.
+
+@cindex @code{free_temp} internal macro
+@cindex internal macro, @code{free_temp}
+@item void free_temp(NODE *n)
+This macro releases the memory associated with a @code{NODE}
+allocated with @code{tmp_string} or @code{tmp_number}.
+Understanding of @command{gawk} memory management is helpful.
+
+@cindex @code{make_builtin} internal function
+@cindex internal function, @code{make_builtin}
+@item void make_builtin(char *name, NODE *(*func)(NODE *), int count)
+Register a C function pointed to by @code{func} as new built-in
+function @code{name}. @code{name} is a regular C string. @code{count}
+is the maximum number of arguments that the function takes.
+The function should be written in the following manner:
+
+@example
+/* do_xxx --- do xxx function for gawk */
+
+NODE *
+do_xxx(NODE *tree)
+@{
+ @dots{}
+@}
+@end example
+
+@cindex @code{get_argument} internal function
+@cindex internal function, @code{get_argument}
+@item NODE *get_argument(NODE *tree, int i)
+This function is called from within a C extension function to get
+the @code{i}'th argument from the function call.
+The first argument is argument zero.
+
+@cindex @code{set_value} internal function
+@item void set_value(NODE *tree)
+@cindex internal function, @code{set_value}
+This function is called from within a C extension function to set
+the return value from the extension function. This value is
+what the @command{awk} program sees as the return value from the
+new @command{awk} function.
+
+@cindex @code{update_ERRNO} internal function
+@item void update_ERRNO(void)
+@cindex internal function, @code{update_ERRNO}
+This function is called from within a C extension function to set
+the value of @command{gawk}'s @code{ERRNO} variable, based on the current
+value of the C @code{errno} variable.
+It is provided as a convenience.
+@end table
+
+An argument that is supposed to be an array needs to be handled with
+some extra code, in case the array being passed in is actually
+from a function parameter.
+The following ``boiler plate'' code shows how to do this:
+
+@smallexample
+NODE *the_arg;
+
+the_arg = get_argument(tree, 2); /* assume need 3rd arg, 0-based */
+
+/* if a parameter, get it off the stack */
+if (the_arg->type == Node_param_list)
+ the_arg = stack_ptr[the_arg->param_cnt];
+
+/* parameter referenced an array, get it */
+if (the_arg->type == Node_array_ref)
+ the_arg = the_arg->orig_array;
+
+/* check type */
+if (the_arg->type != Node_var && the_arg->type != Node_var_array)
+ fatal("newfunc: third argument is not an array");
+
+/* force it to be an array, if necessary, clear it */
+the_arg->type = Node_var_array;
+assoc_clear(the_arg);
+@end smallexample
+
+Again, you should spend time studying the @command{gawk} internals;
+don't just blindly copy this code.
+
+@node Sample Library, , Internals, Dynamic Extensions
+@appendixsubsec Directory and File Operation Built-ins
+
+Two useful functions that are not in @command{awk} are @code{chdir}
+(so that an @command{awk} program can change its directory) and
+@code{stat} (so that an @command{awk} program can gather information about
+a file).
+This @value{SECTION} implements these functions for @command{gawk} in an
+external extension library.
+
+@menu
+* Internal File Description:: What the new functions will do.
+* Internal File Ops:: The code for internal file operations.
+* Using Internal File Ops:: How to use an external extension.
+@end menu
+
+@node Internal File Description, Internal File Ops, Sample Library, Sample Library
+@appendixsubsubsec Using @code{chdir} and @code{stat}
+
+This @value{SECTION} shows how to use the new functions at the @command{awk}
+level once they've been integrated into the running @command{gawk}
+interpreter.
+Using @code{chdir} is very straightforward. It takes one argument,
+the new directory to change to:
+
+@example
+@dots{}
+newdir = "/home/arnold/funstuff"
+ret = chdir(newdir)
+if (ret < 0) @{
+ printf("could not change to %s: %s\n",
+ newdir, ERRNO) > "/dev/stderr"
+ exit 1
+@}
+@dots{}
+@end example
+
+The return value is negative if the @code{chdir} failed,
+and @code{ERRNO}
+(@pxref{Built-in Variables})
+is set to a string indicating the error.
+
+Using @code{stat} is a bit more complicated.
+The C @code{stat} function fills in a structure that has a fair
+amount of information.
+The right way to model this in @command{awk} is to fill in an associative
+array with the appropriate information:
+
+@c broke printf for page breaking
+@example
+file = "/home/arnold/.profile"
+fdata[1] = "x" # force `fdata' to be an array
+ret = stat(file, fdata)
+if (ret < 0) @{
+ printf("could not stat %s: %s\n",
+ file, ERRNO) > "/dev/stderr"
+ exit 1
+@}
+printf("size of %s is %d bytes\n", file, fdata["size"])
+@end example
+
+The @code{stat} function always clears the data array, even if
+the @code{stat} fails. It fills in the following elements:
+
+@table @code
+@item "name"
+The name of the file that was @code{stat}'ed.
+
+@item "dev"
+@itemx "ino"
+The file's device and inode numbers, respectively.
+
+@item "mode"
+The file's mode, as a numeric value. This includes both the file's
+type and its permissions.
+
+@item "nlink"
+The number of hard links (directory entries) the file has.
+
+@item "uid"
+@itemx "gid"
+The numeric user and group ID numbers of the file's owner.
+
+@item "size"
+The size in bytes of the file.
+
+@item "blocks"
+The number of disk blocks the file actually occupies. This may not
+be a function of the file's size if the file has holes.
+
+@item "atime"
+@itemx "mtime"
+@itemx "ctime"
+The file's last access, modification, and inode update times,
+respectively. These are numeric timestamps, suitable for formatting
+with @code{strftime}
+(@pxref{Built-in, ,Built-in Functions}).
+
+@item "pmode"
+The file's ``printable mode.'' This is a string representation of
+the file's type and permissions, such as what is produced by
+@samp{ls -l}---for example, @code{"drwxr-xr-x"}.
+
+@item "type"
+A printable string representation of the file's type. The value
+is one of the following:
+
+@table @code
+@item "blockdev"
+@itemx "chardev"
+The file is a block or character device (``special file'').
+
+@ignore
+@item "door"
+The file is a Solaris ``door'' (special file used for
+interprocess communications).
+@end ignore
+
+@item "directory"
+The file is a directory.
+
+@item "fifo"
+The file is a named-pipe (also known as a FIFO).
+
+@item "file"
+The file is just a regular file.
+
+@item "socket"
+The file is an @code{AF_UNIX} (``Unix domain'') socket in the
+filesystem.
+
+@item "symlink"
+The file is a symbolic link.
+@end table
+@end table
+
+Several additional elements may be present depending upon the operating
+system and the type of the file. You can test for them in your @command{awk}
+program by using the @code{in} operator
+(@pxref{Reference to Elements, ,Referring to an Array Element}):
+
+@table @code
+@item "blksize"
+The preferred block size for I/O to the file. This field is not
+present on all POSIX-like systems in the C @code{stat} structure.
+
+@item "linkval"
+If the file is a symbolic link, this element is the name of the
+file the link points to (i.e., the value of the link).
+
+@item "rdev"
+@itemx "major"
+@itemx "minor"
+If the file is a block or character device file, then these values
+represent the numeric device number and the major and minor components
+of that number, respectively.
+@end table
+
+@node Internal File Ops, Using Internal File Ops, Internal File Description, Sample Library
+@appendixsubsubsec C Code for @code{chdir} and @code{stat}
+
+@cindex Linux
+@cindex GNU/Linux
+Here is the C code for these extensions. They were written for
+GNU/Linux. The code needs some more work for complete portability
+to other POSIX-compliant systems:@footnote{This version is edited
+slightly for presentation. The complete version can be found in
+@file{extension/filefuncs.c} in the @command{gawk} distribution.}
+
+@c break line for page breaking
+@example
+#include "awk.h"
+
+#include <sys/sysmacros.h>
+
+/* do_chdir --- provide dynamically loaded
+ chdir() builtin for gawk */
+
+static NODE *
+do_chdir(tree)
+NODE *tree;
+@{
+ NODE *newdir;
+ int ret = -1;
+
+ newdir = get_argument(tree, 0);
+@end example
+
+The file includes the @code{"awk.h"} header file for definitions
+for the @command{gawk} internals. It includes @code{<sys/sysmacros.h>}
+for access to the @code{major} and @code{minor} macros.
+
+@cindex conventions, programming
+@cindex programming conventions
+By convention, for an @command{awk} function @code{foo}, the function that
+implements it is called @samp{do_foo}. The function should take
+a @samp{NODE *} argument, usually called @code{tree}, that
+represents the argument list to the function. The @code{newdir}
+variable represents the new directory to change to, retrieved
+with @code{get_argument}. Note that the first argument is
+numbered zero.
+
+This code actually accomplishes the @code{chdir}. It first forces
+the argument to be a string and passes the string value to the
+@code{chdir} system call. If the @code{chdir} fails, @code{ERRNO}
+is updated.
+The result of @code{force_string} has to be freed with @code{free_temp}:
+
+@example
+ if (newdir != NULL) @{
+ (void) force_string(newdir);
+ ret = chdir(newdir->stptr);
+ if (ret < 0)
+ update_ERRNO();
+
+ free_temp(newdir);
+ @}
+@end example
+
+Finally, the function returns the return value to the @command{awk} level,
+using @code{set_value}. Then it must return a value from the call to
+the new built-in (this value ignored by the interpreter):
+
+@example
+ /* Set the return value */
+ set_value(tmp_number((AWKNUM) ret));
+
+ /* Just to make the interpreter happy */
+ return tmp_number((AWKNUM) 0);
+@}
+@end example
+
+The @code{stat} built-in is more involved. First comes a function
+that turns a numeric mode into a printable representation
+(e.g., 644 becomes @samp{-rw-r--r--}). This is omitted here for brevity:
+
+@c break line for page breaking
+@example
+/* format_mode --- turn a stat mode field
+ into something readable */
+
+static char *
+format_mode(fmode)
+unsigned long fmode;
+@{
+ @dots{}
+@}
+@end example
+
+Next comes the actual @code{do_stat} function itself. First come the
+variable declarations and argument checking:
+
+@ignore
+Changed message for page breaking. Used to be:
+ "stat: called with incorrect number of arguments (%d), should be 2",
+@end ignore
+@example
+/* do_stat --- provide a stat() function for gawk */
+
+static NODE *
+do_stat(tree)
+NODE *tree;
+@{
+ NODE *file, *array;
+ struct stat sbuf;
+ int ret;
+ char *msg;
+ NODE **aptr;
+ char *pmode; /* printable mode */
+ char *type = "unknown";
+
+ /* check arg count */
+ if (tree->param_cnt != 2)
+ fatal(
+ "stat: called with %d arguments, should be 2",
+ tree->param_cnt);
+@end example
+
+Then comes the actual work. First, we get the arguments.
+Then, we always clear the array. To get the file information,
+we use @code{lstat}, in case the file is a symbolic link.
+If there's an error, we set @code{ERRNO} and return:
+
+@c comment made multiline for page breaking
+@example
+ /*
+ * directory is first arg,
+ * array to hold results is second
+ */
+ file = get_argument(tree, 0);
+ array = get_argument(tree, 1);
+
+ /* empty out the array */
+ assoc_clear(array);
+
+ /* lstat the file, if error, set ERRNO and return */
+ (void) force_string(file);
+ ret = lstat(file->stptr, & sbuf);
+ if (ret < 0) @{
+ update_ERRNO();
+
+ set_value(tmp_number((AWKNUM) ret));
+
+ free_temp(file);
+ return tmp_number((AWKNUM) 0);
+ @}
+@end example
+
+Now comes the tedious part: filling in the array. Only a few of the
+calls are shown here, since they all follow the same pattern:
+
+@example
+ /* fill in the array */
+ aptr = assoc_lookup(array, tmp_string("name", 4), FALSE);
+ *aptr = dupnode(file);
+
+ aptr = assoc_lookup(array, tmp_string("mode", 4), FALSE);
+ *aptr = make_number((AWKNUM) sbuf.st_mode);
+
+ aptr = assoc_lookup(array, tmp_string("pmode", 5), FALSE);
+ pmode = format_mode(sbuf.st_mode);
+ *aptr = make_string(pmode, strlen(pmode));
+@end example
+
+When done, we free the temporary value containing the @value{FN},
+set the return value, and return:
+
+@example
+ free_temp(file);
+
+ /* Set the return value */
+ set_value(tmp_number((AWKNUM) ret));
+
+ /* Just to make the interpreter happy */
+ return tmp_number((AWKNUM) 0);
+@}
+@end example
+
+@cindex conventions, programming
+@cindex programming conventions
+Finally, it's necessary to provide the ``glue'' that loads the
+new function(s) into @command{gawk}. By convention, each library has
+a routine named @code{dlload} that does the job:
+
+@example
+/* dlload --- load new builtins in this library */
+
+NODE *
+dlload(tree, dl)
+NODE *tree;
+void *dl;
+@{
+ make_builtin("chdir", do_chdir, 1);
+ make_builtin("stat", do_stat, 2);
+ return tmp_number((AWKNUM) 0);
+@}
+@end example
+
+And that's it! As an exercise, consider adding functions to
+implement system calls such as @code{chown}, @code{chmod}, and @code{umask}.
+
+@node Using Internal File Ops, , Internal File Ops, Sample Library
+@appendixsubsubsec Integrating the Extensions
+
+@cindex Linux
+@cindex GNU/Linux
+Now that the code is written, it must be possible to add it at
+runtime to the running @command{gawk} interpreter. First, the
+code must be compiled. Assuming that the functions are in
+a file named @file{filefuncs.c}, and @var{idir} is the location
+of the @command{gawk} include files,
+the following steps create
+a GNU/Linux shared library:
+
+@example
+$ gcc -shared -DHAVE_CONFIG_H -c -O -g -I@var{idir} filefuncs.c
+$ ld -o filefuncs.so -shared filefuncs.o
+@end example
+
+@cindex @code{extension} built-in function
+Once the library exists, it is loaded by calling the @code{extension}
+built-in function.
+This function takes two arguments: the name of the
+library to load and the name of a function to call when the library
+is first loaded. This function adds the new functions to @command{gawk}.
+It returns the value returned by the initialization function
+within the shared library:
+
+@example
+# file testff.awk
+BEGIN @{
+ extension("./filefuncs.so", "dlload")
+
+ chdir(".") # no-op
+
+ data[1] = 1 # force `data' to be an array
+ print "Info for testff.awk"
+ ret = stat("testff.awk", data)
+ print "ret =", ret
+ for (i in data)
+ printf "data[\"%s\"] = %s\n", i, data[i]
+ print "testff.awk modified:",
+ strftime("%m %d %y %H:%M:%S", data["mtime"])
+@}
+@end example
+
+Here are the results of running the program:
+
+@example
+$ gawk -f testff.awk
+@print{} Info for testff.awk
+@print{} ret = 0
+@print{} data["blksize"] = 4096
+@print{} data["mtime"] = 932361936
+@print{} data["mode"] = 33188
+@print{} data["type"] = file
+@print{} data["dev"] = 2065
+@print{} data["gid"] = 10
+@print{} data["ino"] = 878597
+@print{} data["ctime"] = 971431797
+@print{} data["blocks"] = 2
+@print{} data["nlink"] = 1
+@print{} data["name"] = testff.awk
+@print{} data["atime"] = 971608519
+@print{} data["pmode"] = -rw-r--r--
+@print{} data["size"] = 607
+@print{} data["uid"] = 2076
+@print{} testff.awk modified: 07 19 99 08:25:36
+@end example
+
+@node Future Extensions, , Dynamic Extensions, Notes
@appendixsec Probable Future Extensions
@ignore
From emory!scalpel.netlabs.com!lwall Tue Oct 31 12:43:17 1995
Return-Path: <emory!scalpel.netlabs.com!lwall>
Message-Id: <9510311732.AA28472@scalpel.netlabs.com>
To: arnold@skeeve.atl.ga.us (Arnold D. Robbins)
-Subject: Re: May I quote you?
+Subject: Re: May I quote you?
In-Reply-To: Your message of "Tue, 31 Oct 95 09:11:00 EST."
- <m0tAHPQ-00014MC@skeeve.atl.ga.us>
+ <m0tAHPQ-00014MC@skeeve.atl.ga.us>
Date: Tue, 31 Oct 95 09:32:46 -0800
From: Larry Wall <emory!scalpel.netlabs.com!lwall>
@@ -19925,7 +23872,7 @@ From: Larry Wall <emory!scalpel.netlabs.com!lwall>
: thoroughly updated manual. One of the sections deals with planned future
: extensions and enhancements. I have the following at the beginning
: of it:
-:
+:
: @cindex PERL
: @cindex Wall, Larry
: @display
@@ -19935,7 +23882,7 @@ From: Larry Wall <emory!scalpel.netlabs.com!lwall>
: @i{Hey!} @*
: Larry Wall
: @end display
-:
+:
: Before I actually release this for publication, I wanted to get your
: permission to quote you. (Hopefully, in the spirit of much of GNU, the
: implied humor is visible... :-)
@@ -19946,213 +23893,790 @@ Larry
@end ignore
@cindex PERL
@cindex Wall, Larry
-@display
-@i{AWK is a language similar to PERL, only considerably more elegant.}
+@cindex Robbins, Arnold
+@quotation
+@i{AWK is a language similar to PERL, only considerably more elegant.}@*
Arnold Robbins
-@i{Hey!}
+@i{Hey!}@*
Larry Wall
-@end display
-@sp 1
+@end quotation
-This section briefly lists extensions and possible improvements
+This @value{SECTION} briefly lists extensions and possible improvements
that indicate the directions we are
-currently considering for @code{gawk}. The file @file{FUTURES} in the
-@code{gawk} distributions lists these extensions as well.
+currently considering for @command{gawk}. The file @file{FUTURES} in the
+@command{gawk} distribution lists these extensions as well.
-This is a list of probable future changes that will be usable by the
-@code{awk} language programmer.
+Following is a list of probable future changes visible at the
+@command{awk} language level:
@c these are ordered by likelihood
@table @asis
-@item Localization
-The GNU project is starting to support multiple languages.
-It will at least be possible to make @code{gawk} print its warnings and
-error messages in languages other than English.
-It may be possible for @code{awk} programs to also use the multiple
-language facilities, separate from @code{gawk} itself.
+@item Loadable Module Interface
+It is not clear that the @command{awk}-level interface to the
+modules facility is as good as it should be. The interface needs to be
+redesigned, particularly taking namespace issues into account, as
+well as possibly including issues such as library search path order
+and versioning.
+
+@item @code{RECLEN} variable for fixed length records
+Along with @code{FIELDWIDTHS}, this would speed up the processing of
+fixed-length records.
+@code{PROCINFO["RS"]} would be @code{"RS"} or @code{"RECLEN"},
+depending upon which kind of record processing is in effect.
+
+@item Additional @code{printf} specifiers
+The 1999 ISO C standard added a number of additional @code{printf}
+format specifiers. These should be evaluated for possible inclusion
+in @command{gawk}.
+
+@ignore
+@item A @samp{%'d} flag
+Add @samp{%'d} for putting in commas in formatting numeric values.
+@end ignore
@item Databases
-It may be possible to map a GDBM/NDBM/SDBM file into an @code{awk} array.
+It may be possible to map a GDBM/NDBM/SDBM file into an @command{awk} array.
-@item A @code{PROCINFO} Array
-The special files that provide process-related information
-(@pxref{Special Files, ,Special File Names in @code{gawk}})
-will be superseded by a @code{PROCINFO} array that would provide the same
-information, in an easier to access fashion.
+@item Large Character Sets
+It would be nice if @command{gawk} could handle UTF-8 and other
+character sets that are larger than eight bits.
@item More @code{lint} warnings
There are more things that could be checked for portability.
+@end table
-@item Control of subprocess environment
-Changes made in @code{gawk} to the array @code{ENVIRON} may be
-propagated to subprocesses run by @code{gawk}.
-
-@ignore
-@item @code{RECLEN} variable for fixed length records
-Along with @code{FIELDWIDTHS}, this would speed up the processing of
-fixed-length records.
+Following is a list of probable improvements that will make @command{gawk}'s
+source code easier to work with:
-@item A @code{restart} keyword
-After modifying @code{$0}, @code{restart} would restart the pattern
-matching loop, without reading a new record from the input.
-
-@item A @samp{|&} redirection
-The @samp{|&} redirection, in place of @samp{|}, would open a two-way
-pipeline for communication with a sub-process (via @code{getline} and
-@code{print} and @code{printf}).
-
-@item Function valued variables
-It would be possible to assign the name of a user-defined or built-in
-function to a regular @code{awk} variable, and then call the function
-indirectly, by using the regular variable. This would make it possible
-to write general purpose sorting and comparing routines, for example,
-by simply passing the name of one function into another.
-
-@item A built-in @code{stat} function
-The @code{stat} function would provide an easy-to-use hook to the
-@code{stat} system call so that @code{awk} programs could determine information
-about files.
-
-@item A built-in @code{ftw} function
-Combined with function valued variables and the @code{stat} function,
-@code{ftw} (file tree walk) would make it easy for an @code{awk} program
-to walk an entire file tree.
-@end ignore
+@table @asis
+@item Loadable Module Mechanics
+The current extension mechanism works
+(@pxref{Dynamic Extensions, ,Adding New Built-in Functions to @command{gawk}}),
+but is rather primitive. It requires a fair amount of manual work
+to create and integrate a loadable module.
+Nor is the current mechanism as portable as might be desired.
+The GNU @command{libtool} package provides a number of features that
+would make using loadable modules much easier.
+@command{gawk} should be changed to use @command{libtool}.
+
+@item Loadable Module Internals
+The API to its internals that @command{gawk} ``exports'' should be revised.
+Too many things are needlessly exposed. A new API should be designed
+and implemented to make module writing easier.
+
+@item Better Array Subscript Management
+@command{gawk}'s management of array subscript storage could use revamping,
+so that using the same value to index multiple arrays only
+stores one copy of the index value.
+
+@item Integrating the DBUG Library
+Integrating Fred Fish's DBUG library would be helpful during development,
+but it's a lot of work to do.
@end table
-This is a list of probable improvements that will make @code{gawk}
-perform better.
+Following is a list of probable improvements that will make @command{gawk}
+perform better:
@table @asis
@item An Improved Version of @code{dfa}
-The @code{dfa} pattern matcher from GNU @code{grep} has some
+The @code{dfa} pattern matcher from GNU @command{grep} has some
problems. Either a new version or a fixed one will deal with some
important regexp matching issues.
-@item Use of GNU @code{malloc}
-The GNU version of @code{malloc} could potentially speed up @code{gawk},
-since it relies heavily on the use of dynamic memory allocation.
-
-@end table
-
-@node Improvements, , Future Extensions, Notes
-@appendixsec Suggestions for Improvements
-
-Here are some projects that would-be @code{gawk} hackers might like to take
-on. They vary in size from a few days to a few weeks of programming,
-depending on which one you choose and how fast a programmer you are. Please
-send any improvements you write to the maintainers at the GNU project.
-@xref{Adding Code, , Adding New Features},
-for guidelines to follow when adding new features to @code{gawk}.
-@xref{Bugs, ,Reporting Problems and Bugs}, for information on
-contacting the maintainers.
-
-@enumerate
-@item
-Compilation of @code{awk} programs: @code{gawk} uses a Bison (YACC-like)
+@c NEXT ED: remove this item. awka and mawk do these respectively
+@item Compilation of @command{awk} programs
+@command{gawk} uses a Bison (YACC-like)
parser to convert the script given it into a syntax tree; the syntax
tree is then executed by a simple recursive evaluator. This method incurs
a lot of overhead, since the recursive evaluator performs many procedure
calls to do even the simplest things.
-It should be possible for @code{gawk} to convert the script's parse tree
+It should be possible for @command{gawk} to convert the script's parse tree
into a C program which the user would then compile, using the normal
-C compiler and a special @code{gawk} library to provide all the needed
-functions (regexps, fields, associative arrays, type coercion, and so
-on).
+C compiler and a special @command{gawk} library to provide all the needed
+functions (regexps, fields, associative arrays, type coercion, and so on).
-An easier possibility might be for an intermediate phase of @code{awk} to
+An easier possibility might be for an intermediate phase of @command{gawk} to
convert the parse tree into a linear byte code form like the one used
in GNU Emacs Lisp. The recursive evaluator would then be replaced by
a straight line byte code interpreter that would be intermediate in speed
-between running a compiled program and doing what @code{gawk} does
+between running a compiled program and doing what @command{gawk} does
now.
+@end table
-@item
-The programs in the test suite could use documenting in this @value{DOCUMENT}.
+Finally,
+the programs in the test suite could use documenting in this @value{DOCUMENT}.
-@item
-See the @file{FUTURES} file for more ideas. Contact us if you would
-seriously like to tackle any of the items listed there.
-@end enumerate
+@xref{Additions, ,Making Additions to @command{gawk}},
+if you are interested in tackling any of these projects.
+
+@node Basic Concepts, Glossary, Notes, Top
+@appendix Basic Programming Concepts
+@cindex basic programming concepts
+@cindex programming concepts, basic
+
+This @value{APPENDIX} attempts to define some of the basic concepts
+and terms that are used throughout the rest of this @value{DOCUMENT}.
+As this @value{DOCUMENT} is specifically about @command{awk},
+and not about computer programming in general, the coverage here
+is by necessity fairly cursory and simplistic.
+(If you need more background, there are many
+other introductory texts that you should refer to instead.)
+
+@menu
+* Basic High Level:: The high level view.
+* Basic Data Typing:: A very quick intro to data types.
+* Floating Point Issues:: Stuff to know about floating-point numbers.
+@end menu
+
+@node Basic High Level, Basic Data Typing, Basic Concepts, Basic Concepts
+@appendixsec What a Program Does
+
+@cindex processing data
+At the most basic level, the job of a program is to process
+some input data and produce results.
+
+@c NEXT ED: Use real images here
+@iftex
+@tex
+\expandafter\ifx\csname graph\endcsname\relax \csname newbox\endcsname\graph\fi
+\expandafter\ifx\csname graphtemp\endcsname\relax \csname newdimen\endcsname\graphtemp\fi
+\setbox\graph=\vtop{\vskip 0pt\hbox{%
+ \special{pn 20}%
+ \special{pa 2425 200}%
+ \special{pa 2850 200}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 20}%
+ \special{pa 2750 175}%
+ \special{pa 2850 200}%
+ \special{pa 2750 225}%
+ \special{pa 2750 175}%
+ \special{fp}%
+ \special{pn 20}%
+ \special{pa 850 200}%
+ \special{pa 1250 200}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 20}%
+ \special{pa 1150 175}%
+ \special{pa 1250 200}%
+ \special{pa 1150 225}%
+ \special{pa 1150 175}%
+ \special{fp}%
+ \special{pn 20}%
+ \special{pa 2950 400}%
+ \special{pa 3650 400}%
+ \special{pa 3650 0}%
+ \special{pa 2950 0}%
+ \special{pa 2950 400}%
+ \special{fp}%
+ \special{pn 10}%
+ \special{ar 1800 200 450 200 0 6.28319}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 3.300in\lower\graphtemp\hbox to 0pt{\hss Results\hss}}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 1.800in\lower\graphtemp\hbox to 0pt{\hss Program\hss}}%
+ \special{pn 10}%
+ \special{pa 0 400}%
+ \special{pa 700 400}%
+ \special{pa 700 0}%
+ \special{pa 0 0}%
+ \special{pa 0 400}%
+ \special{fp}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 0.350in\lower\graphtemp\hbox to 0pt{\hss Data\hss}}%
+ \hbox{\vrule depth0.400in width0pt height 0pt}%
+ \kern 3.650in
+ }%
+}%
+\centerline{\box\graph}
+@end tex
+@end iftex
+@ifnottex
+@example
+ _______
++------+ / \ +---------+
+| Data | -----> < Program > -----> | Results |
++------+ \_______/ +---------+
+@end example
+@end ifnottex
+
+@cindex compiled programs
+@cindex programs, compiled
+@cindex interpreted programs
+@cindex programs, interpreted
+The ``program'' in the figure can be either a compiled
+program@footnote{Compiled programs are typically written
+in lower-level languages such as C, C++, Fortran, or Ada,
+and then translated, or @dfn{compiled}, into a form that
+the computer can execute directly.}
+(such as @command{ls}),
+or it may be @dfn{interpreted}. In the latter case, a machine-executable
+program such as @command{awk} reads your program, and then uses the
+instructions in your program to process the data.
+
+@cindex programming, basic steps
+When you write a program, it usually consists
+of the following, very basic set of steps:
+
+@c NEXT ED: Use real images here
+@iftex
+@tex
+\expandafter\ifx\csname graph\endcsname\relax \csname newbox\endcsname\graph\fi
+\expandafter\ifx\csname graphtemp\endcsname\relax \csname newdimen\endcsname\graphtemp\fi
+\setbox\graph=\vtop{\vskip 0pt\hbox{%
+ \graphtemp=.5ex\advance\graphtemp by 0.600in
+ \rlap{\kern 2.800in\lower\graphtemp\hbox to 0pt{\hss Yes\hss}}%
+ \graphtemp=.5ex\advance\graphtemp by 0.100in
+ \rlap{\kern 3.300in\lower\graphtemp\hbox to 0pt{\hss No\hss}}%
+ \special{pn 8}%
+ \special{pa 2100 1000}%
+ \special{pa 1600 1000}%
+ \special{pa 1600 1000}%
+ \special{pa 1600 300}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 8}%
+ \special{pa 1575 400}%
+ \special{pa 1600 300}%
+ \special{pa 1625 400}%
+ \special{pa 1575 400}%
+ \special{fp}%
+ \special{pn 8}%
+ \special{pa 2600 500}%
+ \special{pa 2600 900}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 8}%
+ \special{pa 2625 800}%
+ \special{pa 2600 900}%
+ \special{pa 2575 800}%
+ \special{pa 2625 800}%
+ \special{fp}%
+ \special{pn 8}%
+ \special{pa 3200 200}%
+ \special{pa 4000 200}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 8}%
+ \special{pa 3900 175}%
+ \special{pa 4000 200}%
+ \special{pa 3900 225}%
+ \special{pa 3900 175}%
+ \special{fp}%
+ \special{pn 8}%
+ \special{pa 1400 200}%
+ \special{pa 2100 200}%
+ \special{fp}%
+ \special{sh 1.000}%
+ \special{pn 8}%
+ \special{pa 2000 175}%
+ \special{pa 2100 200}%
+ \special{pa 2000 225}%
+ \special{pa 2000 175}%
+ \special{fp}%
+ \special{pn 8}%
+ \special{ar 2600 1000 400 100 0 6.28319}%
+ \graphtemp=.5ex\advance\graphtemp by 1.000in
+ \rlap{\kern 2.600in\lower\graphtemp\hbox to 0pt{\hss Process\hss}}%
+ \special{pn 8}%
+ \special{pa 2200 400}%
+ \special{pa 3100 400}%
+ \special{pa 3100 0}%
+ \special{pa 2200 0}%
+ \special{pa 2200 400}%
+ \special{fp}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 2.688in\lower\graphtemp\hbox to 0pt{\hss More Data?\hss}}%
+ \special{pn 8}%
+ \special{ar 650 200 650 200 0 6.28319}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 0.613in\lower\graphtemp\hbox to 0pt{\hss Initialization\hss}}%
+ \special{pn 8}%
+ \special{ar 0 200 0 0 0 6.28319}%
+ \special{pn 8}%
+ \special{ar 4550 200 450 100 0 6.28319}%
+ \graphtemp=.5ex\advance\graphtemp by 0.200in
+ \rlap{\kern 4.600in\lower\graphtemp\hbox to 0pt{\hss Clean Up\hss}}%
+ \hbox{\vrule depth1.100in width0pt height 0pt}%
+ \kern 5.000in
+ }%
+}%
+\centerline{\box\graph}
+@end tex
+@end iftex
+@ifnottex
+@example
+ ______
++----------------+ / More \ No +----------+
+| Initialization | -------> < Data > -------> | Clean Up |
++----------------+ ^ \ ? / +----------+
+ | +--+-+
+ | | Yes
+ | |
+ | V
+ | +---------+
+ +-----+ Process |
+ +---------+
+@end example
+@end ifnottex
+
+@table @asis
+@item Initialization
+These are the things you do before actually starting to process
+data, such as checking arguments, initializing any data you need
+to work with, and so on.
+This step corresponds to @command{awk}'s @code{BEGIN} rule
+(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
+
+If you were baking a cake, this might consist of laying out all the
+mixing bowls and the baking pan, and making sure you have all the
+ingredients that you need.
+
+@item Processing
+This is where the actual work is done. Your program reads data,
+one logical chunk at a time, and processes it as appropriate.
+
+In most programming languages, you have to manually manage the reading
+of data, checking to see if there is more each time you read a chunk.
+@command{awk}'s pattern-action paradigm
+(@pxref{Getting Started, ,Getting Started with @command{awk}})
+handles the mechanics of this for you.
+
+In baking a cake, the processing corresponds to the actual labor:
+breaking eggs, mixing the flour, water, and other ingredients, and then putting the cake
+into the oven.
+
+@item Clean Up
+Once you've processed all the data, you may have things you need to
+do before exiting.
+This step corresponds to @command{awk}'s @code{END} rule
+(@pxref{BEGIN/END, ,The @code{BEGIN} and @code{END} Special Patterns}).
+
+After the cake comes out of the oven, you still have to wrap it in
+plastic wrap to keep anyone from tasting it, as well as wash
+the mixing bowls and other utensils.
+@end table
+
+@cindex algorithm, definition of
+An @dfn{algorithm} is a detailed set of instructions necessary to accomplish
+a task, or process data. It is much the same as a recipe for baking
+a cake. Programs implement algorithms. Often, it is up to you to design
+the algorithm and implement it, simultaneously.
+
+@cindex record, definition of
+@cindex fields, definition of
+The ``logical chunks'' we talked about previously are called @dfn{records},
+similar to the records a company keeps on employees, a school keeps for
+students, or a doctor keeps for patients.
+Each record has many component parts, such as first and last names,
+date of birth, address, and so on. The component parts are referred
+to as the @dfn{fields} of the record.
+
+The act of reading data is termed @dfn{input}, and that of
+generating results, not too surprisingly, is termed @dfn{output}.
+They are often referred to together as ``Input/Output,''
+and even more often, as ``I/O'' for short.
+(You will also see ``input'' and ``output'' used as verbs.)
+
+@cindex data-driven languages
+@cindex language, data-driven
+@command{awk} manages the reading of data for you, as well as the
+breaking it up into records and fields. Your program's job is to
+tell @command{awk} what to with the data. You do this by describing
+@dfn{patterns} in the data to look for, and @dfn{actions} to execute
+when those patterns are seen. This @dfn{data-driven} nature of
+@command{awk} programs usually makes them both easier to write
+and easier to read.
+
+@node Basic Data Typing, Floating Point Issues, Basic High Level, Basic Concepts
+@appendixsec Data Values in a Computer
+
+@cindex variable, definition of
+In a program,
+you keep track of information and values in things called @dfn{variables}.
+A variable is just a name for a given value, such as @code{first_name},
+@code{last_name}, @code{address}, and so on.
+@command{awk} has several pre-defined variables, and it has
+special names to refer to the current input record
+and the fields of the record.
+You may also group multiple
+associated values under one name, as an array.
+
+@cindex values, numeric
+@cindex values, string
+@cindex scalar, definition of
+Data, particularly in @command{awk}, consists of either numeric
+values, such as 42 or 3.1415927, or string values.
+String values are essentially anything that's not a number, such as a name.
+Strings are sometimes referred to as @dfn{character data}, since they
+store the individual characters that comprise them.
+Individual variables, as well as numeric and string variables, are
+referred to as @dfn{scalar} values.
+Groups of values, such as arrays, are not scalars.
+
+@cindex integer, definition of
+@cindex floating-point, definition of
+Within computers, there are two kinds of numeric values: @dfn{integers},
+and @dfn{floating-point}.
+In school, integer values were referred to as ``whole'' numbers---that is,
+numbers without any fractional part, such as 1, 42, or @minus{}17.
+The advantage to integer numbers is that they represent values exactly.
+The disadvantage is that their range is limited. On most modern systems,
+this range is @minus{}2,147,483,648 to 2,147,483,647.
+
+@cindex unsigned integers
+@cindex integer, unsigned
+Integer values come in two flavors: @dfn{signed} and @dfn{unsigned}.
+Signed values may be negative or positive, with the range of values just
+described.
+Unsigned values are always positive. On most modern systems,
+the range is from 0 to 4,294,967,295.
+
+@cindex double-precision floating-point, definition of
+@cindex single-precision floating-point, definition of
+Floating-point numbers represent what are called ``real'' numbers; i.e.,
+those that do have a fractional part, such as 3.1415927.
+The advantage to floating-point numbers is that they
+can represent a much larger range of values.
+The disadvantage is that there are numbers that they cannot represent
+exactly.
+@command{awk} uses @dfn{double-precision} floating-point numbers, which
+can hold more digits than @dfn{single-precision}
+floating-point numbers.
+Floating-point issues are discussed more fully in
+@ref{Floating Point Issues, ,Floating-Point Number Caveats}.
+
+At the very lowest level, computers store values as groups of binary digits,
+or @dfn{bits}. Modern computers group bits into groups of eight, called @dfn{bytes}.
+Advanced applications sometimes have to manipulate bits directly,
+and @command{gawk} provides functions for doing so.
+
+@cindex null string, definition of
+@cindex empty string, definition of
+While you are probably used to the idea of a number without a value (i.e., zero),
+it takes a bit more getting used to the idea of zero-length character data.
+Nevertheless, such a thing exists.
+It is called the @dfn{null string}.
+The null string is character data that has no value.
+In other words, it is empty. It is written in @command{awk} programs
+like this: @code{""}.
+
+Humans are used to working in decimal; i.e., base 10. In base 10,
+numbers go from 0 to 9, and then ``roll over'' into the next
+column. (Remember grade school? 42 is 4 times 10 plus 2.)
+
+There are other number bases though. Computers commonly use base 2
+or @dfn{binary}, base 8 or @dfn{octal}, and base 16 or @dfn{hexadecimal}.
+In binary, each column represents two times the value in the column to
+its right. Each column may contain either a 0 or a 1.
+Thus, binary 1010 represents 1 times 8, plus 0 times 4, plus 1 times 2,
+plus 0 times 1, or decimal 10.
+Octal and hexadecimal are discussed more in
+@ref{Non-decimal-numbers, ,Octal and Hexadecimal Numbers}.
+
+Programs are written in programming languages.
+Hundreds, if not thousands, of programming languages exist.
+One of the most popular is the C programming language.
+The C language had a very strong influence on the design of
+the @command{awk} language.
+
+@cindex Kernighan, Brian
+@cindex Ritchie, Dennis
+There have been several versions of C. The first is often referred to
+as ``K&R'' C, after the initials of Brian Kernighan and Dennis Ritchie,
+the authors of the first book on C. (Dennis Ritchie created the language,
+and Brian Kernighan was one of the creators of @command{awk}.)
+
+In the mid-1980's, an effort began to produce an international standard
+for C. This work culminated in 1989, with the production of the ANSI
+standard for C. This standard became an ISO standard in 1990.
+Where it makes sense, POSIX @command{awk} is compatible with 1990 ISO C.
+
+In 1999, a revised ISO C standard was approved and released.
+Future versions of @command{gawk} will be as compatible as possible
+with this standard.
+
+@node Floating Point Issues, , Basic Data Typing, Basic Concepts
+@appendixsec Floating-Point Number Caveats
+
+As mentioned earlier, floating-point numbers represent what are called
+``real'' numbers; i.e., those that have a fractional part. @command{awk}
+uses double-precision floating-point numbers to represent all
+numeric values. This @value{SECTION} describes some of the issues
+involved in using floating-point numbers.
+
+There is a very nice paper on floating-point arithmetic by
+David Goldberg, @cite{What Every
+Computer Scientist Should Know About Floating-point Arithmetic},
+@cite{ACM Computing Surveys} @strong{23}, 1 (1991-03),
+5-48.@footnote{@uref{http://www.validgh.com/goldberg/paper.ps}}
+This is worth reading if you are interested in the details,
+but it does require a background in Computer Science.
+
+Internally, @command{awk} keeps both the numeric value
+(double-precision floating-point) and the string value for a variable.
+Separately, @command{awk} keeps
+track of what type the variable has
+(@pxref{Typing and Comparison, ,Variable Typing and Comparison Expressions}),
+which plays a role in how variables are used in comparisons.
+
+It is important to note that the string value for a number may not
+reflect the full value (all the digits) that the numeric value
+actually contains.
+The following program (@file{values.awk}) illustrates this:
+
+@example
+@{
+ $1 = $2 + $3
+ # see it for what it is
+ printf("$1 = %.12g\n", $1)
+ # use CONVFMT
+ a = "<" $1 ">"
+ print "a =", a
+@group
+ # use OFMT
+ print "$1 =", $1
+@end group
+@}
+@end example
+
+@noindent
+This program shows the full value of the sum of @code{$2} and @code{$3}
+using @code{printf}, and then prints the string values obtained
+from both automatic conversion (via @code{CONVFMT}) and
+from printing (via @code{OFMT}).
+
+Here is what happens when the program is run:
+
+@example
+$ echo 2 3.654321 1.2345678 | awk -f values.awk
+@print{} $1 = 4.8888888
+@print{} a = <4.88889>
+@print{} $1 = 4.88889
+@end example
+
+This makes it clear that the full numeric value is different from
+what the default string representations show.
+
+@code{CONVFMT}'s default value is @code{"%.6g"}, which yields a value with
+at least six significant digits. For some applications, you might want to
+change it to specify more precision.
+On most modern machines, most of the time,
+17 digits is enough to capture a floating-point number's
+value exactly.@footnote{Pathological cases can require up to
+752 digits (!), but we doubt that you need to worry about this.}
+
+@cindex floating-point, precision issues
+Unlike numbers in the abstract sense (such as what you studied in high school
+or college math), numbers stored in computers are limited in certain ways.
+They cannot represent an infinite number of digits, nor can they always
+represent things exactly.
+In particular,
+floating-point numbers cannot
+always represent values exactly. Here is an example:
-@node Glossary, Copying, Notes, Top
-@appendix Glossary
+@example
+$ awk '@{ printf("%010d\n", $1 * 100) @}'
+515.79
+@print{} 0000051579
+515.80
+@print{} 0000051579
+515.81
+@print{} 0000051580
+515.82
+@print{} 0000051582
+@kbd{Ctrl-d}
+@end example
+
+@noindent
+This shows that some values can be represented exactly,
+whereas others are only approximated. This is not a ``bug''
+in @command{awk}, but simply an artifact of how computers
+represent numbers.
+
+@cindex negative zero
+@cindex positive zero
+@cindex zero, negative vs.@: positive
+@cindex floating-point, positive and negative values for zero
+Another peculiarity of floating-point numbers on modern systems
+is that they often have more than one representation for the number zero!
+In particular, it is possible to represent ``minus zero'' as well as
+regular, or ``positive'' zero.
+
+This example shows that negative and positive zero are distinct values
+when stored internally, but that they are in fact equal to each other,
+as well as to ``regular'' zero:
+
+@smallexample
+$ gawk 'BEGIN @{ mz = -0 ; pz = 0
+> printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz
+> printf "mz == 0 -> %d, pz == 0 -> %d\n", mz == 0, pz == 0
+> @}'
+@print{} -0 = -0, +0 = 0, (-0 == +0) -> 1
+@print{} mz == 0 -> 1, pz == 0 -> 1
+@end smallexample
+
+It helps to keep this in mind should you process numeric data
+that contains negative zero values; the fact that the zero is negative
+is noted and can affect comparisons.
+
+@node Glossary, Copying, Basic Concepts, Top
+@unnumbered Glossary
@table @asis
@item Action
-A series of @code{awk} statements attached to a rule. If the rule's
-pattern matches an input record, @code{awk} executes the
+A series of @command{awk} statements attached to a rule. If the rule's
+pattern matches an input record, @command{awk} executes the
rule's action. Actions are always enclosed in curly braces.
-@xref{Action Overview, ,Overview of Actions}.
+(@xref{Action Overview, ,Actions}.)
-@item Amazing @code{awk} Assembler
+@cindex Spencer, Henry
+@cindex @command{sed} utility
+@cindex amazing @command{awk} assembler (@command{aaa})
+@item Amazing @command{awk} Assembler
Henry Spencer at the University of Toronto wrote a retargetable assembler
-completely as @code{awk} scripts. It is thousands of lines long, including
-machine descriptions for several eight-bit microcomputers.
-It is a good example of a
-program that would have been better written in another language.
-
-@item Amazingly Workable Formatter (@code{awf})
+completely as @command{sed} and @command{awk} scripts. It is thousands
+of lines long, including machine descriptions for several eight-bit
+microcomputers. It is a good example of a program that would have been
+better written in another language.
+You can get it from @uref{ftp://ftp.freefriends.org/arnold/Awkstuff/aaa.tgz}.
+
+@cindex amazingly workable formatter (@command{awf})
+@cindex @command{awf} (amazingly workable formatter) program
+@item Amazingly Workable Formatter (@command{awf})
Henry Spencer at the University of Toronto wrote a formatter that accepts
a large subset of the @samp{nroff -ms} and @samp{nroff -man} formatting
-commands, using @code{awk} and @code{sh}.
+commands, using @command{awk} and @command{sh}.
+It is available over the Internet
+from @uref{ftp://ftp.freefriends.org/arnold/Awkstuff/awf.tgz}.
+
+@item Anchor
+The regexp metacharacters @samp{^} and @samp{$}, which force the match
+to the beginning or end of the string, respectively.
+@cindex ANSI
@item ANSI
The American National Standards Institute. This organization produces
many standards, among them the standards for the C and C++ programming
languages.
+These standards often become international standards as well. See also
+``ISO.''
+
+@item Array
+A grouping of multiple values under the same name.
+Most languages just provide sequential arrays.
+@command{awk} provides associative arrays.
+
+@item Assertion
+A statement in a program that a condition is true at this point in the program.
+Useful for reasoning about how a program is supposed to behave.
@item Assignment
-An @code{awk} expression that changes the value of some @code{awk}
+An @command{awk} expression that changes the value of some @command{awk}
variable or data object. An object that you can assign to is called an
@dfn{lvalue}. The assigned values are called @dfn{rvalues}.
@xref{Assignment Ops, ,Assignment Expressions}.
-@item @code{awk} Language
-The language in which @code{awk} programs are written.
+@item Associative Array
+Arrays in which the indices may be numbers or strings, not just
+sequential integers in a fixed range.
+
+@item @command{awk} Language
+The language in which @command{awk} programs are written.
-@item @code{awk} Program
-An @code{awk} program consists of a series of @dfn{patterns} and
+@item @command{awk} Program
+An @command{awk} program consists of a series of @dfn{patterns} and
@dfn{actions}, collectively known as @dfn{rules}. For each input record
given to the program, the program's rules are all processed in turn.
-@code{awk} programs may also contain function definitions.
+@command{awk} programs may also contain function definitions.
-@item @code{awk} Script
-Another name for an @code{awk} program.
+@item @command{awk} Script
+Another name for an @command{awk} program.
@item Bash
-The GNU version of the standard shell (the Bourne-Again shell).
-See ``Bourne Shell.''
+The GNU version of the standard shell
+@iftex
+(the @b{B}ourne-@b{A}gain @b{SH}ell).
+@end iftex
+@ifnottex
+(the Bourne-Again SHell).
+@end ifnottex
+See also ``Bourne Shell.''
@item BBS
See ``Bulletin Board System.''
+@item Bit
+Short for ``Binary Digit.''
+All values in computer memory ultimately reduce to binary digits: values
+that are either zero or one.
+Groups of bits may be interpreted differently---as integers,
+floating-point numbers, character data, addresses of other
+memory objects, or other data.
+@command{awk} lets you work with floating-point numbers and strings.
+@command{gawk} lets you manipulate bit values with the built-in
+functions described in
+@ref{Bitwise Functions, ,Using @command{gawk}'s Bit Manipulation Functions}.
+
+Computers are often defined by how many bits they use to represent integer
+values. Typical systems are 32-bit systems, but 64-bit systems are
+becoming increasingly popular, and 16-bit systems are waning in
+popularity.
+
@item Boolean Expression
-Named after the English mathematician Boole. See ``Logical Expression.''
+Named after the English mathematician Boole. See also ``Logical Expression.''
@item Bourne Shell
The standard shell (@file{/bin/sh}) on Unix and Unix-like systems,
originally written by Steven R.@: Bourne.
-Many shells (Bash, @code{ksh}, @code{pdksh}, @code{zsh}) are
+Many shells (@command{bash}, @command{ksh}, @command{pdksh}, @command{zsh}) are
generally upwardly compatible with the Bourne shell.
@item Built-in Function
-The @code{awk} language provides built-in functions that perform various
-numerical, time stamp related, and string computations. Examples are
+The @command{awk} language provides built-in functions that perform various
+numerical, I/O-related, and string computations. Examples are
@code{sqrt} (for the square root of a number) and @code{substr} (for a
-substring of a string). @xref{Built-in, ,Built-in Functions}.
+substring of a string).
+@command{gawk} provides functions for timestamp management, bit manipulation,
+and runtime string translation.
+(@xref{Built-in, ,Built-in Functions}.)
@item Built-in Variable
-@code{ARGC}, @code{ARGIND}, @code{ARGV}, @code{CONVFMT}, @code{ENVIRON},
-@code{ERRNO}, @code{FIELDWIDTHS}, @code{FILENAME}, @code{FNR}, @code{FS},
-@code{IGNORECASE}, @code{NF}, @code{NR}, @code{OFMT}, @code{OFS}, @code{ORS},
-@code{RLENGTH}, @code{RSTART}, @code{RS}, @code{RT}, and @code{SUBSEP},
-are the variables that have special meaning to @code{awk}.
-Changing some of them affects @code{awk}'s running environment.
-Several of these variables are specific to @code{gawk}.
-@xref{Built-in Variables}.
+@code{ARGC},
+@code{ARGV},
+@code{CONVFMT},
+@code{ENVIRON},
+@code{FILENAME},
+@code{FNR},
+@code{FS},
+@code{NF},
+@code{NR},
+@code{OFMT},
+@code{OFS},
+@code{ORS},
+@code{RLENGTH},
+@code{RSTART},
+@code{RS},
+and
+@code{SUBSEP}
+are the variables that have special meaning to @command{awk}.
+In addition,
+@code{ARGIND},
+@code{BINMODE},
+@code{ERRNO},
+@code{FIELDWIDTHS},
+@code{IGNORECASE},
+@code{LINT},
+@code{PROCINFO},
+@code{RT},
+and
+@code{TEXTDOMAIN}
+are the variables that have special meaning to @command{gawk}.
+Changing some of them affects @command{awk}'s running environment.
+(@xref{Built-in Variables}.)
@item Braces
See ``Curly Braces.''
@@ -20164,11 +24688,19 @@ board.
@item C
The system programming language that most GNU software is written in. The
-@code{awk} programming language has C-like syntax, and this @value{DOCUMENT}
-points out similarities between @code{awk} and C when appropriate.
+@command{awk} programming language has C-like syntax, and this @value{DOCUMENT}
+points out similarities between @command{awk} and C when appropriate.
+
+In general, @command{gawk} attempts to be as similar to the 1990 version
+of ISO C as makes sense. Future versions of @command{gawk} may adopt features
+from the newer 1999 standard, as appropriate.
+
+@item C++
+A popular object-oriented programming language derived from C.
@cindex ISO 8859-1
@cindex ISO Latin-1
+@cindex character sets (machine character encodings)
@item Character Set
The set of numeric codes used by a computer system to represent the
characters (letters, numbers, punctuation, etc.) of a particular country
@@ -20176,156 +24708,255 @@ or place. The most common character set in use today is ASCII (American
Standard Code for Information Interchange). Many European
countries use an extension of ASCII known as ISO-8859-1 (ISO Latin-1).
+@cindex @command{chem} utility
@item CHEM
-A preprocessor for @code{pic} that reads descriptions of molecules
-and produces @code{pic} input for drawing them. It was written in @code{awk}
+A preprocessor for @command{pic} that reads descriptions of molecules
+and produces @command{pic} input for drawing them.
+It was written in @command{awk}
by Brian Kernighan and Jon Bentley, and is available from
-@email{@w{netlib@@research.bell-labs.com}}.
+@uref{http://cm.bell-labs.com/netlib/typesetting/chem.gz}.
+
+@item Coprocess
+A subordinate program with which two-way communications is possible.
+
+@cindex compiled programs
+@item Compiler
+A program that translates human-readable source code into
+machine-executable object code. The object code is then executed
+directly by the computer.
+See also ``Interpreter.''
@item Compound Statement
-A series of @code{awk} statements, enclosed in curly braces. Compound
+A series of @command{awk} statements, enclosed in curly braces. Compound
statements may be nested.
-@xref{Statements, ,Control Statements in Actions}.
+(@xref{Statements, ,Control Statements in Actions}.)
@item Concatenation
Concatenating two strings means sticking them together, one after another,
-giving a new string. For example, the string @samp{foo} concatenated with
+producing a new string. For example, the string @samp{foo} concatenated with
the string @samp{bar} gives the string @samp{foobar}.
-@xref{Concatenation, ,String Concatenation}.
+(@xref{Concatenation, ,String Concatenation}.)
@item Conditional Expression
An expression using the @samp{?:} ternary operator, such as
@samp{@var{expr1} ? @var{expr2} : @var{expr3}}. The expression
@var{expr1} is evaluated; if the result is true, the value of the whole
-expression is the value of @var{expr2}, otherwise the value is
+expression is the value of @var{expr2}; otherwise the value is
@var{expr3}. In either case, only one of @var{expr2} and @var{expr3}
-is evaluated. @xref{Conditional Exp, ,Conditional Expressions}.
+is evaluated. (@xref{Conditional Exp, ,Conditional Expressions}.)
@item Comparison Expression
A relation that is either true or false, such as @samp{(a < b)}.
Comparison expressions are used in @code{if}, @code{while}, @code{do},
and @code{for}
statements, and in patterns to select which input records to process.
-@xref{Typing and Comparison, ,Variable Typing and Comparison Expressions}.
+(@xref{Typing and Comparison, ,Variable Typing and Comparison Expressions}.)
@item Curly Braces
The characters @samp{@{} and @samp{@}}. Curly braces are used in
-@code{awk} for delimiting actions, compound statements, and function
+@command{awk} for delimiting actions, compound statements, and function
bodies.
+@cindex dark corner
@item Dark Corner
An area in the language where specifications often were (or still
are) not clear, leading to unexpected or undesirable behavior.
-Such areas are marked in this @value{DOCUMENT} with ``(d.c.)'' in the
-text, and are indexed under the heading ``dark corner.''
+Such areas are marked in this @value{DOCUMENT} with
+@iftex
+the picture of a flashlight in the margin
+@end iftex
+@ifnottex
+``(d.c.)'' in the text
+@end ifnottex
+and are indexed under the heading ``dark corner.''
+
+@item Data Driven
+A description of @command{awk} programs, where you specify the data you
+are interested in processing, and what to do when that data is seen.
@item Data Objects
These are numbers and strings of characters. Numbers are converted into
strings and vice versa, as needed.
-@xref{Conversion, ,Conversion of Strings and Numbers}.
+(@xref{Conversion, ,Conversion of Strings and Numbers}.)
+
+@item Deadlock
+The situation in which two communicating processes are each waiting
+for the other to perform an action.
-@item Double Precision
+@item Double-Precision
An internal representation of numbers that can have fractional parts.
-Double precision numbers keep track of more digits than do single precision
-numbers, but operations on them are more expensive. This is the way
-@code{awk} stores numeric values. It is the C type @code{double}.
+Double-precision numbers keep track of more digits than do single-precision
+numbers, but operations on them are sometimes more expensive. This is the way
+@command{awk} stores numeric values. It is the C type @code{double}.
@item Dynamic Regular Expression
A dynamic regular expression is a regular expression written as an
ordinary expression. It could be a string constant, such as
@code{"foo"}, but it may also be an expression whose value can vary.
-@xref{Computed Regexps, , Using Dynamic Regexps}.
+(@xref{Computed Regexps, , Using Dynamic Regexps}.)
@item Environment
A collection of strings, of the form @var{name@code{=}val}, that each
program has available to it. Users generally place values into the
environment in order to provide information to various programs. Typical
-examples are the environment variables @code{HOME} and @code{PATH}.
+examples are the environment variables @env{HOME} and @env{PATH}.
@item Empty String
See ``Null String.''
+@cindex epoch, definition of
+@item Epoch
+The date used as the ``beginning of time'' for timestamps.
+Time values in Unix systems are represented as seconds since the epoch,
+with library functions available for converting these values into
+standard date and time formats.
+
+The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC.
+See also ``GMT'' and ``UTC.''
+
@item Escape Sequences
A special sequence of characters used for describing non-printing
-characters, such as @samp{\n} for newline, or @samp{\033} for the ASCII
-ESC (escape) character. @xref{Escape Sequences}.
+characters, such as @samp{\n} for newline or @samp{\033} for the ASCII
+ESC (Escape) character. (@xref{Escape Sequences}.)
+
+@item FDL
+See ``Free Documentation License.''
@item Field
-When @code{awk} reads an input record, it splits the record into pieces
-separated by whitespace (or by a separator regexp which you can
+When @command{awk} reads an input record, it splits the record into pieces
+separated by whitespace (or by a separator regexp that you can
change by setting the built-in variable @code{FS}). Such pieces are
called fields. If the pieces are of fixed length, you can use the built-in
variable @code{FIELDWIDTHS} to describe their lengths.
-@xref{Field Separators, ,Specifying How Fields are Separated},
-and also see
-@xref{Constant Size, , Reading Fixed-width Data}.
+(@xref{Field Separators, ,Specifying How Fields Are Separated},
+and
+@ref{Constant Size, ,Reading Fixed-Width Data}.)
-@item Floating Point Number
-Often referred to in mathematical terms as a ``rational'' number, this is
-just a number that can have a fractional part.
-See ``Double Precision'' and ``Single Precision.''
+@item Flag
+A variable whose truth value indicates the existence or non-existence
+of some condition.
+
+@item Floating-Point Number
+Often referred to in mathematical terms as a ``rational'' or real number,
+this is just a number that can have a fractional part.
+See also ``Double-Precision'' and ``Single-Precision.''
@item Format
Format strings are used to control the appearance of output in the
-@code{printf} statement. Also, data conversions from numbers to strings
+@code{strftime} and @code{sprintf} functions, and are used in the
+@code{printf} statement as well. Also, data conversions from numbers to strings
are controlled by the format string contained in the built-in variable
-@code{CONVFMT}. @xref{Control Letters, ,Format-Control Letters}.
+@code{CONVFMT}. (@xref{Control Letters, ,Format-Control Letters}.)
+
+@item Free Documentation License
+This document describes the terms under which this @value{DOCUMENT}
+is published and may be copied. (@xref{GNU Free Documentation License}.)
@item Function
A specialized group of statements used to encapsulate general
-or program-specific tasks. @code{awk} has a number of built-in
+or program-specific tasks. @command{awk} has a number of built-in
functions, and also allows you to define your own.
-@xref{Built-in, ,Built-in Functions},
-and @ref{User-defined, ,User-defined Functions}.
+(@xref{Functions}.)
@item FSF
See ``Free Software Foundation.''
+@cindex FSF
+@cindex Free Software Foundation
+@cindex Stallman, Richard
@item Free Software Foundation
A non-profit organization dedicated
to the production and distribution of freely distributable software.
It was founded by Richard M.@: Stallman, the author of the original
Emacs editor. GNU Emacs is the most widely used version of Emacs today.
-@item @code{gawk}
-The GNU implementation of @code{awk}.
+@item @command{gawk}
+The GNU implementation of @command{awk}.
+@cindex GPL
+@cindex General Public License
+@cindex GNU General Public License
@item General Public License
-This document describes the terms under which @code{gawk} and its source
-code may be distributed. (@pxref{Copying, ,GNU GENERAL PUBLIC LICENSE})
+This document describes the terms under which @command{gawk} and its source
+code may be distributed. (@xref{Copying, ,GNU General Public License}.)
+
+@item GMT
+``Greenwich Mean Time.''
+This is the old term for UTC.
+It is the time of day used as the epoch for Unix and POSIX systems.
+See also ``Epoch'' and ``UTC.''
+@cindex FSF
+@cindex Free Software Foundation
+@cindex GNU Project
@item GNU
``GNU's not Unix''. An on-going project of the Free Software Foundation
to create a complete, freely distributable, POSIX-compliant computing
environment.
+@item GNU/Linux
+A variant of the GNU system using the Linux kernel, instead of the
+Free Software Foundation's Hurd kernel.
+Linux is a stable, efficient, full-featured clone of Unix that has
+been ported to a variety of architectures.
+It is most popular on PC-class systems, but runs well on a variety of
+other systems too.
+The Linux kernel source code is available under the terms of the GNU General
+Public License, which is perhaps its most important aspect.
+
@item GPL
See ``General Public License.''
@item Hexadecimal
-Base 16 notation, where the digits are @code{0}-@code{9} and
-@code{A}-@code{F}, with @samp{A}
-representing 10, @samp{B} representing 11, and so on up to @samp{F} for 15.
+Base 16 notation, where the digits are @code{0}--@code{9} and
+@code{A}--@code{F}, with @samp{A}
+representing 10, @samp{B} representing 11, and so on, up to @samp{F} for 15.
Hexadecimal numbers are written in C using a leading @samp{0x},
-to indicate their base. Thus, @code{0x12} is 18 (one times 16 plus 2).
+to indicate their base. Thus, @code{0x12} is 18 (1 times 16 plus 2).
@item I/O
Abbreviation for ``Input/Output,'' the act of moving data into and/or
out of a running program.
@item Input Record
-A single chunk of data read in by @code{awk}. Usually, an @code{awk} input
+A single chunk of data that is read in by @command{awk}. Usually, an @command{awk} input
record consists of one line of text.
-@xref{Records, ,How Input is Split into Records}.
+(@xref{Records, ,How Input Is Split into Records}.)
@item Integer
-A whole number, i.e.@: a number that does not have a fractional part.
+A whole number, i.e., a number that does not have a fractional part.
+
+@item Internationalization
+The process of writing or modifying a program so
+that it can use multiple languages without requiring
+further source code changes.
+
+@cindex interpreted programs
+@item Interpreter
+A program that reads human-readable source code directly, and uses
+the instructions in it to process data and produce results.
+@command{awk} is typically (but not always) implemented as an interpreter.
+See also ``Compiler.''
+
+@item Interval Expression
+A component of a regular expression that lets you specify repeated matches of
+some part of the regexp. Interval expressions were not traditionally available
+in @command{awk} programs.
+
+@cindex ISO
+@item ISO
+The International Standards Organization.
+This organization produces international standards for many things, including
+programming languages, such as C and C++.
+In the computer arena, important standards like those for C, C++, and POSIX
+become both American national and ISO international standards simultaneously.
+This @value{DOCUMENT} refers to Standard C as ``ISO C'' throughout.
@item Keyword
-In the @code{awk} language, a keyword is a word that has special
+In the @command{awk} language, a keyword is a word that has special
meaning. Keywords are reserved and may not be used as variable names.
-@code{gawk}'s keywords are:
+@command{gawk}'s keywords are:
@code{BEGIN},
@code{END},
@code{if},
@@ -20341,88 +24972,124 @@ meaning. Keywords are reserved and may not be used as variable names.
@code{nextfile},
@code{function},
@code{func},
-and @code{exit}.
+and
+@code{exit}.
+
+@cindex LGPL
+@cindex Lesser General Public License
+@cindex GNU Lesser General Public License
+@item Lesser General Public License
+This document describes the terms under which binary library archives
+or shared objects,
+and their source code may be distributed.
+
+@item Linux
+See ``GNU/Linux.''
+
+@item LGPL
+See ``Lesser General Public License.''
+
+@item Localization
+The process of providing the data necessary for an
+internationalized program to work in a particular language.
@item Logical Expression
An expression using the operators for logic, AND, OR, and NOT, written
-@samp{&&}, @samp{||}, and @samp{!} in @code{awk}. Often called Boolean
+@samp{&&}, @samp{||}, and @samp{!} in @command{awk}. Often called Boolean
expressions, after the mathematician who pioneered this kind of
mathematical logic.
@item Lvalue
An expression that can appear on the left side of an assignment
operator. In most languages, lvalues can be variables or array
-elements. In @code{awk}, a field designator can also be used as an
+elements. In @command{awk}, a field designator can also be used as an
lvalue.
+@item Matching
+The act of testing a string against a regular expression. If the
+regexp describes the contents of the string, it is said to @dfn{match} it.
+
+@item Metacharacters
+Characters used within a regexp that do not stand for themselves.
+Instead, they denote regular expression operations, such as repetition,
+grouping, or alternation.
+
@item Null String
A string with no characters in it. It is represented explicitly in
-@code{awk} programs by placing two double-quote characters next to
+@command{awk} programs by placing two double quote characters next to
each other (@code{""}). It can appear in input data by having two successive
occurrences of the field separator appear next to each other.
@item Number
-A numeric valued data object. The @code{gawk} implementation uses double
-precision floating point to represent numbers.
-Very old @code{awk} implementations use single precision floating
-point.
+A numeric-valued data object. Modern @command{awk} implementations use
+double-precision floating-point to represent numbers.
+Very old @command{awk} implementations use single-precision floating-point.
@item Octal
-Base-eight notation, where the digits are @code{0}-@code{7}.
+Base-eight notation, where the digits are @code{0}--@code{7}.
Octal numbers are written in C using a leading @samp{0},
to indicate their base. Thus, @code{013} is 11 (one times 8 plus 3).
+@cindex P1003.2 POSIX standard
+@item P1003.2
+See ``POSIX.''
+
@item Pattern
-Patterns tell @code{awk} which input records are interesting to which
+Patterns tell @command{awk} which input records are interesting to which
rules.
A pattern is an arbitrary conditional expression against which input is
tested. If the condition is satisfied, the pattern is said to @dfn{match}
the input record. A typical pattern might compare the input record against
-a regular expression. @xref{Pattern Overview, ,Pattern Elements}.
+a regular expression. (@xref{Pattern Overview, ,Pattern Elements}.)
@item POSIX
-The name for a series of standards being developed by the IEEE
+The name for a series of standards
+@c being developed by the IEEE
that specify a Portable Operating System interface. The ``IX'' denotes
the Unix heritage of these standards. The main standard of interest for
-@code{awk} users is
+@command{awk} users is
@cite{IEEE Standard for Information Technology, Standard 1003.2-1992,
Portable Operating System Interface (POSIX) Part 2: Shell and Utilities}.
Informally, this standard is often referred to as simply ``P1003.2.''
+@item Precedence
+The order in which operations are performed when operators are used
+without explicit parentheses.
+
@item Private
Variables and/or functions that are meant for use exclusively by library
-functions, and not for the main @code{awk} program. Special care must be
+functions and not for the main @command{awk} program. Special care must be
taken when naming such variables and functions.
-@xref{Library Names, , Naming Library Function Global Variables}.
+(@xref{Library Names, , Naming Library Function Global Variables}.)
@item Range (of input lines)
-A sequence of consecutive lines from the input file. A pattern
-can specify ranges of input lines for @code{awk} to process, or it can
-specify single lines. @xref{Pattern Overview, ,Pattern Elements}.
+A sequence of consecutive lines from the input file(s). A pattern
+can specify ranges of input lines for @command{awk} to process or it can
+specify single lines. (@xref{Pattern Overview, ,Pattern Elements}.)
@item Recursion
When a function calls itself, either directly or indirectly.
If this isn't clear, refer to the entry for ``recursion.''
@item Redirection
-Redirection means performing input from other than the standard input
-stream, or output to other than the standard output stream.
+Redirection means performing input from something other than the standard input
+stream, or performing output to something other than the standard output stream.
You can redirect the output of the @code{print} and @code{printf} statements
-to a file or a system command, using the @samp{>}, @samp{>>}, and @samp{|}
+to a file or a system command, using the @samp{>}, @samp{>>}, @samp{|}, and @samp{|&}
operators. You can redirect input to the @code{getline} statement using
-the @samp{<} and @samp{|} operators.
-@xref{Redirection, ,Redirecting Output of @code{print} and @code{printf}},
-and @ref{Getline, ,Explicit Input with @code{getline}}.
+the @samp{<}, @samp{|}, and @samp{|&} operators.
+(@xref{Redirection, ,Redirecting Output of @code{print} and @code{printf}},
+and @ref{Getline, ,Explicit Input with @code{getline}}.)
@item Regexp
Short for @dfn{regular expression}. A regexp is a pattern that denotes a
set of strings, possibly an infinite set. For example, the regexp
@samp{R.*xp} matches any string starting with the letter @samp{R}
-and ending with the letters @samp{xp}. In @code{awk}, regexps are
+and ending with the letters @samp{xp}. In @command{awk}, regexps are
used in patterns and in conditional expressions. Regexps may contain
-escape sequences. @xref{Regexp, ,Regular Expressions}.
+escape sequences. (@xref{Regexp, ,Regular Expressions}.)
@item Regular Expression
See ``regexp.''
@@ -20430,89 +25097,129 @@ See ``regexp.''
@item Regular Expression Constant
A regular expression constant is a regular expression written within
slashes, such as @code{/foo/}. This regular expression is chosen
-when you write the @code{awk} program, and cannot be changed doing
-its execution. @xref{Regexp Usage, ,How to Use Regular Expressions}.
+when you write the @command{awk} program and cannot be changed during
+its execution. (@xref{Regexp Usage, ,How to Use Regular Expressions}.)
@item Rule
-A segment of an @code{awk} program that specifies how to process single
+A segment of an @command{awk} program that specifies how to process single
input records. A rule consists of a @dfn{pattern} and an @dfn{action}.
-@code{awk} reads an input record; then, for each rule, if the input record
-satisfies the rule's pattern, @code{awk} executes the rule's action.
+@command{awk} reads an input record; then, for each rule, if the input record
+satisfies the rule's pattern, @command{awk} executes the rule's action.
Otherwise, the rule does nothing for that input record.
@item Rvalue
A value that can appear on the right side of an assignment operator.
-In @code{awk}, essentially every expression has a value. These values
+In @command{awk}, essentially every expression has a value. These values
are rvalues.
-@item @code{sed}
+@item Scalar
+A single value, be it a number or a string.
+Regular variables are scalars; arrays and functions are not.
+
+@item Search Path
+In @command{gawk}, a list of directories to search for @command{awk} program source files.
+In the shell, a list of directories to search for executable programs.
+
+@item Seed
+The initial value, or starting point, for a sequence of random numbers.
+
+@item @command{sed}
See ``Stream Editor.''
+@item Shell
+The command interpreter for Unix and POSIX-compliant systems.
+The shell works both interactively, and as a programming language
+for batch files, or shell scripts.
+
@item Short-Circuit
-The nature of the @code{awk} logical operators @samp{&&} and @samp{||}.
-If the value of the entire expression can be deduced from evaluating just
-the left-hand side of these operators, the right-hand side will not
-be evaluated
-(@pxref{Boolean Ops, ,Boolean Expressions}).
+The nature of the @command{awk} logical operators @samp{&&} and @samp{||}.
+If the value of the entire expression is determinable from evaluating just
+the lefthand side of these operators, the righthand side is not
+evaluated.
+(@xref{Boolean Ops, ,Boolean Expressions}.)
@item Side Effect
A side effect occurs when an expression has an effect aside from merely
producing a value. Assignment expressions, increment and decrement
-expressions and function calls have side effects.
-@xref{Assignment Ops, ,Assignment Expressions}.
+expressions, and function calls have side effects.
+(@xref{Assignment Ops, ,Assignment Expressions}.)
-@item Single Precision
+@item Single-Precision
An internal representation of numbers that can have fractional parts.
-Single precision numbers keep track of fewer digits than do double precision
-numbers, but operations on them are less expensive in terms of CPU time.
-This is the type used by some very old versions of @code{awk} to store
+Single-precision numbers keep track of fewer digits than do double-precision
+numbers, but operations on them are sometimes less expensive in terms of CPU time.
+This is the type used by some very old versions of @command{awk} to store
numeric values. It is the C type @code{float}.
@item Space
The character generated by hitting the space bar on the keyboard.
@item Special File
-A file name interpreted internally by @code{gawk}, instead of being handed
-directly to the underlying operating system. For example, @file{/dev/stderr}.
-@xref{Special Files, ,Special File Names in @code{gawk}}.
+A @value{FN} interpreted internally by @command{gawk}, instead of being handed
+directly to the underlying operating system---for example, @file{/dev/stderr}.
+(@xref{Special Files, ,Special @value{FFN}s in @command{gawk}}.)
@item Stream Editor
A program that reads records from an input stream and processes them one
or more at a time. This is in contrast with batch programs, which may
expect to read their input files in entirety before starting to do
-anything, and with interactive programs, which require input from the
+anything, as well as with interactive programs which require input from the
user.
@item String
A datum consisting of a sequence of characters, such as @samp{I am a
-string}. Constant strings are written with double-quotes in the
-@code{awk} language, and may contain escape sequences.
-@xref{Escape Sequences}.
+string}. Constant strings are written with double quotes in the
+@command{awk} language and may contain escape sequences.
+(@xref{Escape Sequences}.)
@item Tab
The character generated by hitting the @kbd{TAB} key on the keyboard.
It usually expands to up to eight spaces upon output.
+@item Text Domain
+A unique name that identifies an application.
+Used for grouping messages that are translated at runtime
+into the local language.
+
+@item Timestamp
+A value in the ``seconds since the epoch'' format used by Unix
+and POSIX systems. Used for the @command{gawk} functions
+@code{mktime}, @code{strftime}, and @code{systime}.
+See also ``Epoch'' and ``UTC.''
+
+@cindex Linux
+@cindex GNU/Linux
+@cindex Unix
+@cindex BSD-based operating systems
+@cindex NetBSD
+@cindex FreeBSD
+@cindex OpenBSD
@item Unix
A computer operating system originally developed in the early 1970's at
AT&T Bell Laboratories. It initially became popular in universities around
-the world, and later moved into commercial evnironments as a software
+the world and later moved into commercial environments as a software
development system and network server system. There are many commercial
versions of Unix, as well as several work-alike systems whose source code
-is freely available (such as Linux, NetBSD, and FreeBSD).
+is freely available (such as GNU/Linux, NetBSD, FreeBSD, and OpenBSD).
+
+@item UTC
+The accepted abbreviation for ``Universal Coordinated Time.''
+This is standard time in Greenwich, England, which is used as a
+reference time for day and date calculations.
+See also ``Epoch'' and ``GMT.''
@item Whitespace
A sequence of space, tab, or newline characters occurring inside an input
record or a string.
@end table
-@node Copying, Index, Glossary, Top
-@unnumbered GNU GENERAL PUBLIC LICENSE
+@node Copying, GNU Free Documentation License, Glossary, Top
+@unnumbered GNU General Public License
@center Version 2, June 1991
@display
Copyright @copyright{} 1989, 1991 Free Software Foundation, Inc.
-59 Temple Place --- Suite 330, Boston, MA 02111-1307, USA
+59 Temple Place, Suite 330, Boston, MA 02111, USA
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
@@ -20569,10 +25276,10 @@ patent must be licensed for everyone's free use or not licensed at all.
The precise terms and conditions for copying, distribution and
modification follow.
-@iftex
+@ifnotinfo
@c fakenode --- for prepinfo
-@unnumberedsec TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-@end iftex
+@unnumberedsec Terms and Conditions for Copying, Distribution and Modification
+@end ifnotinfo
@ifinfo
@center TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
@end ifinfo
@@ -20680,7 +25387,7 @@ customarily used for software interchange; or,
@item
Accompany it with the information you received as to the offer
to distribute corresponding source code. (This alternative is
-allowed only for non-commercial distribution and only if you
+allowed only for noncommercial distribution and only if you
received the program in object code or executable form with such
an offer, in accord with Subsection b above.)
@end enumerate
@@ -20795,10 +25502,10 @@ make exceptions for this. Our decision will be guided by the two goals
of preserving the free status of all derivatives of our free software and
of promoting the sharing and reuse of software generally.
-@iftex
+@ifnotinfo
@c fakenode --- for prepinfo
@heading NO WARRANTY
-@end iftex
+@end ifnotinfo
@ifinfo
@center NO WARRANTY
@end ifinfo
@@ -20826,10 +25533,10 @@ PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
POSSIBILITY OF SUCH DAMAGES.
@end enumerate
-@iftex
+@ifnotinfo
@c fakenode --- for prepinfo
@heading END OF TERMS AND CONDITIONS
-@end iftex
+@end ifnotinfo
@ifinfo
@center END OF TERMS AND CONDITIONS
@end ifinfo
@@ -20863,7 +25570,7 @@ GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with this program; if not, write to the Free Software
-Foundation, Inc., 59 Temple Place --- Suite 330, Boston, MA 02111-1307, USA.
+Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111, USA.
@end smallexample
Also add information on how to contact you by electronic and paper mail.
@@ -20875,7 +25582,7 @@ when it starts in an interactive mode:
Gnomovision version 69, Copyright (C) @var{year} @var{name of author}
Gnomovision comes with ABSOLUTELY NO WARRANTY; for details
type `show w'. This is free software, and you are welcome
-to redistribute it under certain conditions; type `show c'
+to redistribute it under certain conditions; type `show c'
for details.
@end smallexample
@@ -20893,7 +25600,7 @@ necessary. Here is a sample; alter the names:
@group
Yoyodyne, Inc., hereby disclaims all copyright
interest in the program `Gnomovision'
-(which makes passes at compilers) written
+(which makes passes at compilers) written
by James Hacker.
@var{signature of Ty Coon}, 1 April 1989
@@ -20904,15 +25611,413 @@ Ty Coon, President of Vice
This General Public License does not permit incorporating your program into
proprietary programs. If your program is a subroutine library, you may
consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Library General
+library. If this is what you want to do, use the GNU Lesser General
Public License instead of this License.
-@node Index, , Copying, Top
+@node GNU Free Documentation License, Index, Copying, Top
+@unnumbered GNU Free Documentation License
+@center Version 1.1, March 2000
+@cindex FDL
+@cindex Free Documentation License
+@cindex GNU Free Documentation License
+
+@display
+Copyright (C) 2000 Free Software Foundation, Inc.
+59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+Everyone is permitted to copy and distribute verbatim copies
+of this license document, but changing it is not allowed.
+@end display
+@sp 1
+@enumerate 0
+@item
+PREAMBLE
+
+The purpose of this License is to make a manual, textbook, or other
+written document ``free'' in the sense of freedom: to assure everyone
+the effective freedom to copy and redistribute it, with or without
+modifying it, either commercially or noncommercially. Secondarily,
+this License preserves for the author and publisher a way to get
+credit for their work, while not being considered responsible for
+modifications made by others.
+
+This License is a kind of ``copyleft'', which means that derivative
+works of the document must themselves be free in the same sense. It
+complements the GNU General Public License, which is a copyleft
+license designed for free software.
+
+We have designed this License in order to use it for manuals for free
+software, because free software needs free documentation: a free
+program should come with manuals providing the same freedoms that the
+software does. But this License is not limited to software manuals;
+it can be used for any textual work, regardless of subject matter or
+whether it is published as a printed book. We recommend this License
+principally for works whose purpose is instruction or reference.
+
+@sp 1
+@item
+APPLICABILITY AND DEFINITIONS
+
+This License applies to any manual or other work that contains a
+notice placed by the copyright holder saying it can be distributed
+under the terms of this License. The ``Document'', below, refers to any
+such manual or work. Any member of the public is a licensee, and is
+addressed as ``you''.
+
+A ``Modified Version'' of the Document means any work containing the
+Document or a portion of it, either copied verbatim, or with
+modifications and/or translated into another language.
+
+A ``Secondary Section'' is a named appendix or a front-matter section of
+the Document that deals exclusively with the relationship of the
+publishers or authors of the Document to the Document's overall subject
+(or to related matters) and contains nothing that could fall directly
+within that overall subject. (For example, if the Document is in part a
+textbook of mathematics, a Secondary Section may not explain any
+mathematics.) The relationship could be a matter of historical
+connection with the subject or with related matters, or of legal,
+commercial, philosophical, ethical or political position regarding
+them.
+
+The ``Invariant Sections'' are certain Secondary Sections whose titles
+are designated, as being those of Invariant Sections, in the notice
+that says that the Document is released under this License.
+
+The ``Cover Texts'' are certain short passages of text that are listed,
+as Front-Cover Texts or Back-Cover Texts, in the notice that says that
+the Document is released under this License.
+
+A ``Transparent'' copy of the Document means a machine-readable copy,
+represented in a format whose specification is available to the
+general public, whose contents can be viewed and edited directly and
+straightforwardly with generic text editors or (for images composed of
+pixels) generic paint programs or (for drawings) some widely available
+drawing editor, and that is suitable for input to text formatters or
+for automatic translation to a variety of formats suitable for input
+to text formatters. A copy made in an otherwise Transparent file
+format whose markup has been designed to thwart or discourage
+subsequent modification by readers is not Transparent. A copy that is
+not ``Transparent'' is called ``Opaque''.
+
+Examples of suitable formats for Transparent copies include plain
+ASCII without markup, Texinfo input format, LaTeX input format, SGML
+or XML using a publicly available DTD, and standard-conforming simple
+HTML designed for human modification. Opaque formats include
+PostScript, PDF, proprietary formats that can be read and edited only
+by proprietary word processors, SGML or XML for which the DTD and/or
+processing tools are not generally available, and the
+machine-generated HTML produced by some word processors for output
+purposes only.
+
+The ``Title Page'' means, for a printed book, the title page itself,
+plus such following pages as are needed to hold, legibly, the material
+this License requires to appear in the title page. For works in
+formats which do not have any title page as such, ``Title Page'' means
+the text near the most prominent appearance of the work's title,
+preceding the beginning of the body of the text.
+@sp 1
+@item
+VERBATIM COPYING
+
+You may copy and distribute the Document in any medium, either
+commercially or noncommercially, provided that this License, the
+copyright notices, and the license notice saying this License applies
+to the Document are reproduced in all copies, and that you add no other
+conditions whatsoever to those of this License. You may not use
+technical measures to obstruct or control the reading or further
+copying of the copies you make or distribute. However, you may accept
+compensation in exchange for copies. If you distribute a large enough
+number of copies you must also follow the conditions in section 3.
+
+You may also lend copies, under the same conditions stated above, and
+you may publicly display copies.
+@sp 1
+@item
+COPYING IN QUANTITY
+
+If you publish printed copies of the Document numbering more than 100,
+and the Document's license notice requires Cover Texts, you must enclose
+the copies in covers that carry, clearly and legibly, all these Cover
+Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on
+the back cover. Both covers must also clearly and legibly identify
+you as the publisher of these copies. The front cover must present
+the full title with all words of the title equally prominent and
+visible. You may add other material on the covers in addition.
+Copying with changes limited to the covers, as long as they preserve
+the title of the Document and satisfy these conditions, can be treated
+as verbatim copying in other respects.
+
+If the required texts for either cover are too voluminous to fit
+legibly, you should put the first ones listed (as many as fit
+reasonably) on the actual cover, and continue the rest onto adjacent
+pages.
+
+If you publish or distribute Opaque copies of the Document numbering
+more than 100, you must either include a machine-readable Transparent
+copy along with each Opaque copy, or state in or with each Opaque copy
+a publicly-accessible computer-network location containing a complete
+Transparent copy of the Document, free of added material, which the
+general network-using public has access to download anonymously at no
+charge using public-standard network protocols. If you use the latter
+option, you must take reasonably prudent steps, when you begin
+distribution of Opaque copies in quantity, to ensure that this
+Transparent copy will remain thus accessible at the stated location
+until at least one year after the last time you distribute an Opaque
+copy (directly or through your agents or retailers) of that edition to
+the public.
+
+It is requested, but not required, that you contact the authors of the
+Document well before redistributing any large number of copies, to give
+them a chance to provide you with an updated version of the Document.
+@sp 1
+@item
+MODIFICATIONS
+
+You may copy and distribute a Modified Version of the Document under
+the conditions of sections 2 and 3 above, provided that you release
+the Modified Version under precisely this License, with the Modified
+Version filling the role of the Document, thus licensing distribution
+and modification of the Modified Version to whoever possesses a copy
+of it. In addition, you must do these things in the Modified Version:
+
+@enumerate A
+@item
+Use in the Title Page (and on the covers, if any) a title distinct
+from that of the Document, and from those of previous versions
+(which should, if there were any, be listed in the History section
+of the Document). You may use the same title as a previous version
+if the original publisher of that version gives permission.
+
+@item
+List on the Title Page, as authors, one or more persons or entities
+responsible for authorship of the modifications in the Modified
+Version, together with at least five of the principal authors of the
+Document (all of its principal authors, if it has less than five).
+
+@item
+State on the Title page the name of the publisher of the
+Modified Version, as the publisher.
+
+@item
+Preserve all the copyright notices of the Document.
+
+@item
+Add an appropriate copyright notice for your modifications
+adjacent to the other copyright notices.
+
+@item
+Include, immediately after the copyright notices, a license notice
+giving the public permission to use the Modified Version under the
+terms of this License, in the form shown in the Addendum below.
+
+@item
+Preserve in that license notice the full lists of Invariant Sections
+and required Cover Texts given in the Document's license notice.
+
+@item
+Include an unaltered copy of this License.
+
+@item
+Preserve the section entitled ``History'', and its title, and add to
+it an item stating at least the title, year, new authors, and
+publisher of the Modified Version as given on the Title Page. If
+there is no section entitled ``History'' in the Document, create one
+stating the title, year, authors, and publisher of the Document as
+given on its Title Page, then add an item describing the Modified
+Version as stated in the previous sentence.
+
+@item
+Preserve the network location, if any, given in the Document for
+public access to a Transparent copy of the Document, and likewise
+the network locations given in the Document for previous versions
+it was based on. These may be placed in the ``History'' section.
+You may omit a network location for a work that was published at
+least four years before the Document itself, or if the original
+publisher of the version it refers to gives permission.
+
+@item
+In any section entitled ``Acknowledgements'' or ``Dedications'',
+preserve the section's title, and preserve in the section all the
+substance and tone of each of the contributor acknowledgements
+and/or dedications given therein.
+
+@item
+Preserve all the Invariant Sections of the Document,
+unaltered in their text and in their titles. Section numbers
+or the equivalent are not considered part of the section titles.
+
+@item
+Delete any section entitled ``Endorsements''. Such a section
+may not be included in the Modified Version.
+
+@item
+Do not retitle any existing section as ``Endorsements''
+or to conflict in title with any Invariant Section.
+@end enumerate
+
+If the Modified Version includes new front-matter sections or
+appendices that qualify as Secondary Sections and contain no material
+copied from the Document, you may at your option designate some or all
+of these sections as invariant. To do this, add their titles to the
+list of Invariant Sections in the Modified Version's license notice.
+These titles must be distinct from any other section titles.
+
+You may add a section entitled ``Endorsements'', provided it contains
+nothing but endorsements of your Modified Version by various
+parties--for example, statements of peer review or that the text has
+been approved by an organization as the authoritative definition of a
+standard.
+
+You may add a passage of up to five words as a Front-Cover Text, and a
+passage of up to 25 words as a Back-Cover Text, to the end of the list
+of Cover Texts in the Modified Version. Only one passage of
+Front-Cover Text and one of Back-Cover Text may be added by (or
+through arrangements made by) any one entity. If the Document already
+includes a cover text for the same cover, previously added by you or
+by arrangement made by the same entity you are acting on behalf of,
+you may not add another; but you may replace the old one, on explicit
+permission from the previous publisher that added the old one.
+
+The author(s) and publisher(s) of the Document do not by this License
+give permission to use their names for publicity for or to assert or
+imply endorsement of any Modified Version.
+@sp 1
+@item
+COMBINING DOCUMENTS
+
+You may combine the Document with other documents released under this
+License, under the terms defined in section 4 above for modified
+versions, provided that you include in the combination all of the
+Invariant Sections of all of the original documents, unmodified, and
+list them all as Invariant Sections of your combined work in its
+license notice.
+
+The combined work need only contain one copy of this License, and
+multiple identical Invariant Sections may be replaced with a single
+copy. If there are multiple Invariant Sections with the same name but
+different contents, make the title of each such section unique by
+adding at the end of it, in parentheses, the name of the original
+author or publisher of that section if known, or else a unique number.
+Make the same adjustment to the section titles in the list of
+Invariant Sections in the license notice of the combined work.
+
+In the combination, you must combine any sections entitled ``History''
+in the various original documents, forming one section entitled
+``History''; likewise combine any sections entitled ``Acknowledgements'',
+and any sections entitled ``Dedications''. You must delete all sections
+entitled ``Endorsements.''
+@sp 1
+@item
+COLLECTIONS OF DOCUMENTS
+
+You may make a collection consisting of the Document and other documents
+released under this License, and replace the individual copies of this
+License in the various documents with a single copy that is included in
+the collection, provided that you follow the rules of this License for
+verbatim copying of each of the documents in all other respects.
+
+You may extract a single document from such a collection, and distribute
+it individually under this License, provided you insert a copy of this
+License into the extracted document, and follow this License in all
+other respects regarding verbatim copying of that document.
+@sp 1
+@item
+AGGREGATION WITH INDEPENDENT WORKS
+
+A compilation of the Document or its derivatives with other separate
+and independent documents or works, in or on a volume of a storage or
+distribution medium, does not as a whole count as a Modified Version
+of the Document, provided no compilation copyright is claimed for the
+compilation. Such a compilation is called an ``aggregate'', and this
+License does not apply to the other self-contained works thus compiled
+with the Document, on account of their being thus compiled, if they
+are not themselves derivative works of the Document.
+
+If the Cover Text requirement of section 3 is applicable to these
+copies of the Document, then if the Document is less than one quarter
+of the entire aggregate, the Document's Cover Texts may be placed on
+covers that surround only the Document within the aggregate.
+Otherwise they must appear on covers around the whole aggregate.
+@sp 1
+@item
+TRANSLATION
+
+Translation is considered a kind of modification, so you may
+distribute translations of the Document under the terms of section 4.
+Replacing Invariant Sections with translations requires special
+permission from their copyright holders, but you may include
+translations of some or all Invariant Sections in addition to the
+original versions of these Invariant Sections. You may include a
+translation of this License provided that you also include the
+original English version of this License. In case of a disagreement
+between the translation and the original English version of this
+License, the original English version will prevail.
+@sp 1
+@item
+TERMINATION
+
+You may not copy, modify, sublicense, or distribute the Document except
+as expressly provided for under this License. Any other attempt to
+copy, modify, sublicense or distribute the Document is void, and will
+automatically terminate your rights under this License. However,
+parties who have received copies, or rights, from you under this
+License will not have their licenses terminated so long as such
+parties remain in full compliance.
+@sp 1
+@item
+FUTURE REVISIONS OF THIS LICENSE
+
+The Free Software Foundation may publish new, revised versions
+of the GNU Free Documentation License from time to time. Such new
+versions will be similar in spirit to the present version, but may
+differ in detail to address new problems or concerns. See
+@uref{http://www.gnu.org/copyleft/}.
+
+Each version of the License is given a distinguishing version number.
+If the Document specifies that a particular numbered version of this
+License ``or any later version'' applies to it, you have the option of
+following the terms and conditions either of that specified version or
+of any later version that has been published (not as a draft) by the
+Free Software Foundation. If the Document does not specify a version
+number of this License, you may choose any version ever published (not
+as a draft) by the Free Software Foundation.
+
+@end enumerate
+
+@c fakenode --- for prepinfo
+@unnumberedsec ADDENDUM: How to use this License for your documents
+
+To use this License in a document you have written, include a copy of
+the License in the document and put the following copyright and
+license notices just after the title page:
+
+@smallexample
+@group
+
+ Copyright (C) @var{year} @var{your name}.
+ Permission is granted to copy, distribute and/or modify this document
+ under the terms of the GNU Free Documentation License, Version 1.1
+ or any later version published by the Free Software Foundation;
+ with the Invariant Sections being @var{list their titles}, with the
+ Front-Cover Texts being @var{list}, and with the Back-Cover Texts being @var{list}.
+ A copy of the license is included in the section entitled ``GNU
+ Free Documentation License''.
+@end group
+@end smallexample
+If you have no Invariant Sections, write ``with no Invariant Sections''
+instead of saying which ones are invariant. If you have no
+Front-Cover Texts, write ``no Front-Cover Texts'' instead of
+``Front-Cover Texts being @var{list}''; likewise for Back-Cover Texts.
+
+If your document contains nontrivial examples of program code, we
+recommend releasing these examples in parallel under your choice of
+free software license, such as the GNU General Public License,
+to permit their use in free software.
+
+@node Index, , GNU Free Documentation License, Top
@unnumbered Index
@printindex cp
-@summarycontents
-@contents
@bye
Unresolved Issues:
@@ -20936,19 +26041,30 @@ Consistency issues:
Use ESC and not ESCAPE
Use space and not blank to describe the space bar's character
The term "blank" is thus basically reserved for "blank lines" etc.
- The `(d.c.)' should appear inside the closing `.' of a sentence
- It should come before (pxref{...})
+ To make dark corners work, the @value{DARKCORNER} has to be outside
+ closing `.' of a sentence and after (pxref{...}). This is
+ a change from earlier versions.
" " should have an @w{} around it
Use "non-" everywhere
- Use @code{ftp} when talking about anonymous ftp
- Use upper-case and lower-case, not "upper case" and "lower case"
+ Use @command{ftp} when talking about anonymous ftp
+ Use uppercase and lowercase, not "upper-case" and "lower-case"
+ or "upper case" and "lower case"
+ Use "single precision" and "double precision", not "single-precision" or "double-precision"
Use alphanumeric, not alpha-numeric
+ Use POSIX-compliant, not POSIX compliant
Use --foo, not -Wfoo when describing long options
- Use findex for all programs and functions in the example chapters
Use "Bell Laboratories", but not "Bell Labs".
Use "behavior" instead of "behaviour".
Use "zeros" instead of "zeroes".
+ Use "nonzero" not "non-zero".
+ Use "runtime" not "run time" or "run-time".
+ Use "command-line" not "command line".
+ Use "online" not "on-line".
+ Use "whitespace" not "white space".
Use "Input/Output", not "input/output". Also "I/O", not "i/o".
+ Use "lefthand"/"righthand", not "left-hand"/"right-hand".
+ Use "workaround", not "work-around".
+ Use "startup"/"cleanup", not "start-up"/"clean-up"
Use @code{do}, and not @code{do}-@code{while}, except where
actually discussing the do-while.
The words "a", "and", "as", "between", "for", "from", "in", "of",
@@ -20957,20 +26073,39 @@ Consistency issues:
"Into" and "How" should.
Search for @dfn; make sure important items are also indexed.
"e.g." should always be followed by a comma.
- "i.e." should never be followed by a comma, and should be followed
- by `@:'.
+ "i.e." should always be followed by a comma.
The numbers zero through ten should be spelled out, except when
talking about file descriptor numbers. > 10 and < 0, it's
ok to use numbers.
- In tables, put command line options in @code, while in the text,
- put them in @samp.
+ In tables, put command-line options in @code, while in the text,
+ put them in @option.
When using @strong, use "Note:" or "Caution:" with colons and
not exclamation points. Do not surround the paragraphs
with @quotation ... @end quotation.
+ For most cases, do NOT put a comma before "and", "or" or "but".
+ But exercise taste with this rule.
+ Don't show the awk command with a program in quotes when it's
+ just the program. I.e.
+
+ {
+ ....
+ }
+
+ not
+ awk '{
+ ...
+ }'
+
+ Do show it when showing command-line arguments, data files, etc, even
+ if there is no output shown.
+
+ Use numbered lists only to show a sequential series of steps.
+
+ Use @code{xxx} for the xxx operator in indexing statements, not @samp.
Date: Wed, 13 Apr 94 15:20:52 -0400
-From: rsm@gnu.ai.mit.edu (Richard Stallman)
-To: gnu-prog@gnu.ai.mit.edu
+From: rms@gnu.org (Richard Stallman)
+To: gnu-prog@gnu.org
Subject: A reminder: no pathnames in GNU
It's a GNU convention to use the term "file name" for the name of a
@@ -20984,6 +26119,9 @@ have used "pathname".
Note that "file name" should be two words when it appears as ordinary
text. It's ok as one word when it's a metasyntactic variable, though.
+------------------------
+ORA uses filename, thus the macro.
+
Suggestions:
------------
Enhance FIELDWIDTHS with some way to indicate "the rest of the record".
@@ -20991,4 +26129,41 @@ E.g., a length of 0 or -1 or something. May be "n"?
Make FIELDWIDTHS be an array?
-What if FIELDWIDTHS has invalid values in it?
+% Next edition:
+% 1. Talk about common extensions, those in nawk, gawk, mawk
+% 2. Use @code{foo} for variables and @code{foo()} for functions
+% 3. Standardize the error messages from the functions and programs
+% in Chapters 12 and 13.
+% 4. Nuke the BBS stuff and use something that won't be obsolete
+% 5. Reorg chapters 5 & 7 like so:
+%Chapter 5:
+% - Constants, Variables, and Conversions
+% + Constant Expressions
+% + Using Regular Expression Constants
+% + Variables
+% + Conversion of Strings and Numbers
+% - Operators
+% + Arithmetic Operators
+% + String Concatenation
+% + Assignment Expressions
+% + Increment and Decrement Operators
+% - Truth Values and Conditions
+% + True and False in Awk
+% + Boolean Expressions
+% + Conditional Expressions
+% - Function Calls
+% - Operator Precedence
+%
+%Chapter 7:
+% - Array Basics
+% + Introduction to Arrays
+% + Referring to an Array Element
+% + Assigning Array Elements
+% + Basic Array Example
+% + Scanning All Elements of an Array
+% - The delete Statement
+% - Using Numbers to Subscript Arrays
+% - Using Uninitialized Variables as Subscripts
+% - Multidimensional Arrays
+% + Scanning Multidimensional Arrays
+% - Sorting Array Values and Indices with gawk
diff --git a/contrib/awk/doc/gawkinet.texi b/contrib/awk/doc/gawkinet.texi
new file mode 100644
index 0000000..2ffb581
--- /dev/null
+++ b/contrib/awk/doc/gawkinet.texi
@@ -0,0 +1,5075 @@
+\input texinfo @c -*-texinfo-*-
+@c %**start of header (This is for running Texinfo on a region.)
+@setfilename gawkinet.info
+@settitle TCP/IP Internetworking With @command{gawk}
+@c %**end of header (This is for running Texinfo on a region.)
+
+@c inside ifinfo for older versions of texinfo.tex
+@ifinfo
+@dircategory GNU Packages
+@direntry
+* Gawkinet: (gawkinet). TCP/IP Internetworking With @command{gawk}.
+@end direntry
+@end ifinfo
+
+@iftex
+@set DOCUMENT book
+@set CHAPTER chapter
+@set SECTION section
+@set DARKCORNER @inmargin{@image{lflashlight,1cm}, @image{rflashlight,1cm}}
+@end iftex
+@ifinfo
+@set DOCUMENT Info file
+@set CHAPTER major node
+@set SECTION node
+@set DARKCORNER (d.c.)
+@end ifinfo
+@ifhtml
+@set DOCUMENT web page
+@set CHAPTER chapter
+@set SECTION section
+@set DARKCORNER (d.c.)
+@end ifhtml
+
+@set FSF
+
+@set FN file name
+@set FFN File Name
+
+@c merge the function and variable indexes into the concept index
+@ifinfo
+@synindex fn cp
+@synindex vr cp
+@end ifinfo
+@iftex
+@syncodeindex fn cp
+@syncodeindex vr cp
+@end iftex
+
+@c If "finalout" is commented out, the printed output will show
+@c black boxes that mark lines that are too long. Thus, it is
+@c unwise to comment it out when running a master in case there are
+@c overfulls which are deemed okay.
+
+@iftex
+@finalout
+@end iftex
+
+@smallbook
+
+@c Special files are described in chapter 6 Printing Output under
+@c 6.7 Special File Names in gawk. I think the networking does not
+@c fit into that chapter, thus this separate document. At over 50
+@c pages, I think this is the right decision. ADR.
+
+@set TITLE TCP/IP Internetworking With @command{gawk}
+@set EDITION 1.1
+@set UPDATE-MONTH March, 2001
+@c gawk versions:
+@set VERSION 3.1
+@set PATCHLEVEL 0
+
+@ifinfo
+This file documents the networking features in GNU @command{awk}.
+
+This is Edition @value{EDITION} of @cite{@value{TITLE}},
+for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU
+implementation of AWK.
+
+Copyright (C) 2000, 2001 Free Software Foundation, Inc.
+
+Permission is granted to copy, distribute and/or modify this document
+under the terms of the GNU Free Documentation License, Version 1.1 or
+any later version published by the Free Software Foundation; with the
+Invariant Sections being ``GNU General Public License'', the Front-Cover
+texts being (a) (see below), and with the Back-Cover Texts being (b)
+(see below). A copy of the license is included in the section entitled
+``GNU Free Documentation License''.
+
+@enumerate a
+@item
+``A GNU Manual''
+
+@item
+``You have freedom to copy and modify this GNU Manual, like GNU
+software. Copies published by the Free Software Foundation raise
+funds for GNU development.''
+@end enumerate
+@end ifinfo
+
+@setchapternewpage odd
+
+@titlepage
+@title @value{TITLE}
+@subtitle Edition @value{EDITION}
+@subtitle @value{UPDATE-MONTH}
+@author J@"urgen Kahrs
+@author with Arnold D. Robbins
+
+@c Include the Distribution inside the titlepage environment so
+@c that headings are turned off. Headings on and off do not work.
+
+@page
+@vskip 0pt plus 1filll
+Copyright @copyright{} 2000, 2001 Free Software Foundation, Inc.
+@sp 1
+@b{User Friendly} Copyright @copyright{} 2000 J.D.@: ``Iliad'' Frazier.
+Reprinted by permission.
+@sp 2
+
+This is Edition @value{EDITION} of @cite{@value{TITLE}},
+for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU
+implementation of AWK.
+
+@sp 2
+Published by:
+@sp 1
+
+Free Software Foundation @*
+59 Temple Place --- Suite 330 @*
+Boston, MA 02111-1307 USA @*
+Phone: +1-617-542-5942 @*
+Fax: +1-617-542-2652 @*
+Email: @email{gnu@@gnu.org} @*
+URL: @uref{http://www.gnu.org/} @*
+
+ISBN 1-882114-93-0 @*
+
+Permission is granted to copy, distribute and/or modify this document
+under the terms of the GNU Free Documentation License, Version 1.1 or
+any later version published by the Free Software Foundation; with the
+Invariant Sections being ``GNU General Public License'', the Front-Cover
+texts being (a) (see below), and with the Back-Cover Texts being (b)
+(see below). A copy of the license is included in the section entitled
+``GNU Free Documentation License''.
+
+@enumerate a
+@item
+``A GNU Manual''
+
+@item
+``You have freedom to copy and modify this GNU Manual, like GNU
+software. Copies published by the Free Software Foundation raise
+funds for GNU development.''
+@end enumerate
+@c @sp 2
+@c Cover art by ?????.
+@end titlepage
+
+@iftex
+@headings off
+@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
+@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
+@end iftex
+
+@ifinfo
+@node Top, Preface, (dir), (dir)
+@top General Introduction
+@comment node-name, next, previous, up
+
+This file documents the networking features in GNU Awk (@command{gawk})
+version 3.1 and later.
+@end ifinfo
+
+@menu
+* Preface:: About this document.
+* Introduction:: About networkiing.
+* Using Networking:: Some examples.
+* Some Applications and Techniques:: More extended examples.
+* Links:: Where to find the stuff mentioned in this
+ document.
+* GNU Free Documentation License:: The license for this document.
+* Index:: The index.
+
+@detailmenu
+* Stream Communications:: Sending data streams.
+* Datagram Communications:: Sending self-contained messages.
+* The TCP/IP Protocols:: How these models work in the Internet.
+* Basic Protocols:: The basic protocols.
+* Ports:: The idea behind ports.
+* Making Connections:: Making TCP/IP connections.
+* Gawk Special Files:: How to do @command{gawk} networking.
+* Special File Fields:: The fields in the special file name.
+* Comparing Protocols:: Differences between the protocols.
+* File /inet/tcp:: The TCP special file.
+* File /inet/udp:: The UDB special file.
+* File /inet/raw:: The RAW special file.
+* TCP Connecting:: Making a TCP connection.
+* Troubleshooting:: Troubleshooting TCP/IP connections.
+* Interacting:: Interacting with a service.
+* Setting Up:: Setting up a service.
+* Email:: Reading email.
+* Web page:: Reading a Web page.
+* Primitive Service:: A primitive Web service.
+* Interacting Service:: A Web service with interaction.
+* CGI Lib:: A simple CGI library.
+* Simple Server:: A simple Web server.
+* Caveats:: Network programming caveats.
+* Challenges:: Where to go from here.
+* PANIC:: An Emergency Web Server.
+* GETURL:: Retrieving Web Pages.
+* REMCONF:: Remote Configuration Of Embedded Systems.
+* URLCHK:: Look For Changed Web Pages.
+* WEBGRAB:: Extract Links From A Page.
+* STATIST:: Graphing A Statistical Distribution.
+* MAZE:: Walking Through A Maze In Virtual Reality.
+* MOBAGWHO:: A Simple Mobile Agent.
+* STOXPRED:: Stock Market Prediction As A Service.
+* PROTBASE:: Searching Through A Protein Database.
+@end detailmenu
+@end menu
+
+@contents
+
+@node Preface, Introduction, Top, Top
+@unnumbered Preface
+
+In May of 1997, J@"urgen Kahrs felt the need for network access
+from @command{awk}, and, with a little help from me, set about adding
+features to do this for @command{gawk}. At that time, he
+wrote the bulk of this @value{DOCUMENT}.
+
+The code and documentation were added to the @command{gawk} 3.1 development
+tree, and languished somewhat until I could finally get
+down to some serious work on that version of @command{gawk}.
+This finally happened in the middle of 2000.
+
+Meantime, J@"urgen wrote an article about the Internet special
+files and @samp{|&} operator for @cite{Linux Journal}, and made a
+networking patch for the production versions of @command{gawk}
+available from his home page.
+In August of 2000 (for @command{gawk} 3.0.6), this patch
+also made it to the main GNU @command{ftp} distribution site.
+
+For release with @command{gawk}, I edited J@"urgen's prose
+for English grammar and style, as he is not a native English
+speaker. I also
+rearranged the material somewhat for what I felt was a better order of
+presentation, and (re)wrote some of the introductory material.
+
+The majority of this document and the code are his work, and the
+high quality and interesting ideas speak for themselves. It is my
+hope that these features will be of significant value to the @command{awk}
+community.
+
+@sp 1
+@noindent
+Arnold Robbins @*
+Nof Ayalon, ISRAEL @*
+March, 2001
+
+@node Introduction, Using Networking, Preface, Top
+@chapter Networking Concepts
+
+This @value{CHAPTER} provides a (necessarily) brief intoduction to
+computer networking concepts. For many applications of @command{gawk}
+to TCP/IP networking, we hope that this is enough. For more
+advanced tasks, you will need deeper background, and it may be necessary
+to switch to lower-level programming in C or C++.
+
+There are two real-life models for the way computers send messages
+to each other over a network. While the analogies are not perfect,
+they are close enough to convey the major concepts.
+These two models are the phone system (reliable byte-stream communications),
+and the postal system (best-effort datagrams).
+
+@menu
+* Stream Communications:: Sending data streams.
+* Datagram Communications:: Sending self-contained messages.
+* The TCP/IP Protocols:: How these models work in the Internet.
+* Making Connections:: Making TCP/IP connections.
+@end menu
+
+@node Stream Communications, Datagram Communications, Introduction, Introduction
+@section Reliable Byte-streams (Phone Calls)
+
+When you make a phone call, the following steps occur:
+
+@enumerate
+@item
+You dial a number.
+
+@item
+The phone system connects to the called party, telling
+them there is an incoming call. (Their phone rings.)
+
+@item
+The other party answers the call, or, in the case of a
+computer network, refuses to answer the call.
+
+@item
+Assuming the other party answers, the connection between
+you is now a @dfn{duplex} (two-way), @dfn{reliable} (no data lost),
+sequenced (data comes out in the order sent) data stream.
+
+@item
+You and your friend may now talk freely, with the phone system
+moving the data (your voices) from one end to the other.
+From your point of view, you have a direct end-to-end
+connection with the person on the other end.
+@end enumerate
+
+The same steps occur in a duplex reliable computer networking connection.
+There is considerably more overhead in setting up the communications,
+but once it's done, data moves in both directions, reliably, in sequence.
+
+@node Datagram Communications, The TCP/IP Protocols, Stream Communications, Introduction
+@section Best-effort Datagrams (Mailed Letters)
+
+Suppose you mail three different documents to your office on the
+other side of the country on two different days. Doing so
+entails the following.
+
+@enumerate
+@item
+Each document travels in its own envelope.
+
+@item
+Each envelope contains both the sender and the
+recipient address.
+
+@item
+Each envelope may travel a different route to its destination.
+
+@item
+The envelopes may arrive in a different order from the one
+in which they were sent.
+
+@item
+One or more may get lost in the mail.
+(Although, fortunately, this does not occur very often.)
+
+@item
+In a computer network, one or more @dfn{packets}
+may also arrive multiple times. (This doesn't happen
+with the postal system!)
+
+@end enumerate
+
+The important characteristics of datagram communications, like
+those of the postal system are thus:
+
+@itemize @bullet
+@item
+Delivery is ``best effort;'' the data may never get there.
+
+@item
+Each message is self-contained, including the source and
+destination addresses.
+
+@item
+Delivery is @emph{not} sequenced; packets may arrive out
+of order, and/or multiple times.
+
+@item
+Unlike the phone system, overhead is considerably lower.
+It is not necessary to set up the call first.
+@end itemize
+
+The price the user pays for the lower overhead of datagram communications
+is exactly the lower reliability; it is often necessary for user-level
+protocols that use datagram communications to add their own reliabilty
+features on top of the basic communications.
+
+@node The TCP/IP Protocols, Making Connections, Datagram Communications, Introduction
+@section The Internet Protocols
+
+The Internet Protocol Suite (usually referred as just TCP/IP)@footnote{
+It should be noted that although the Internet seems to have conquered the
+world, there are other networking protocol suites in existence and in use.}
+consists of a number of different protocols at different levels or ``layers.''
+For our purposes, three protocols provide the fundamental communications
+mechanisms. All other defined protocols are referred to as user-level
+protocols (e.g., HTTP, used later in this @value{DOCUMENT}).
+
+@menu
+* Basic Protocols:: The basic protocols.
+* Ports:: The idea behind ports.
+@end menu
+
+@node Basic Protocols, Ports, The TCP/IP Protocols, The TCP/IP Protocols
+@subsection The Basic Internet Protocols
+
+@table @asis
+@item IP
+The Internet Protocol. This protocol is almost never used directly by
+applications. It provides the basic packet delivery and routing infrastructure
+of the Internet. Much like the phone company's switching centers or the Post
+Office's trucks, it is not of much day-to-day interest to the regular user
+(or programmer).
+It happens to be a best effort datagram protocol.
+
+@item UDP
+The User Datagram Protocol. This is a best effort datagram protocol.
+It provides a small amount of extra reliability over IP, and adds
+the notion of @dfn{ports}, described in @ref{Ports, ,TCP and UDP Ports}.
+
+@item TCP
+The Transmission Control Protocol. This is a duplex, reliable, sequenced
+byte-stream protocol, again layered on top of IP, and also providing the
+notion of ports. This is the protocol that you will most likely use
+when using @command{gawk} for network programming.
+@end table
+
+All other user-level protocols use either TCP or UDP to do their basic
+communications. Examples are SMTP (Simple Mail Transfer Protocol),
+FTP (File Transfer Protocol) and HTTP (HyperText Transfer Protocol).
+@cindex SMTP
+@cindex FTP
+@cindex HTTP
+
+@node Ports, , Basic Protocols, The TCP/IP Protocols
+@subsection TCP and UDP Ports
+
+In the postal system, the address on an envelope indicates a physical
+location, such as a residence or office building. But there may be
+more than one person at the location; thus you have to further quantify
+the recipient by putting a person or company name on the envelope.
+
+In the phone system, one phone number may represent an entire company,
+in which case you need a person's extension number in order to
+reach that individual directly. Or, when you call a home, you have to
+say, ``May I please speak to ...'' before talking to the person directly.
+
+IP networking provides the concept of addressing. An IP address represents
+a particular computer, but no more. In order to reach the mail service
+on a system, or the FTP or WWW service on a system, you have to have some
+way to further specify which service you want. In the Internet Protocol suite,
+this is done with @dfn{port numbers}, which represent the services, much
+like an extension number used with a phone number.
+
+Port numbers are 16-bit integers. Unix and Unix-like systems reserve ports
+below 1024 for ``well known'' services, such as SMTP, FTP, and HTTP.
+Numbers above 1024 may be used by any application, although there is no
+promise made that a particular port number is always available.
+
+@node Making Connections, , The TCP/IP Protocols, Introduction
+@section Making TCP/IP Connections (And Some Terminology)
+
+Two terms come up repeatedly when discussing networking:
+@dfn{client} and @dfn{server}. For now, we'll discuss these terms
+at the @dfn{connection level}, when first establishing connections
+between two processes on different systems over a network.
+(Once the connection is established, the higher level, or
+@dfn{application level} protocols,
+such as HTTP or FTP, determine who is the client and who is the
+server. Often, it turns out that the client and server are the
+same in both roles.)
+
+@cindex server
+The @dfn{server} is the system providing the service, such as the
+web server or email server. It is the @dfn{host} (system) which
+is @emph{connected to} in a transaction.
+For this to work though, the server must be expecting connections.
+Much as there has to be someone at the office building to answer
+the phone@footnote{In the days before voice mail systems!}, the
+server process (usually) has to be started first and waiting
+for a connection.
+
+@cindex client
+The @dfn{client} is the system requesting the service.
+It is the system @emph{initiating the connection} in a transaction.
+(Just as when you pick up the phone to call an office or store.)
+
+In the TCP/IP framework, each end of a connection is represented by a pair
+of (@var{address}, @var{port}) pairs. For the duration of the connection,
+the ports in use at each end are unique, and cannot be used simultaneously
+by other processes on the same system. (Only after closing a connection
+can a new one be built up on the same port. This is contrary to the usual
+behavior of fully developed web servers which have to avoid situations
+in which they are not reachable. We have to pay this price in order to
+enjoy the benefits of a simple communication paradigm in @command{gawk}.)
+
+@cindex blocking
+@cindex synchronous communications
+Furthermore, once the connection is established, communications
+are @dfn{synchronous}. I.e., each end waits on the other to finish
+transmitting, before replying. This is much like two people in a phone
+conversation. While both could talk simultaneously, doing so usually
+doesn't work too well.
+
+In the case of TCP, the synchronicity is enforced by the protocol when
+sending data. Data writes @dfn{block} until the data have been received on the
+other end. For both TCP and UDP, data reads block until there is incoming
+data waiting to be read. This is summarized in the following table,
+where an ``X'' indicates that the given action blocks.
+
+@ifnottex
+@multitable {Protocol} {Reads} {Writes}
+@item TCP @tab X @tab X
+@item UDP @tab X @tab
+@item RAW @tab X @tab
+@end multitable
+@end ifnottex
+@tex
+\centerline{
+\vbox{\bigskip % space above the table (about 1 linespace)
+% Because we have vertical rules, we can't let TeX insert interline space
+% in its usual way.
+\offinterlineskip
+\halign{\hfil\strut# &\vrule #& \hfil#\hfil& \hfil#\hfil\cr
+Protocol&&\quad Reads\quad &Writes\cr
+\noalign{\hrule}
+\omit&height 2pt\cr
+\noalign{\hrule height0pt}% without this the rule does not extend; why?
+TCP&&X&X\cr
+UDP&&X&\cr
+RAW&&X&\cr
+}}}
+@end tex
+
+@node Using Networking, Some Applications and Techniques, Introduction, Top
+@comment node-name, next, previous, up
+@chapter Networking With @command{gawk}
+
+@cindex network
+The @command{awk} programming language was originally developed as a
+pattern-matching language for writing short programs to perform
+data manipulation tasks.
+@command{awk}'s strength is the manipulation of textual data
+that is stored in files.
+It was never meant to be used for networking purposes.
+To exploit its features in a
+networking context, it's necessary to use an access mode for network connections
+that resembles the access of files as closely as possible.
+
+@cindex Perl
+@cindex Python
+@cindex Tcl/Tk
+@command{awk} is also meant to be a prototyping language. It is used
+to demonstrate feasibility and to play with features and user interfaces.
+This can be done with file-like handling of network
+connections.
+@command{gawk} trades the lack
+of many of the advanced features of the TCP/IP family of protocols
+for the convenience of simple connection handling.
+The advanced
+features are available when programming in C or Perl. In fact, the
+network programming
+in this @value{CHAPTER}
+is very similar to what is described in books like
+@cite{Internet Programming with Python},
+@cite{Advanced Perl Programming},
+or
+@cite{Web Client Programming with Perl}.
+But it's done here without first having to learn object-oriented ideology, underlying
+languages such as Tcl/Tk, Perl, Python, or all of the libraries necessary to
+extend these languages before they are ready for the Internet.
+
+This @value{CHAPTER} demonstrates how to use the TCP protocol. The
+other protocols are much less important for most users (UDP) or even
+untractable (RAW).
+
+@menu
+* Gawk Special Files:: How to do @command{gawk} networking.
+* TCP Connecting:: Making a TCP connection.
+* Troubleshooting:: Troubleshooting TCP/IP connections.
+* Interacting:: Interacting with a service.
+* Setting Up:: Setting up a service.
+* Email:: Reading email.
+* Web page:: Reading a Web page.
+* Primitive Service:: A primitive Web service.
+* Interacting Service:: A Web service with interaction.
+* Simple Server:: A simple Web server.
+* Caveats:: Network programming caveats.
+* Challenges:: Where to go from here.
+@end menu
+
+@node Gawk Special Files, TCP Connecting, Using Networking, Using Networking
+@comment node-name, next, previous, up
+@section @command{gawk} Networking Mechanisms
+@cindex network
+
+The @samp{|&} operator introduced in @command{gawk} 3.1 for use in
+communicating with a @dfn{co-process} is described in
+@ref{Two-way I/O, ,Two-way Communications With Another Process, gawk, GAWK: Effective AWK Programming}.
+It shows how to do two-way I/O to a
+separate process, sending it data with @code{print} or @code{printf} and
+reading data with @code{getline}. If you haven't read it already, you should
+detour there to do so.
+
+@command{gawk} transparently extends the two-way I/O mechanism to simple networking through
+the use of special @value{FN}s. When a ``co-process'' is started that matches
+the special files we are about to describe, @command{gawk} creates the appropriate network
+connection, and then two-way I/O proceeds as usual.
+
+At the C, C++ (and basic Perl) level, networking is accomplished
+via @dfn{sockets}, an Application Programming Interface (API) originally
+developed at the University of California at Berkeley that is now used
+almost universally for TCP/IP networking.
+Socket level programming, while fairly straightforward, requires paying
+attention to a number of details, as well as using binary data. It is not
+well-suited for use from a high-level language like @command{awk}.
+The special files provided in @command{gawk} hide the details from
+the programmer, making things much simpler and easier to use.
+@c Who sez we can't toot our own horn occasionally?
+
+The special @value{FN} for network access is made up of several fields, all
+of them mandatory, none of them optional:
+
+@example
+/inet/@var{protocol}/@var{localport}/@var{hostname}/@var{remoteport}
+@end example
+
+The @file{/inet/} field is, of course, constant when accessing the network.
+The @var{localport} and @var{remoteport} fields do not have a meaning
+when used with @file{/inet/raw} because ``ports'' only apply to
+TCP and UDP. So, when using @file{/inet/raw}, the port fields always have
+to be @samp{0}.
+
+@menu
+* Special File Fields:: The fields in the special file name.
+* Comparing Protocols:: Differences between the protocols.
+@end menu
+
+@node Special File Fields, Comparing Protocols, Gawk Special Files, Gawk Special Files
+@subsection The Fields of the Special @value{FFN}
+This @value{SECTION} explains the meaning of all the other fields,
+as well as the range of values and the defaults.
+All of the fields are mandatory. To let the system pick a value,
+or if the field doesn't apply to the protocol, specify it as @samp{0}.
+
+@table @var
+@item protocol
+Determines which member of the TCP/IP
+family of protocols is selected to transport the data across the
+network. There are three possible values (always written in lowercase):
+@samp{tcp}, @samp{udp}, and @samp{raw}. The exact meaning of each is
+explained later in this @value{SECTION}.
+
+@item localport
+Determines which port on the local
+machine is used to communicate across the network. It has no meaning
+with @file{/inet/raw} and must therefore be @samp{0}. Application level clients
+usually use @samp{0} to indicate they do not care which local port is
+used---instead they specify a remote port to connect to. It is vital for
+application level servers to use a number different from @samp{0} here
+because their service has to be available at a specific publicly-known
+port number. It is possible to use a name from @file{/etc/services} here.
+
+@item hostname
+Determines which remote host is to
+be at the other end of the connection. Application level servers must fill
+this field with a @samp{0} to indicate their being open for all other hosts
+to connect to them and enforce connection level server behavior this way.
+It is not possible for an application level server to restrict its
+availability to one remote host by entering a host name here.
+Application level clients must enter a name different from @samp{0}.
+The name can be either symbolic
+(e.g., @samp{jpl-devvax.jpl.nasa.gov}) or numeric (e.g., @samp{128.149.1.143}).
+
+@item remoteport
+Determines which port on the remote
+machine is used to communicate across the network. It has no meaning
+with @file{/inet/raw} and must therefore be 0.
+For @file{/inet/tcp} and @file{/inet/udp},
+application level clients @emph{must} use a number
+other than @samp{0} to indicate which port on the remote machine
+they want to connect to. Application level servers must not fill this field with
+a @samp{0}. Instead they specify a local port for clients to connect to.
+It is possible to use a name from @file{/etc/services} here.
+@end table
+
+Experts in network programming will notice that the usual
+client/server asymmetry found at the level of the socket API is not visible
+here. This is for the sake of simplicity of the high-level concept. If this
+asymmetry is necessary for your application,
+use another language.
+For @command{gawk}, it is
+more important to enable users to write a client program with a minimum
+of code. What happens when first accessing a network connection is seen
+in the following pseudo-code:
+
+@smallexample
+if ((name of remote host given) && (other side accepts connection)) @{
+ rendez-vous successful; transmit with getline or print
+@} else @{
+ if ((other side did not accept) && (localport == 0))
+ exit unsuccessful
+ if (TCP) @{
+ set up a server accepting connections
+ this means waiting for the client on the other side to connect
+ @} else
+ ready
+@}
+@end smallexample
+
+The exact behavior of this algorithm depends on the values of the
+fields of the special @value{FN}. When in doubt, the following table
+gives you the combinations of values and their meaning. If this
+table is too complicated, focus on the three lines printed in
+@strong{bold}. All the examples in
+@ref{Using Networking, ,Networking With @command{gawk}},
+use only the
+patterns printed in bold letters.
+
+@multitable {12345678901234} {123456} {123456} {1234567} {1234567890123456789012345}
+@item @sc{protocol} @tab @sc{local port} @tab @sc{host name}
+@tab @sc{remote port} @tab @sc{Resulting connection level behavior}
+@item @strong{tcp} @tab @strong{0} @tab @strong{x} @tab @strong{x} @tab
+ @strong{Dedicated client, fails if immediately connecting to a
+ server on the other side fails}
+@item udp @tab 0 @tab x @tab x @tab Dedicated client
+@item raw @tab 0 @tab x @tab 0 @tab Dedicated client, works only as @code{root}
+@item @strong{tcp, udp} @tab @strong{x} @tab @strong{x} @tab @strong{x} @tab
+ @strong{Client, switches to dedicated server if necessary}
+@item @strong{tcp, udp} @tab @strong{x} @tab @strong{0} @tab @strong{0} @tab
+ @strong{Dedicated server}
+@item raw @tab 0 @tab 0 @tab 0 @tab Dedicated server, works only as @code{root}
+@item tcp, udp, raw @tab x @tab x @tab 0 @tab Invalid
+@item tcp, udp, raw @tab 0 @tab 0 @tab x @tab Invalid
+@item tcp, udp, raw @tab x @tab 0 @tab x @tab Invalid
+@item tcp, udp @tab 0 @tab 0 @tab 0 @tab Invalid
+@item tcp, udp @tab 0 @tab x @tab 0 @tab Invalid
+@item raw @tab x @tab 0 @tab 0 @tab Invalid
+@item raw @tab 0 @tab x @tab x @tab Invalid
+@item raw @tab x @tab x @tab x @tab Invalid
+@end multitable
+
+In general, TCP is the preferred mechanism to use. It is the simplest
+protocol to understand and to use. Use the others only if circumstances
+demand low-overhead.
+
+@node Comparing Protocols, , Special File Fields, Gawk Special Files
+@subsection Comparing Protocols
+
+This @value{SECTION} develops a pair of programs (sender and receiver)
+that do nothing but send a timestamp from one machine to another. The
+sender and the receiver are implemented with each of the three protocols
+available and demonstrate the differences between them.
+
+@menu
+* File /inet/tcp:: The TCP special file.
+* File /inet/udp:: The UDB special file.
+* File /inet/raw:: The RAW special file.
+@end menu
+
+@node File /inet/tcp, File /inet/udp, Comparing Protocols, Comparing Protocols
+@subsubsection @file{/inet/tcp}
+@cindex @file{/inet/tcp} special files
+@cindex TCP
+Once again, always use TCP.
+(Use UDP when low-overhead is a necessity, and use RAW for
+network experimentation.)
+The first example is the sender
+program:
+
+@example
+# Server
+BEGIN @{
+ print strftime() |& "/inet/tcp/8888/0/0"
+ close("/inet/tcp/8888/0/0")
+@}
+@end example
+
+The receiver is very simple:
+
+@example
+# Client
+BEGIN @{
+ "/inet/tcp/0/localhost/8888" |& getline
+ print $0
+ close("/inet/tcp/0/localhost/8888")
+@}
+@end example
+
+TCP guarantees that the bytes arrive at the receiving end in exactly
+the same order that they were sent. No byte is lost
+(except for broken connections), doubled, or out of order. Some
+overhead is necessary to accomplish this, but this is the price to pay for
+a reliable service.
+It does matter which side starts first. The sender/server has to be started
+first, and it waits for the receiver to read a line.
+
+@node File /inet/udp, File /inet/raw, File /inet/tcp, Comparing Protocols
+@subsubsection @file{/inet/udp}
+@cindex @file{/inet/udp} special files
+@cindex UDP
+The server and client programs that use UDP are almost identical to their TCP counterparts;
+only the @var{protocol} has changed. As before, it does matter which side
+starts first. The receiving side blocks and waits for the sender.
+In this case, the receiver/client has to be started first:
+
+@page
+@example
+# Server
+BEGIN @{
+ print strftime() |& "/inet/udp/8888/0/0"
+ close("/inet/udp/8888/0/0")
+@}
+@end example
+
+The receiver is almost identical to the TCP receiver:
+
+@example
+# Client
+BEGIN @{
+ "/inet/udp/0/localhost/8888" |& getline
+ print $0
+ close("/inet/udp/0/localhost/8888")
+@}
+@end example
+
+UDP cannot guarantee that the datagrams at the receiving end will arrive in exactly
+the same order they were sent. Some datagrams could be
+lost, some doubled, and some out of order. But no overhead is necessary to
+accomplish this. This unreliable behavior is good enough for tasks
+such as data acquisition, logging, and even stateless services like NFS.
+
+@node File /inet/raw, , File /inet/udp, Comparing Protocols
+@subsubsection @file{/inet/raw}
+@cindex @file{/inet/raw} special files
+@cindex RAW
+
+This is an IP-level protocol. Only @code{root} is allowed to access this
+special file. It is meant to be the basis for implementing
+and experimenting with transport level protocols.@footnote{This special file
+is reserved, but not otherwise currently implemented.}
+In the most general case,
+the sender has to supply the encapsulating header bytes in front of the
+packet and the receiver has to strip the additional bytes from the message.
+
+@cindex dark corner
+RAW receivers cannot receive packets sent with TCP or UDP because the
+operating system does not deliver the packets to a RAW receiver. The
+operating system knows about some of the protocols on top of IP
+and decides on its own which packet to deliver to which process.
+@value{DARKCORNER}
+Therefore, the UDP receiver must be used for receiving UDP
+datagrams sent with the RAW sender. This is a dark corner, not only of
+@command{gawk}, but also of TCP/IP.
+
+@cindex SPAK utility
+For extended experimentation with protocols, look into
+the approach implemented in a tool called SPAK.
+This tool reflects the hierarchical layering of protocols (encapsulation)
+in the way data streams are piped out of one program into the next one.
+It shows which protocol is based on which other (lower-level) protocol
+by looking at the command-line ordering of the program calls.
+Cleverly thought out, SPAK is much better than @command{gawk}'s
+@file{/inet} for learning the meaning of each and every bit in the
+protocol headers.
+
+The next example uses the RAW protocol to emulate
+the behavior of UDP. The sender program is the same as above, but with some
+additional bytes that fill the places of the UDP fields:
+
+@example
+@group
+BEGIN @{
+ Message = "Hello world\n"
+ SourcePort = 0
+ DestinationPort = 8888
+ MessageLength = length(Message)+8
+ RawService = "/inet/raw/0/localhost/0"
+ printf("%c%c%c%c%c%c%c%c%s",
+ SourcePort/256, SourcePort%256,
+ DestinationPort/256, DestinationPort%256,
+ MessageLength/256, MessageLength%256,
+ 0, 0, Message) |& RawService
+ fflush(RawService)
+ close(RawService)
+@}
+@end group
+@end example
+
+Since this program tries
+to emulate the behavior of UDP, it checks if
+the RAW sender is understood by the UDP receiver but not if the RAW receiver
+can understand the UDP sender. In a real network, the
+RAW receiver is hardly
+of any use because it gets every IP packet that
+comes across the network. There are usually so many packets that
+@command{gawk} would be too slow for processing them.
+Only on a network with little
+traffic can the IP-level receiver program be tested. Programs for analyzing
+IP traffic on modem or ISDN channels should be possible.
+
+Port numbers do not have a meaning when using @file{/inet/raw}. Their fields
+have to be @samp{0}. Only TCP and UDP use ports. Receiving data from
+@file{/inet/raw} is difficult, not only because of processing speed but also
+because data is usually binary and not restricted to ASCII. This
+implies that line separation with @code{RS} does not work as usual.
+
+@node TCP Connecting, Troubleshooting, Gawk Special Files, Using Networking
+@section Establishing a TCP Connection
+
+Let's observe a network connection at work. Type in the following program
+and watch the output. Within a second, it connects via TCP (@file{/inet/tcp})
+to the machine it is running on (@samp{localhost}), and asks the service
+@samp{daytime} on the machine what time it is:
+
+@cindex @code{|&} I/O operator
+@cindex @code{getline} built-in function
+@example
+BEGIN @{
+ "/inet/tcp/0/localhost/daytime" |& getline
+ print $0
+ close("/inet/tcp/0/localhost/daytime")
+@}
+@end example
+
+Even experienced @command{awk} users will find the second line strange in two
+respects:
+
+@itemize @bullet
+@item
+A special file is used as a shell command that pipes its output
+into @code{getline}. One would rather expect to see the special file
+being read like any other file (@samp{getline <
+"/inet/tcp/0/localhost/daytime")}.
+
+@item
+The operator @samp{|&} has not been part of any @command{awk}
+implementation (until now).
+It is actually the only extension of the @command{awk}
+language needed (apart from the special files) to introduce network access.
+@end itemize
+
+The @samp{|&} operator was introduced in @command{gawk} 3.1 in order to
+overcome the crucial restriction that access to files and pipes in
+@command{awk} is always unidirectional. It was formerly impossible to use
+both access modes on the same file or pipe. Instead of changing the whole
+concept of file access, the @samp{|&} operator
+behaves exactly like the usual pipe operator except for two additions:
+
+@itemize @bullet
+@item
+Normal shell commands connected to their @command{gawk} program with a @samp{|&}
+pipe can be accessed bidirectionally. The @samp{|&} turns out to be a quite
+general, useful, and natural extension of @command{awk}.
+
+@item
+Pipes that consist of a special @value{FN} for network connections are not
+executed as shell commands. Instead, they can be read and written to, just
+like a full-duplex network connection.
+@end itemize
+
+In the earlier example, the @samp{|&} operator tells @code{getline}
+to read a line from the special file @file{/inet/tcp/0/localhost/daytime}.
+We could also have printed a line into the special file. But instead we just
+read a line with the time, printed it, and closed the connection.
+(While we could just let @command{gawk} close the connection by finishing
+the program, in this @value{DOCUMENT}
+we are pedantic, and always explicitly close the connections.)
+
+@node Troubleshooting, Interacting, TCP Connecting, Using Networking
+@section Troubleshooting Connection Problems
+It may well be that for some reason the above program does not run on your
+machine. When looking at possible reasons for this, you will learn much
+about typical problems that arise in network programming. First of all,
+your implementation of @command{gawk} may not support network access
+because it is
+a pre-3.1 version or you do not have a network interface in your machine.
+Perhaps your machine uses some other protocol
+like DECnet or Novell's IPX. For the rest of this @value{CHAPTER},
+we will assume
+you work on a Unix machine that supports TCP/IP. If the above program does
+not run on such a machine, it may help to replace the name
+@samp{localhost} with the name of your machine or its IP address. If it
+does, you could replace @samp{localhost} with the name of another machine
+in your vicinity. This way, the program connects to another machine.
+Now you should see the date and time being printed by the program.
+Otherwise your machine may not support the @samp{daytime} service.
+Try changing the service to @samp{chargen} or @samp{ftp}. This way, the program
+connects to other services that should give you some response. If you are
+curious, you should have a look at your file @file{/etc/services}. It could
+look like this:
+
+@ignore
+@multitable {1234567890123} {1234567890123} {123456789012345678901234567890123456789012}
+@item Service @strong{name} @tab Service @strong{number}
+@item echo @tab 7/tcp @tab echo sends back each line it receivces
+@item echo @tab 7/udp @tab echo is good for testing purposes
+@item discard @tab 9/tcp @tab discard behaves like @file{/dev/null}
+@item discard @tab 9/udp @tab discard just throws away each line
+@item daytime @tab 13/tcp @tab daytime sends date & time once per connection
+@item daytime @tab 13/udp
+@item chargen @tab 19/tcp @tab chargen infinitely produces character sets
+@item chargen @tab 19/udp @tab chargen is good for testing purposes
+@item ftp @tab 21/tcp @tab ftp is the usual file transfer protocol
+@item telnet @tab 23/tcp @tab telnet is the usual login facility
+@item smtp @tab 25/tcp @tab smtp is the Simple Mail Transfer Protocol
+@item finger @tab 79/tcp @tab finger tells you who is logged in
+@item www @tab 80/tcp @tab www is the HyperText Transfer Protocol
+@item pop2 @tab 109/tcp @tab pop2 is an older version of pop3
+@item pop2 @tab 109/udp
+@item pop3 @tab 110/tcp @tab pop3 is the Post Office Protocol
+@item pop3 @tab 110/udp @tab pop3 is used for receiving email
+@item nntp @tab 119/tcp @tab nntp is the USENET News Transfer Protocol
+@item irc @tab 194/tcp @tab irc is the Internet Relay Chat
+@item irc @tab 194/udp
+@end multitable
+@end ignore
+
+@smallexample
+# /etc/services:
+#
+# Network services, Internet style
+#
+# Name Number/Protcol Alternate name # Comments
+
+echo 7/tcp
+echo 7/udp
+discard 9/tcp sink null
+discard 9/udp sink null
+daytime 13/tcp
+daytime 13/udp
+chargen 19/tcp ttytst source
+chargen 19/udp ttytst source
+ftp 21/tcp
+telnet 23/tcp
+smtp 25/tcp mail
+finger 79/tcp
+www 80/tcp http # WorldWideWeb HTTP
+www 80/udp # HyperText Transfer Protocol
+pop-2 109/tcp postoffice # POP version 2
+pop-2 109/udp
+pop-3 110/tcp # POP version 3
+pop-3 110/udp
+nntp 119/tcp readnews untp # USENET News
+irc 194/tcp # Internet Relay Chat
+irc 194/udp
+@dots{}
+@end smallexample
+
+@cindex Linux
+@cindex GNU/Linux
+@cindex Microsoft Windows
+Here, you find a list of services that traditional Unix machines usually
+support. If your GNU/Linux machine does not do so, it may be that these
+services are switched off in some startup script. Systems running some
+flavor of Microsoft Windows usually do @emph{not} support such services.
+Nevertheless, it @emph{is} possible to do networking with @command{gawk} on
+Microsoft
+Windows.@footnote{Microsoft prefered to ignore the TCP/IP
+family of protocols until 1995. Then came the rise of the Netscape browser
+as a landmark ``killer application.'' Microsoft added TCP/IP support and
+their own browser to Microsoft Windows 95 at the last minute. They even back-ported
+their TCP/IP implementation to Microsoft Windows for Workgroups 3.11, but it was
+a rather rudimentary and half-hearted implementation. Nevertheless,
+the equivalent of @file{/etc/services} resides under
+@file{c:\windows\services} on Microsoft Windows.}
+The first column of the file gives the name of the service,
+the second a unique number, and the protocol that one can use to connect to
+this service.
+The rest of the line is treated as a comment.
+You see that some services (@samp{echo}) support TCP as
+well as UDP.
+
+@node Interacting, Setting Up, Troubleshooting, Using Networking
+@section Interacting with a Network Service
+
+The next program makes use of the possibility to really interact with a
+network service by printing something into the special file. It asks the
+so-called @command{finger} service if a user of the machine is logged in. When
+testing this program, try to change @samp{localhost} to
+some other machine name in your local network:
+
+@c system if test ! -d eg ; then mkdir eg ; fi
+@c system if test ! -d eg/network ; then mkdir eg/network ; fi
+@example
+@c file eg/network/fingerclient.awk
+BEGIN @{
+ NetService = "/inet/tcp/0/localhost/finger"
+ print "@var{name}" |& NetService
+ while ((NetService |& getline) > 0)
+ print $0
+ close(NetService)
+@}
+@c endfile
+@end example
+
+After telling the service on the machine which user to look for,
+the program repeatedly reads lines that come as a reply. When no more
+lines are coming (because the service has closed the connection), the
+program also closes the connection. Try replacing @code{"@var{name}"} with your
+login name (or the name of someone else logged in). For a list
+of all users currently logged in, replace @var{name} with an empty string
+@code{""}.
+
+@cindex Linux
+@cindex GNU/Linux
+The final @code{close} command could be safely deleted from
+the above script, because the operating system closes any open connection
+by default when a script reaches the end of execution. In order to avoid
+portability problems, it is best to always close connections explicitly.
+With the Linux kernel,
+for example, proper closing results in flushing of buffers. Letting
+the close happen by default may result in discarding buffers.
+
+@ignore
+@c Chuck comments that this seems out of place. He's right. I dunno
+@c where to put it though.
+@cindex @command{finger} utility
+@cindex RFC 1288
+In the early days of the Internet (up until about 1992), you could use
+such a program to check if some user in another country was logged in on
+a specific machine.
+RFC 1288@footnote{@uref{http://www.cis.ohio-state.edu/htbin/rfc/rfc1288.html}}
+provides the exact definition of the @command{finger} protocol.
+Every contemporary Unix system also has a command named @command{finger},
+which functions as a client for the protocol of the same name.
+Still today, some people maintain simple information systems
+with this ancient protocol. For example, by typing
+@samp{finger quake@@seismo.unr.edu}
+you get the latest @dfn{Earthquake Bulletin} for the state of Nevada.
+
+@cindex Earthquake Bulletin
+@smallexample
+$ finger quake@@seismo.unr.edu
+
+[@dots{}]
+
+DATE-(UTC)-TIME LAT LON DEP MAG COMMENTS
+yy/mm/dd hh:mm:ss deg. deg. km
+
+98/12/14 21:09:22 37.47N 116.30W 0.0 2.3Md 76.4 km S of WARM SPRINGS, NEVA
+98/12/14 22:05:09 39.69N 120.41W 11.9 2.1Md 53.8 km WNW of RENO, NEVADA
+98/12/15 14:14:19 38.04N 118.60W 2.0 2.3Md 51.0 km S of HAWTHORNE, NEVADA
+98/12/17 01:49:02 36.06N 117.58W 13.9 3.0Md 74.9 km SE of LONE PINE, CALIFOR
+98/12/17 05:39:26 39.95N 120.87W 6.2 2.6Md 101.6 km WNW of RENO, NEVADA
+98/12/22 06:07:42 38.68N 119.82W 5.2 2.3Md 50.7 km S of CARSON CITY, NEVAD
+@end smallexample
+
+@noindent
+This output from @command{finger} contains the time, location, depth,
+magnitude, and a short comment about
+the earthquakes registered in that region during the last 10 days.
+In many places today the use of such services is restricted
+because most networks have firewalls and proxy servers between them
+and the Internet. Most firewalls are programmed to not let
+@command{finger} requests go beyond the local network.
+
+@cindex Coke machine
+Another (ab)use of the @command{finger} protocol are several Coke machines
+that are connected to the Internet. There is a short list of such
+Coke machines.@footnote{@uref{http://ca.yahoo.com/Computers_and_Internet/Internet/Devices_Connected_to_the_Internet/Soda_Machines/}}
+You can access them either from the command-line or with a simple
+@command{gawk} script. They usually tell you about the different
+flavors of Coke and beer available there. If you have an account there,
+you can even order some drink this way.
+@end ignore
+
+When looking at @file{/etc/services} you may have noticed that the
+@samp{daytime} service is also available with @samp{udp}. In the earlier
+example, change @samp{tcp} to @samp{udp},
+and change @samp{finger} to @samp{daytime}.
+After starting the modified program, you see the expected day and time message.
+The program then hangs, because it waits for more lines coming from the
+service. However, they never come. This behavior is a consequence of the
+differences between TCP and UDP. When using UDP, neither party is
+automatically informed about the other closing the connection.
+Continuing to experiment this way reveals many other subtle
+differences between TCP and UDP. To avoid such trouble, one should always
+remember the advice Douglas E.@: Comer and David Stevens give in
+Volume III of their series @cite{Internetworking With TCP}
+(page 14):
+
+@cindex TCP
+@cindex UDP
+@quotation
+When designing client-server applications, beginners are strongly
+advised to use TCP because it provides reliable, connection-oriented
+communication. Programs only use UDP if the application protocol handles
+reliability, the application requires hardware broadcast or multicast,
+or the application cannot tolerate virtual circuit overhead.
+@end quotation
+
+@node Setting Up, Email, Interacting, Using Networking
+@section Setting Up a Service
+The preceding programs behaved as clients that connect to a server somewhere
+on the Internet and request a particular service. Now we set up such a
+service to mimic the behavior of the @samp{daytime} service.
+Such a server does not know in advance who is going to connect to it over
+the network. Therefore we cannot insert a name for the host to connect to
+in our special @value{FN}.
+
+Start the following program in one window. Notice that the service does
+not have the name @samp{daytime}, but the number @samp{8888}.
+From looking at @file{/etc/services}, you know that names like @samp{daytime}
+are just mnemonics for predetermined 16-bit integers.
+Only the system administrator (@code{root}) could enter
+our new service into @file{/etc/services} with an appropriate name.
+Also notice that the service name has to be entered into a different field
+of the special @value{FN} because we are setting up a server, not a client:
+
+@cindex @command{finger} utility
+@cindex server
+@example
+BEGIN @{
+ print strftime() |& "/inet/tcp/8888/0/0"
+ close("/inet/tcp/8888/0/0")
+@}
+@end example
+
+Now open another window on the same machine.
+Copy the client program given as the first example
+(@pxref{TCP Connecting, ,Establishing a TCP Connection})
+to a new file and edit it, changing the name @samp{daytime} to
+@samp{8888}. Then start the modified client. You should get a reply
+like this:
+
+@example
+Sat Sep 27 19:08:16 CEST 1997
+@end example
+
+@noindent
+Both programs explicitly close the connection.
+
+@cindex Microsoft Windows
+@cindex reserved ports
+Now we will intentionally make a mistake to see what happens when the name
+@samp{8888} (the so-called port) is already used by another service.
+Start the server
+program in both windows. The first one works, but the second one
+complains that it could not open the connection. Each port on a single
+machine can only be used by one server program at a time. Now terminate the
+server program and change the name @samp{8888} to @samp{echo}. After restarting it,
+the server program does not run any more and you know why: there already is
+an @samp{echo} service running on your machine. But even if this isn't true,
+you would not get
+your own @samp{echo} server running on a Unix machine,
+because the ports with numbers smaller
+than 1024 (@samp{echo} is at port 7) are reserved for @code{root}.
+On machines running some flavor of Microsoft Windows, there is no restriction
+that reserves ports 1 to 1024 for a privileged user; hence you can start
+an @samp{echo} server there.
+
+Turning this short server program into something really useful is simple.
+Imagine a server that first reads a @value{FN} from the client through the
+network connection, then does something with the file and
+sends a result back to the client. The server-side processing
+could be:
+
+@example
+BEGIN @{
+ NetService = "/inet/tcp/8888/0/0"
+ NetService |& getline
+ CatPipe = ("cat " $1) # sets $0 and the fields
+ while ((CatPipe | getline) > 0)
+ print $0 |& NetService
+ close(NetService)
+@}
+@end example
+
+@noindent
+and we would
+have a remote copying facility. Such a server reads the name of a file
+from any client that connects to it and transmits the contents of the
+named file across the net. The server-side processing could also be
+the execution of a command that is transmitted across the network. From this
+example, you can see how simple it is to open up a security hole on your
+machine. If you allow clients to connect to your machine and
+execute arbitrary commands, anyone would be free to do @samp{rm -rf *}.
+
+@node Email, Web page, Setting Up, Using Networking
+@section Reading Email
+@cindex POP
+@cindex SMTP
+@cindex RFC 1939
+@cindex RFC 821
+The distribution of email is usually done by dedicated email servers that
+communicate with your machine using special protocols. To receive email, we
+will use the Post Office Protocol (POP). Sending can be done with the much
+older Simple Mail Transfer Protocol (SMTP).
+@ignore
+@footnote{RFC 1939 defines POP.
+RFC 821 defines SMTP. See
+@uref{http://rfc.fh-koeln.de/doc/rfc/html/rfc.html, RFCs in HTML}.}
+@end ignore
+
+When you type in the following program, replace the @var{emailhost} by the
+name of your local email server. Ask your administrator if the server has a
+POP service, and then use its name or number in the program below.
+Now the program is ready to connect to your email server, but it will not
+succeed in retrieving your mail because it does not yet know your login
+name or password. Replace them in the program and it
+shows you the first email the server has in store:
+
+@example
+BEGIN @{
+ POPService = "/inet/tcp/0/@var{emailhost}/pop3"
+ RS = ORS = "\r\n"
+ print "user @var{name}" |& POPService
+ POPService |& getline
+ print "pass @var{password}" |& POPService
+ POPService |& getline
+ print "retr 1" |& POPService
+ POPService |& getline
+ if ($1 != "+OK") exit
+ print "quit" |& POPService
+ RS = "\r\n\\.\r\n"
+ POPService |& getline
+ print $0
+ close(POPService)
+@}
+@end example
+
+@cindex RFC 1939
+The record separators @code{RS} and @code{ORS} are redefined because the
+protocol (POP) requires CR-LF to separate lines. After identifying
+yourself to the email service, the command @samp{retr 1} instructs the
+service to send the first of all your email messages in line. If the service
+replies with something other than @samp{+OK}, the program exits; maybe there
+is no email. Otherwise, the program first announces that it intends to finish
+reading email, and then redefines @code{RS} in order to read the entire
+email as multiline input in one record. From the POP RFC, we know that the body
+of the email always ends with a single line containing a single dot.
+The program looks for this using @samp{RS = "\r\n\\.\r\n"}.
+When it finds this sequence in the mail message, it quits.
+You can invoke this program as often as you like; it does not delete the
+message it reads, but instead leaves it on the server.
+
+@node Web page, Primitive Service, Email, Using Networking
+@section Reading a Web Page
+@cindex HTTP
+@cindex RFC 2068
+@cindex RFC 2616
+
+Retrieving a web page from a web server is as simple as
+retrieving email from an email server. We only have to use a
+similar, but not identical, protocol and a different port. The name of the
+protocol is HyperText Transfer Protocol (HTTP) and the port number is usually
+80. As in the preceding @value{SECTION}, ask your administrator about the
+name of your local web server or proxy web server and its port number
+for HTTP requests.
+
+@ignore
+@c Chuck says this stuff isn't necessary
+More detailed information about HTTP can be found at
+the home of the web protocols,@footnote{@uref{http://www.w3.org/pub/WWW/Protocols}}
+including the specification of HTTP in RFC 2068. The protocol specification
+in RFC 2068 is concise and you can get it for free. If you need more
+explanation and you are willing to pay for a book, you might be
+interested in one of these books:
+
+@enumerate
+
+@item
+When we started writing web clients and servers with @command{gawk},
+the only book available with details about HTTP was the one by Paul Hethmon
+called
+@cite{Illustrated Guide to HTTP}.@footnote{@uref{http://www.browsebooks.com/Hethmon/?882}}
+Hethmon not only describes HTTP,
+he also implements a simple web server in C++.
+
+@item
+Since July 2000, O'Reilly offers the book by Clinton Wong called
+@cite{HTTP Pocket Reference}.@footnote{@uref{http://www.oreilly.com/catalog/httppr}}
+It only has 75 pages but its
+focus definitely is HTTP. This pocket reference is not a replacement
+for the RFC, but I wish I had had it back in 1997 when I started writing
+scripts to handle HTTP.
+
+@item
+Another small booklet about HTTP is the one by Toexcell Incorporated Staff,
+ISBN 1-58348-270-9, called
+@cite{Hypertext Transfer Protocol Http 1.0 Specifications}
+
+@end enumerate
+@end ignore
+
+The following program employs a rather crude approach toward retrieving a
+web page. It uses the prehistoric syntax of HTTP 0.9, which almost all
+web servers still support. The most noticeable thing about it is that the
+program directs the request to the local proxy server whose name you insert
+in the special @value{FN} (which in turn calls @samp{www.yahoo.com}):
+
+@example
+BEGIN @{
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/0/@var{proxy}/80"
+ print "GET http://www.yahoo.com" |& HttpService
+ while ((HttpService |& getline) > 0)
+ print $0
+ close(HttpService)
+@}
+@end example
+
+@cindex RFC 1945
+@cindex HTML
+@cindex Yahoo!
+Again, lines are separated by a redefined @code{RS} and @code{ORS}.
+The @code{GET} request that we send to the server is the only kind of
+HTTP request that existed when the web was created in the early 1990s.
+HTTP calls this @code{GET} request a ``method,'' which tells the
+service to transmit a web page (here the home page of the Yahoo! search
+engine). Version 1.0 added the request methods @code{HEAD} and
+@code{POST}. The current version of HTTP is 1.1,@footnote{Version 1.0 of
+HTTP was defined in RFC 1945. HTTP 1.1 was initially specified in RFC
+2068. In June 1999, RFC 2068 was made obsolete by RFC 2616. It is an update
+without any substantial changes.} and knows the additional request
+methods @code{OPTIONS}, @code{PUT}, @code{DELETE}, and @code{TRACE}.
+You can fill in any valid web address, and the program prints the
+HTML code of that page to your screen.
+
+Notice the similarity between the responses of the POP and HTTP
+services. First, you get a header that is terminated by an empty line, and
+then you get the body of the page in HTML. The lines of the headers also
+have the same form as in POP. There is the name of a parameter,
+then a colon, and finally the value of that parameter.
+
+@cindex CGI
+@cindex @file{gif} image format
+@cindex @file{png} image format
+Images (@file{.png} or @file{.gif} files) can also be retrieved this way,
+but then you
+get binary data that should be redirected into a file. Another
+application is calling a CGI (Common Gateway Interface) script on some
+server. CGI scripts are used when the contents of a web page are not
+constant, but generated instantly at the moment you send a request
+for the page. For example, to get a detailed report about the current
+quotes of Motorola stock shares, call a CGI script at Yahoo! with
+the following:
+
+@example
+get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
+print get |& HttpService
+@end example
+
+You can also request weather reports this way.
+@ignore
+@cindex Boutell, Thomas
+A good book to go on with is
+the
+@cite{HTML Source Book}.@footnote{@uref{http://www.utoronto.ca/webdocs/HTMLdocs/NewHTML/book.html}}
+There are also some books on CGI programming
+like @cite{CGI Programming in C & Perl},
+by Thomas Boutell@footnote{@uref{http://cseng.aw.com/bookdetail.qry?ISBN=0-201-42219-0&ptype=0}},
+and @cite{The CGI Book}.@footnote{@uref{http://www.cgibook.com}}
+Another good source is @cite{The CGI Resource Index}}.@footnote{@uref{http://www.cgi-resources.com}}
+@end ignore
+
+@node Primitive Service, Interacting Service, Web page, Using Networking
+@section A Primitive Web Service
+Now we know enough about HTTP to set up a primitive web service that just
+says @code{"Hello, world"} when someone connects to it with a browser.
+Compared
+to the situation in the preceding @value{SECTION}, our program changes the role. It
+tries to behave just like the server we have observed. Since we are setting
+up a server here, we have to insert the port number in the @samp{localport}
+field of the special @value{FN}. The other two fields (@var{hostname} and
+@var{remoteport}) have to contain a @samp{0} because we do not know in
+advance which host will connect to our service.
+
+In the early 1990s, all a server had to do was send an HTML document and
+close the connection. Here, we adhere to the modern syntax of HTTP.
+The steps are as follows:
+
+@enumerate 1
+@item
+Send a status line telling the web browser that everything
+is OK.
+
+@item
+Send a line to tell the browser how many bytes follow in the
+body of the message. This was not necessary earlier because both
+parties knew that the document ended when the connection closed. Nowadays
+it is possible to stay connected after the transmission of one web page.
+This is to avoid the network traffic necessary for repeatedly establishing
+TCP connections for requesting several images. Thus, there is the need to tell
+the receiving party how many bytes will be sent. The header is terminated
+as usual with an empty line.
+
+@item
+Send the @code{"Hello, world"} body
+in HTML.
+The useless @code{while} loop swallows the request of the browser.
+We could actually omit the loop, and on most machines the program would still
+work.
+First, start the following program:
+@end enumerate
+
+@example
+@c file eg/network/hello-serv.awk
+BEGIN @{
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/8080/0/0"
+ Hello = "<HTML><HEAD>" \
+ "<TITLE>A Famous Greeting</TITLE></HEAD>" \
+ "<BODY><H1>Hello, world</H1></BODY></HTML>"
+ Len = length(Hello) + length(ORS)
+ print "HTTP/1.0 200 OK" |& HttpService
+ print "Content-Length: " Len ORS |& HttpService
+ print Hello |& HttpService
+ while ((HttpService |& getline) > 0)
+ continue;
+ close(HttpService)
+@}
+@c endfile
+@end example
+
+Now, on the same machine, start your favorite browser and let it point to
+@uref{http://localhost:8080} (the browser needs to know on which port
+our server is listening for requests). If this does not work, the browser
+probably tries to connect to a proxy server that does not know your machine.
+If so, change the browser's configuration so that the browser does not try to
+use a proxy to connect to your machine.
+
+@node Interacting Service, Simple Server, Primitive Service, Using Networking
+@section A Web Service with Interaction
+@cindex GUI
+@ifinfo
+This node shows how to set up a simple web server.
+The subnode is a library file that we will use with all the examples in
+@ref{Some Applications and Techniques}.
+@end ifinfo
+
+@menu
+* CGI Lib:: A simple CGI library.
+@end menu
+
+Setting up a web service that allows user interaction is more difficult and
+shows us the limits of network access in @command{gawk}. In this @value{SECTION},
+we develop a main program (a @code{BEGIN} pattern and its action)
+that will become the core of event-driven execution controlled by a
+graphical user interface (GUI).
+Each HTTP event that the user triggers by some action within the browser
+is received in this central procedure. Parameters and menu choices are
+extracted from this request and an appropriate measure is taken according to
+the user's choice.
+For example:
+
+@cindex HTTP server, core logic
+@example
+BEGIN @{
+ if (MyHost == "") @{
+ "uname -n" | getline MyHost
+ close("uname -n")
+ @}
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ MyPrefix = "http://" MyHost ":" MyPort
+ SetUpServer()
+ while ("awk" != "complex") @{
+ # header lines are terminated this way
+ RS = ORS = "\r\n"
+ Status = 200 # this means OK
+ Reason = "OK"
+ Header = TopHeader
+ Document = TopDoc
+ Footer = TopFooter
+ if (GETARG["Method"] == "GET") @{
+ HandleGET()
+ @} else if (GETARG["Method"] == "HEAD") @{
+ # not yet implemented
+ @} else if (GETARG["Method"] != "") @{
+ print "bad method", GETARG["Method"]
+ @}
+ Prompt = Header Document Footer
+ print "HTTP/1.0", Status, Reason |& HttpService
+ print "Connection: Close" |& HttpService
+ print "Pragma: no-cache" |& HttpService
+ len = length(Prompt) + length(ORS)
+ print "Content-length:", len |& HttpService
+ print ORS Prompt |& HttpService
+ # ignore all the header lines
+ while ((HttpService |& getline) > 0)
+ ;
+ # stop talking to this client
+ close(HttpService)
+ # wait for new client request
+ HttpService |& getline
+ # do some logging
+ print systime(), strftime(), $0
+ # read request parameters
+ CGI_setup($1, $2, $3)
+ @}
+@}
+@end example
+
+This web server presents menu choices in the form of HTML links.
+Therefore, it has to tell the browser the name of the host it is
+residing on. When starting the server, the user may supply the name
+of the host from the command line with @samp{gawk -v MyHost="Rumpelstilzchen"}.
+If the user does not do this, the server looks up the name of the host it is
+running on for later use as a web address in HTML documents. The same
+applies to the port number. These values are inserted later into the
+HTML content of the web pages to refer to the home system.
+
+Each server that is built around this core has to initialize some
+application-dependent variables (such as the default home page) in a procedure
+@code{SetUpServer}, which is called immediately before entering the
+infinite loop of the server. For now, we will write an instance that
+initiates a trivial interaction. With this home page, the client user
+can click on two possible choices, and receive the current date either
+in human-readable format or in seconds since 1970:
+
+@example
+function SetUpServer() @{
+ TopHeader = "<HTML><HEAD>"
+ TopHeader = TopHeader \
+ "<title>My name is GAWK, GNU AWK</title></HEAD>"
+ TopDoc = "<BODY><h2>\
+ Do you prefer your date <A HREF=" MyPrefix \
+ "/human>human</A> or \
+ <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS
+ TopFooter = "</BODY></HTML>"
+@}
+@end example
+
+On the first run through the main loop, the default line terminators are
+set and the default home page is copied to the actual home page. Since this
+is the first run, @code{GETARG["Method"]} is not initialized yet, hence the
+case selection over the method does nothing. Now that the home page is
+initialized, the server can start communicating to a client browser.
+
+@cindex RFC 2068
+@cindex CGI
+It does so by printing the HTTP header into the network connection
+(@samp{print @dots{} |& HttpService}). This command blocks execution of
+the server script until a client connects. If this server
+script is compared with the primitive one we wrote before, you will notice
+two additional lines in the header. The first instructs the browser
+to close the connection after each request. The second tells the
+browser that it should never try to @emph{remember} earlier requests
+that had identical web addresses (no caching). Otherwise, it could happen
+that the browser retrieves the time of day in the previous example just once,
+and later it takes the web page from the cache, always displaying the same
+time of day although time advances each second.
+
+Having supplied the initial home page to the browser with a valid document
+stored in the parameter @code{Prompt}, it closes the connection and waits
+for the next request. When the request comes, a log line is printed that
+allows us to see which request the server receives. The final step in the
+loop is to call the function @code{CGI_setup}, which reads all the lines
+of the request (coming from the browser), processes them, and stores the
+transmitted parameters in the array @code{PARAM}. The complete
+text of these application-independent functions can be found in
+@ref{CGI Lib, ,A Simple CGI Library}.
+For now, we use a simplified version of @code{CGI_setup}:
+
+@example
+function CGI_setup( method, uri, version, i) @{
+ delete GETARG; delete MENU; delete PARAM
+ GETARG["Method"] = $1
+ GETARG["URI"] = $2
+ GETARG["Version"] = $3
+ i = index($2, "?")
+ # is there a "?" indicating a CGI request?
+@group
+ if (i > 0) @{
+ split(substr($2, 1, i-1), MENU, "[/:]")
+ split(substr($2, i+1), PARAM, "&")
+ for (i in PARAM) @{
+ j = index(PARAM[i], "=")
+ GETARG[substr(PARAM[i], 1, j-1)] = \
+ substr(PARAM[i], j+1)
+ @}
+ @} else @{ # there is no "?", no need for splitting PARAMs
+ split($2, MENU, "[/:]")
+ @}
+@end group
+@}
+@end example
+
+At first, the function clears all variables used for
+global storage of request parameters. The rest of the function serves
+the purpose of filling the global parameters with the extracted new values.
+To accomplish this, the name of the requested resource is split into
+parts and stored for later evaluation. If the request contains a @samp{?},
+then the request has CGI variables seamlessly appended to the web address.
+Everything in front of the @samp{?} is split up into menu items, and
+everything behind the @samp{?} is a list of @samp{@var{variable}=@var{value}} pairs
+(separated by @samp{&}) that also need splitting. This way, CGI variables are
+isolated and stored. This procedure lacks recognition of special characters
+that are transmitted in coded form@footnote{As defined in RFC 2068.}. Here, any
+optional request header and body parts are ignored. We do not need
+header parameters and the request body. However, when refining our approach or
+working with the @code{POST} and @code{PUT} methods, reading the header
+and body
+becomes inevitable. Header parameters should then be stored in a global
+array as well as the body.
+
+On each subsequent run through the main loop, one request from a browser is
+received, evaluated, and answered according to the user's choice. This can be
+done by letting the value of the HTTP method guide the main loop into
+execution of the procedure @code{HandleGET}, which evaluates the user's
+choice. In this case, we have only one hierarchical level of menus,
+but in the general case,
+menus are nested.
+The menu choices at each level are
+separated by @samp{/}, just as in @value{FN}s. Notice how simple it is to
+construct menus of arbitrary depth:
+
+@example
+function HandleGET() @{
+ if ( MENU[2] == "human") @{
+ Footer = strftime() TopFooter
+ @} else if (MENU[2] == "POSIX") @{
+ Footer = systime() TopFooter
+ @}
+@}
+@end example
+
+@cindex CGI
+The disadvantage of this approach is that our server is slow and can
+handle only one request at a time. Its main advantage, however, is that
+the server
+consists of just one @command{gawk} program. No need for installing an
+@command{httpd}, and no need for static separate HTML files, CGI scripts, or
+@code{root} privileges. This is rapid prototyping.
+This program can be started on the same host that runs your browser.
+Then let your browser point to @uref{http://localhost:8080}.
+
+@cindex @file{xbm} image format
+@cindex image format
+@cindex GNUPlot utility
+It is also possible to include images into the HTML pages.
+Most browsers support the not very well-known
+@file{.xbm} format,
+which may contain only
+monochrome pictures but is an ASCII format. Binary images are possible but
+not so easy to handle. Another way of including images is to generate them
+with a tool such as GNUPlot,
+by calling the tool with the @code{system} function or through a pipe.
+
+@node CGI Lib, , Interacting Service, Interacting Service
+@subsection A Simple CGI Library
+@quotation
+@i{HTTP is like being married: you have to be able to handle whatever
+you're given, while being very careful what you send back.}@*
+Phil Smith III,@*
+@uref{http://www.netfunny.com/rhf/jokes/99/Mar/http.html}
+@end quotation
+
+In @ref{Interacting Service, ,A Web Service with Interaction},
+we saw the function @code{CGI_setup} as part of the web server
+``core logic'' framework. The code presented there handles almost
+everything necessary for CGI requests.
+One thing it doesn't do is handle encoded characters in the requests.
+For example, an @samp{&} is encoded as a percent sign followed by
+the hexadecimal value---@samp{%26}. These encoded values should be
+decoded.
+Following is a simple library to perform these tasks.
+This code is used for all web server examples
+used throughout the rest of this @value{DOCUMENT}.
+If you want to use it for your own web server, store the source code
+into a file named @file{inetlib.awk}. Then you can include
+these functions into your code by placing the following statement
+into your program:
+
+@example
+@@include inetlib.awk
+@end example
+
+@noindent
+on the first line of your script. But beware, this mechanism is
+only possible if you invoke your web server script with @command{igawk}
+instead of the usual @command{awk} or @command{gawk}.
+Here is the code:
+
+@example
+@c file eg/network/coreserv.awk
+# CGI Library and core of a web server
+@c endfile
+@ignore
+@c file eg/network/coreserv.awk
+#
+# Juergen Kahrs, Juergen.Kahrs@@vr-web.de
+# with Arnold Robbins, arnold@@gnu.org
+# September 2000
+
+@c endfile
+@end ignore
+@c file eg/network/coreserv.awk
+# Global arrays
+# GETARG --- arguments to CGI GET command
+# MENU --- menu items (path names)
+# PARAM --- parameters of form x=y
+
+# Optional variable MyHost contains host address
+# Optional variable MyPort contains port number
+# Needs TopHeader, TopDoc, TopFooter
+# Sets MyPrefix, HttpService, Status, Reason
+
+BEGIN @{
+ if (MyHost == "") @{
+ "uname -n" | getline MyHost
+ close("uname -n")
+ @}
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ MyPrefix = "http://" MyHost ":" MyPort
+ SetUpServer()
+ while ("awk" != "complex") @{
+ # header lines are terminated this way
+ RS = ORS = "\r\n"
+ Status = 200 # this means OK
+ Reason = "OK"
+ Header = TopHeader
+ Document = TopDoc
+ Footer = TopFooter
+ if (GETARG["Method"] == "GET") @{
+ HandleGET()
+ @} else if (GETARG["Method"] == "HEAD") @{
+ # not yet implemented
+ @} else if (GETARG["Method"] != "") @{
+ print "bad method", GETARG["Method"]
+ @}
+ Prompt = Header Document Footer
+ print "HTTP/1.0", Status, Reason |& HttpService
+ print "Connection: Close" |& HttpService
+ print "Pragma: no-cache" |& HttpService
+ len = length(Prompt) + length(ORS)
+ print "Content-length:", len |& HttpService
+ print ORS Prompt |& HttpService
+ # ignore all the header lines
+ while ((HttpService |& getline) > 0)
+ continue
+ # stop talking to this client
+ close(HttpService)
+ # wait for new client request
+ HttpService |& getline
+ # do some logging
+ print systime(), strftime(), $0
+ CGI_setup($1, $2, $3)
+ @}
+@}
+
+function CGI_setup( method, uri, version, i)
+@{
+ delete GETARG
+ delete MENU
+ delete PARAM
+ GETARG["Method"] = method
+ GETARG["URI"] = uri
+ GETARG["Version"] = version
+
+ i = index(uri, "?")
+ if (i > 0) @{ # is there a "?" indicating a CGI request?
+ split(substr(uri, 1, i-1), MENU, "[/:]")
+ split(substr(uri, i+1), PARAM, "&")
+ for (i in PARAM) @{
+ PARAM[i] = _CGI_decode(PARAM[i])
+ j = index(PARAM[i], "=")
+ GETARG[substr(PARAM[i], 1, j-1)] = \
+ substr(PARAM[i], j+1)
+ @}
+ @} else @{ # there is no "?", no need for splitting PARAMs
+ split(uri, MENU, "[/:]")
+ @}
+ for (i in MENU) # decode characters in path
+ if (i > 4) # but not those in host name
+ MENU[i] = _CGI_decode(MENU[i])
+@}
+@c endfile
+@end example
+
+This isolates details in a single function, @code{CGI_setup}.
+Decoding of encoded characters is pushed off to a helper function,
+@code{_CGI_decode}. The use of the leading underscore (@samp{_}) in
+the function name is intended to indicate that it is an ``internal''
+function, although there is nothing to enforce this:
+
+@example
+@c file eg/network/coreserv.awk
+function _CGI_decode(str, hexdigs, i, pre, code1, code2,
+ val, result)
+@{
+ hexdigs = "123456789abcdef"
+
+ i = index(str, "%")
+ if (i == 0) # no work to do
+ return str
+
+ do @{
+ pre = substr(str, 1, i-1) # part before %xx
+ code1 = substr(str, i+1, 1) # first hex digit
+ code2 = substr(str, i+2, 1) # second hex digit
+ str = substr(str, i+3) # rest of string
+
+ code1 = tolower(code1)
+ code2 = tolower(code2)
+ val = index(hexdigs, code1) * 16 \
+ + index(hexdigs, code2)
+
+ result = result pre sprintf("%c", val)
+ i = index(str, "%")
+ @} while (i != 0)
+ if (length(str) > 0)
+ result = result str
+ return result
+@}
+@c endfile
+@end example
+
+This works by splitting the string apart around an encoded character.
+The two digits are converted to lowercase and looked up in a string
+of hex digits. Note that @code{0} is not in the string on purpose;
+@code{index} returns zero when it's not found, automatically giving
+the correct value! Once the hexadecimal value is converted from
+characters in a string into a numerical value, @code{sprintf}
+converts the value back into a real character.
+The following is a simple test harness for the above functions:
+
+@example
+@c file eg/network/testserv.awk
+BEGIN @{
+ CGI_setup("GET",
+ "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
+ "&percent=a %25 sign",
+ "1.0")
+ for (i in MENU)
+ printf "MENU[\"%s\"] = %s\n", i, MENU[i]
+ for (i in PARAM)
+ printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
+ for (i in GETARG)
+ printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
+@}
+@c endfile
+@end example
+
+And this is the result when we run it:
+
+@c artificial line wrap in last output line
+@example
+$ gawk -f testserv.awk
+@print{} MENU["4"] = www.gnu.org
+@print{} MENU["5"] = cgi-bin
+@print{} MENU["6"] = foo
+@print{} MENU["1"] = http
+@print{} MENU["2"] =
+@print{} MENU["3"] =
+@print{} PARAM["1"] = p1=stuff
+@print{} PARAM["2"] = p2=stuff&junk
+@print{} PARAM["3"] = percent=a % sign
+@print{} GETARG["p1"] = stuff
+@print{} GETARG["percent"] = a % sign
+@print{} GETARG["p2"] = stuff&junk
+@print{} GETARG["Method"] = GET
+@print{} GETARG["Version"] = 1.0
+@print{} GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
+p2=stuff%26junk&percent=a %25 sign
+@end example
+
+@node Simple Server, Caveats, Interacting Service, Using Networking
+@section A Simple Web Server
+@cindex GUI
+In the preceding @value{SECTION}, we built the core logic for event driven GUIs.
+In this @value{SECTION}, we finally extend the core to a real application.
+No one would actually write a commercial web server in @command{gawk}, but
+it is instructive to see that it is feasible in principle.
+
+@iftex
+@image{uf002331,4in}
+@end iftex
+
+@cindex ELIZA program
+@cindex Weizenbaum, Joseph
+The application is ELIZA, the famous program by Joseph Weizenbaum that
+mimics the behavior of a professional psychotherapist when talking to you.
+Weizenbaum would certainly object to this description, but this is part of
+the legend around ELIZA.
+Take the site-independent core logic and append the following code:
+
+@example
+@c file eg/network/eliza.awk
+function SetUpServer() @{
+ SetUpEliza()
+ TopHeader = \
+ "<HTML><title>An HTTP-based System with GAWK</title>\
+ <HEAD><META HTTP-EQUIV=\"Content-Type\"\
+ CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\
+ <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\
+ LINK=\"#0000ff\" VLINK=\"#0000ff\"\
+ ALINK=\"#0000ff\"> <A NAME=\"top\">"
+ TopDoc = "\
+ <h2>Please choose one of the following actions:</h2>\
+ <UL>\
+ <LI>\
+ <A HREF=" MyPrefix "/AboutServer>About this server</A>\
+ </LI><LI>\
+ <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\
+ <LI>\
+ <A HREF=" MyPrefix \
+ "/StartELIZA>Start talking to Eliza</A></LI></UL>"
+ TopFooter = "</BODY></HTML>"
+@}
+@c endfile
+@end example
+
+@code{SetUpServer} is similar to the previous example,
+except for calling another function, @code{SetUpEliza}.
+This approach can be used to implement other kinds of servers.
+The only changes needed to do so are hidden in the functions
+@code{SetUpServer} and @code{HandleGET}. Perhaps it might be necessary to
+implement other HTTP methods.
+The @command{igawk} program that comes with @command{gawk}
+may be useful for this process.
+
+When extending this example to a complete application, the first
+thing to do is to implement the function @code{SetUpServer} to
+initialize the HTML pages and some variables. These initializations
+determine the way your HTML pages look (colors, titles, menu
+items, etc.).
+
+@cindex GUI
+The function @code{HandleGET} is a nested case selection that decides
+which page the user wants to see next. Each nesting level refers to a menu
+level of the GUI. Each case implements a certain action of the menu. On the
+deepest level of case selection, the handler essentially knows what the
+user wants and stores the answer into the variable that holds the HTML
+page contents:
+
+@smallexample
+@c file eg/network/eliza.awk
+function HandleGET() @{
+ # A real HTTP server would treat some parts of the URI as a file name.
+ # We take parts of the URI as menu choices and go on accordingly.
+ if(MENU[2] == "AboutServer") @{
+ Document = "This is not a CGI script.\
+ This is an httpd, an HTML file, and a CGI script all \
+ in one GAWK script. It needs no separate www-server, \
+ no installation, and no root privileges.\
+ <p>To run it, do this:</p><ul>\
+ <li> start this script with \"gawk -f httpserver.awk\",</li>\
+ <li> and on the same host let your www browser open location\
+ \"http://localhost:8080\"</li>\
+ </ul>\<p>\ Details of HTTP come from:</p><ul>\
+ <li>Hethmon: Illustrated Guide to HTTP</p>\
+ <li>RFC 2068</li></ul><p>JK 14.9.1997</p>"
+ @} else if (MENU[2] == "AboutELIZA") @{
+ Document = "This is an implementation of the famous ELIZA\
+ program by Joseph Weizenbaum. It is written in GAWK and\
+/bin/sh: expad: command not found
+ @} else if (MENU[2] == "StartELIZA") @{
+ gsub(/\+/, " ", GETARG["YouSay"])
+ # Here we also have to substitute coded special characters
+ Document = "<form method=GET>" \
+ "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\
+ <p><input type=text name=YouSay value=\"\" size=60>\
+ <br><input type=submit value=\"Tell her about it\"></p></form>"
+ @}
+@}
+@c endfile
+@end smallexample
+
+Now we are down to the heart of ELIZA, so you can see how it works.
+Initially the user does not say anything; then ELIZA resets its money
+counter and asks the user to tell what comes to mind open heartedly.
+The subsequent answers are converted to uppercase and stored for
+later comparison. ELIZA presents the bill when being confronted with
+a sentence that contains the phrase ``shut up.'' Otherwise, it looks for
+keywords in the sentence, conjugates the rest of the sentence, remembers
+the keyword for later use, and finally selects an answer from the set of
+possible answers:
+
+@smallexample
+@c file eg/network/eliza.awk
+function ElizaSays(YouSay) @{
+ if (YouSay == "") @{
+ cost = 0
+ answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
+ @} else @{
+ q = toupper(YouSay)
+ gsub("'", "", q)
+ if(q == qold) @{
+ answer = "PLEASE DONT REPEAT YOURSELF !"
+ @} else @{
+ if (index(q, "SHUT UP") > 0) @{
+ answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
+ int(100*rand()+30+cost/100)
+ @} else @{
+ qold = q
+ w = "-" # no keyword recognized yet
+ for (i in k) @{ # search for keywords
+ if (index(q, i) > 0) @{
+ w = i
+ break
+ @}
+ @}
+ if (w == "-") @{ # no keyword, take old subject
+ w = wold
+ subj = subjold
+ @} else @{ # find subject
+ subj = substr(q, index(q, w) + length(w)+1)
+ wold = w
+ subjold = subj # remember keyword and subject
+ @}
+ for (i in conj)
+ gsub(i, conj[i], q) # conjugation
+ # from all answers to this keyword, select one randomly
+ answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
+ # insert subject into answer
+ gsub("_", subj, answer)
+ @}
+ @}
+ @}
+ cost += length(answer) # for later payment : 1 cent per character
+ return answer
+@}
+@c endfile
+@end smallexample
+
+In the long but simple function @code{SetUpEliza}, you can see tables
+for conjugation, keywords, and answers.@footnote{The version shown
+here is abbreviated. The full version comes with the @command{gawk}
+distribution.} The associative array @code{k}
+contains indices into the array of answers @code{r}. To choose an
+answer, ELIZA just picks an index randomly:
+
+@example
+@c file eg/network/eliza.awk
+function SetUpEliza() @{
+ srand()
+ wold = "-"
+ subjold = " "
+
+ # table for conjugation
+ conj[" ARE " ] = " AM "
+ conj["WERE " ] = "WAS "
+ conj[" YOU " ] = " I "
+ conj["YOUR " ] = "MY "
+ conj[" IVE " ] =\
+ conj[" I HAVE " ] = " YOU HAVE "
+ conj[" YOUVE " ] =\
+ conj[" YOU HAVE "] = " I HAVE "
+ conj[" IM " ] =\
+ conj[" I AM " ] = " YOU ARE "
+ conj[" YOURE " ] =\
+ conj[" YOU ARE " ] = " I AM "
+
+ # table of all answers
+ r[1] = "DONT YOU BELIEVE THAT I CAN _"
+ r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
+@c endfile
+ @dots{}
+@end example
+@ignore
+@c file eg/network/eliza.awk
+ r[3] = "YOU WANT ME TO BE ABLE TO _ ?"
+ r[4] = "PERHAPS YOU DONT WANT TO _ "
+ r[5] = "DO YOU WANT TO BE ABLE TO _ ?"
+ r[6] = "WHAT MAKES YOU THINK I AM _ ?"
+ r[7] = "DOES IT PLEASE YOU TO BELIEVE I AM _ ?"
+ r[8] = "PERHAPS YOU WOULD LIKE TO BE _ ?"
+ r[9] = "DO YOU SOMETIMES WISH YOU WERE _ ?"
+ r[10] = "DONT YOU REALLY _ ?"
+ r[11] = "WHY DONT YOU _ ?"
+ r[12] = "DO YOU WISH TO BE ABLE TO _ ?"
+ r[13] = "DOES THAT TROUBLE YOU ?"
+ r[14] = "TELL ME MORE ABOUT SUCH FEELINGS"
+ r[15] = "DO YOU OFTEN FEEL _ ?"
+ r[16] = "DO YOU ENJOY FEELING _ ?"
+ r[17] = "DO YOU REALLY BELIEVE I DONT _ ?"
+ r[18] = "PERHAPS IN GOOD TIME I WILL _ "
+ r[19] = "DO YOU WANT ME TO _ ?"
+ r[20] = "DO YOU THINK YOU SHOULD BE ABLE TO _ ?"
+ r[21] = "WHY CANT YOU _ ?"
+ r[22] = "WHY ARE YOU INTERESTED IN WHETHER OR NOT I AM _ ?"
+ r[23] = "WOULD YOU PREFER IF I WERE NOT _ ?"
+ r[24] = "PERHAPS IN YOUR FANTASIES I AM _ "
+ r[25] = "HOW DO YOU KNOW YOU CANT _ ?"
+ r[26] = "HAVE YOU TRIED ?"
+ r[27] = "PERHAPS YOU CAN NOW _ "
+ r[28] = "DID YOU COME TO ME BECAUSE YOU ARE _ ?"
+ r[29] = "HOW LONG HAVE YOU BEEN _ ?"
+ r[30] = "DO YOU BELIEVE ITS NORMAL TO BE _ ?"
+ r[31] = "DO YOU ENJOY BEING _ ?"
+ r[32] = "WE WERE DISCUSSING YOU -- NOT ME"
+ r[33] = "Oh, I _"
+ r[34] = "YOU'RE NOT REALLY TALKING ABOUT ME, ARE YOU ?"
+ r[35] = "WHAT WOULD IT MEAN TO YOU, IF YOU GOT _ ?"
+ r[36] = "WHY DO YOU WANT _ ?"
+ r[37] = "SUPPOSE YOU SOON GOT _"
+ r[38] = "WHAT IF YOU NEVER GOT _ ?"
+ r[39] = "I SOMETIMES ALSO WANT _"
+ r[40] = "WHY DO YOU ASK ?"
+ r[41] = "DOES THAT QUESTION INTEREST YOU ?"
+ r[42] = "WHAT ANSWER WOULD PLEASE YOU THE MOST ?"
+ r[43] = "WHAT DO YOU THINK ?"
+ r[44] = "ARE SUCH QUESTIONS IN YOUR MIND OFTEN ?"
+ r[45] = "WHAT IS IT THAT YOU REALLY WANT TO KNOW ?"
+ r[46] = "HAVE YOU ASKED ANYONE ELSE ?"
+ r[47] = "HAVE YOU ASKED SUCH QUESTIONS BEFORE ?"
+ r[48] = "WHAT ELSE COMES TO MIND WHEN YOU ASK THAT ?"
+ r[49] = "NAMES DON'T INTEREST ME"
+ r[50] = "I DONT CARE ABOUT NAMES -- PLEASE GO ON"
+ r[51] = "IS THAT THE REAL REASON ?"
+ r[52] = "DONT ANY OTHER REASONS COME TO MIND ?"
+ r[53] = "DOES THAT REASON EXPLAIN ANYTHING ELSE ?"
+ r[54] = "WHAT OTHER REASONS MIGHT THERE BE ?"
+ r[55] = "PLEASE DON'T APOLOGIZE !"
+ r[56] = "APOLOGIES ARE NOT NECESSARY"
+ r[57] = "WHAT FEELINGS DO YOU HAVE WHEN YOU APOLOGIZE ?"
+ r[58] = "DON'T BE SO DEFENSIVE"
+ r[59] = "WHAT DOES THAT DREAM SUGGEST TO YOU ?"
+ r[60] = "DO YOU DREAM OFTEN ?"
+ r[61] = "WHAT PERSONS APPEAR IN YOUR DREAMS ?"
+ r[62] = "ARE YOU DISTURBED BY YOUR DREAMS ?"
+ r[63] = "HOW DO YOU DO ... PLEASE STATE YOUR PROBLEM"
+ r[64] = "YOU DON'T SEEM QUITE CERTAIN"
+ r[65] = "WHY THE UNCERTAIN TONE ?"
+ r[66] = "CAN'T YOU BE MORE POSITIVE ?"
+ r[67] = "YOU AREN'T SURE ?"
+ r[68] = "DON'T YOU KNOW ?"
+ r[69] = "WHY NO _ ?"
+ r[70] = "DON'T SAY NO, IT'S ALWAYS SO NEGATIVE"
+ r[71] = "WHY NOT ?"
+ r[72] = "ARE YOU SURE ?"
+ r[73] = "WHY NO ?"
+ r[74] = "WHY ARE YOU CONCERNED ABOUT MY _ ?"
+ r[75] = "WHAT ABOUT YOUR OWN _ ?"
+ r[76] = "CAN'T YOU THINK ABOUT A SPECIFIC EXAMPLE ?"
+ r[77] = "WHEN ?"
+ r[78] = "WHAT ARE YOU THINKING OF ?"
+ r[79] = "REALLY, ALWAYS ?"
+ r[80] = "DO YOU REALLY THINK SO ?"
+ r[81] = "BUT YOU ARE NOT SURE YOU _ "
+ r[82] = "DO YOU DOUBT YOU _ ?"
+ r[83] = "IN WHAT WAY ?"
+ r[84] = "WHAT RESEMBLANCE DO YOU SEE ?"
+ r[85] = "WHAT DOES THE SIMILARITY SUGGEST TO YOU ?"
+ r[86] = "WHAT OTHER CONNECTION DO YOU SEE ?"
+ r[87] = "COULD THERE REALLY BE SOME CONNECTIONS ?"
+ r[88] = "HOW ?"
+ r[89] = "YOU SEEM QUITE POSITIVE"
+ r[90] = "ARE YOU SURE ?"
+ r[91] = "I SEE"
+ r[92] = "I UNDERSTAND"
+ r[93] = "WHY DO YOU BRING UP THE TOPIC OF FRIENDS ?"
+ r[94] = "DO YOUR FRIENDS WORRY YOU ?"
+ r[95] = "DO YOUR FRIENDS PICK ON YOU ?"
+ r[96] = "ARE YOU SURE YOU HAVE ANY FRIENDS ?"
+ r[97] = "DO YOU IMPOSE ON YOUR FRIENDS ?"
+ r[98] = "PERHAPS YOUR LOVE FOR FRIENDS WORRIES YOU"
+ r[99] = "DO COMPUTERS WORRY YOU ?"
+ r[100] = "ARE YOU TALKING ABOUT ME IN PARTICULAR ?"
+ r[101] = "ARE YOU FRIGHTENED BY MACHINES ?"
+ r[102] = "WHY DO YOU MENTION COMPUTERS ?"
+ r[103] = "WHAT DO YOU THINK MACHINES HAVE TO DO WITH YOUR PROBLEMS ?"
+ r[104] = "DON'T YOU THINK COMPUTERS CAN HELP PEOPLE ?"
+ r[105] = "WHAT IS IT ABOUT MACHINES THAT WORRIES YOU ?"
+ r[106] = "SAY, DO YOU HAVE ANY PSYCHOLOGICAL PROBLEMS ?"
+ r[107] = "WHAT DOES THAT SUGGEST TO YOU ?"
+ r[108] = "I SEE"
+ r[109] = "IM NOT SURE I UNDERSTAND YOU FULLY"
+ r[110] = "COME COME ELUCIDATE YOUR THOUGHTS"
+ r[111] = "CAN YOU ELABORATE ON THAT ?"
+ r[112] = "THAT IS QUITE INTERESTING"
+ r[113] = "WHY DO YOU HAVE PROBLEMS WITH MONEY ?"
+ r[114] = "DO YOU THINK MONEY IS EVERYTHING ?"
+ r[115] = "ARE YOU SURE THAT MONEY IS THE PROBLEM ?"
+ r[116] = "I THINK WE WANT TO TALK ABOUT YOU, NOT ABOUT ME"
+ r[117] = "WHAT'S ABOUT ME ?"
+ r[118] = "WHY DO YOU ALWAYS BRING UP MY NAME ?"
+@c endfile
+@end ignore
+
+@example
+@c file eg/network/eliza.awk
+ # table for looking up answers that
+ # fit to a certain keyword
+ k["CAN YOU"] = "1 2 3"
+ k["CAN I"] = "4 5"
+ k["YOU ARE"] =\
+ k["YOURE"] = "6 7 8 9"
+@c endfile
+ @dots{}
+@end example
+@ignore
+@c file eg/network/eliza.awk
+ k["I DONT"] = "10 11 12 13"
+ k["I FEEL"] = "14 15 16"
+ k["WHY DONT YOU"] = "17 18 19"
+ k["WHY CANT I"] = "20 21"
+ k["ARE YOU"] = "22 23 24"
+ k["I CANT"] = "25 26 27"
+ k["I AM"] =\
+ k["IM "] = "28 29 30 31"
+ k["YOU "] = "32 33 34"
+ k["I WANT"] = "35 36 37 38 39"
+ k["WHAT"] =\
+ k["HOW"] =\
+ k["WHO"] =\
+ k["WHERE"] =\
+ k["WHEN"] =\
+ k["WHY"] = "40 41 42 43 44 45 46 47 48"
+ k["NAME"] = "49 50"
+ k["CAUSE"] = "51 52 53 54"
+ k["SORRY"] = "55 56 57 58"
+ k["DREAM"] = "59 60 61 62"
+ k["HELLO"] =\
+ k["HI "] = "63"
+ k["MAYBE"] = "64 65 66 67 68"
+ k[" NO "] = "69 70 71 72 73"
+ k["YOUR"] = "74 75"
+ k["ALWAYS"] = "76 77 78 79"
+ k["THINK"] = "80 81 82"
+ k["LIKE"] = "83 84 85 86 87 88 89"
+ k["YES"] = "90 91 92"
+ k["FRIEND"] = "93 94 95 96 97 98"
+ k["COMPUTER"] = "99 100 101 102 103 104 105"
+ k["-"] = "106 107 108 109 110 111 112"
+ k["MONEY"] = "113 114 115"
+ k["ELIZA"] = "116 117 118"
+@c endfile
+@end ignore
+@example
+@c file eg/network/eliza.awk
+@}
+@c endfile
+@end example
+
+@cindex Humphrys, Mark
+@cindex ELIZA program
+@cindex Yahoo!
+Some interesting remarks and details (including the original source code
+of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has a
+page with a collection of ELIZA-like programs. Many of them are written
+in Java, some of them disclosing the Java source code, and a few even
+explain how to modify the Java source code.
+
+@node Caveats, Challenges, Simple Server, Using Networking
+@section Network Programming Caveats
+
+By now it should be clear
+that debugging a networked application is more
+complicated than debugging a single-process single-hosted application.
+The behavior of a networked application sometimes looks non-causal because
+it is not reproducible in a strong sense. Whether a network application
+works or not sometimes depends on the following:
+
+@itemize @bullet
+@item
+How crowded the underlying network is.
+
+@item
+If the party at the other end is running or not.
+
+@item
+The state of the party at the other end.
+@end itemize
+
+@cindex network
+The most difficult problems for a beginner arise from the hidden states of the
+underlying network. After closing a TCP connection, it's often necessary to wait
+a short while before reopening the connection. Even more difficult is the
+establishment of a connection that previously ended with a ``broken pipe.''
+Those connections have to ``time out'' for a minute or so
+before they can reopen.
+Check this with the command @samp{netstat -a}, which
+provides a list of still ``active'' connections.
+
+@node Challenges, , Caveats, Using Networking
+@section Where To Go From Here
+
+@cindex Loebner, Hugh
+@cindex Contest
+Now, you have learned enough to build your own application. You could,
+for example, take part in the
+Loebner Contest
+to win $100,000. The Loebner Prize is the first formal instantiation of
+a Turing Test. Hugh Loebner agreed with The Cambridge Center for Behavioral
+Studies to underwrite a contest designed to implement the Turing Test.
+Dr.@: Loebner pledged a Grand Prize of $100,000 for the first computer whose
+responses were indistinguishable from a human's. Each year an annual prize
+of $2000 and a bronze medal is awarded to the @emph{most} human computer.
+The winner of the annual contest is the best entry relative to other entries
+that year, irrespective of how good it is in an absolute sense. Here is
+an example of a conversation with the winning program of 1997:
+
+@smallexample
+(c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
+[Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
+PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
+JUDGE02[10:39:36]My name is Nathan.
+PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
+PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
+PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
+JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
+PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
+PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
+PROGRAM[10:41:21]embarrassed?
+JUDGE02[10:41:37]You tell me. I didn't see it.
+PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
+JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
+PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
+PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
+PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
+JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
+PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
+PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
+PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
+PROGRAM[10:44:01]dramatic actually happen?
+JUDGE02[10:44:19]Do you know what sculpture is?
+PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
+PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
+PROGRAM[10:44:51]must say.
+JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
+PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
+PROGRAM[10:45:43]off this one I think and onto something more down to earth!
+JUDGE02[10:46:20]What is more down to earth than art?
+PROGRAM[10:46:21]I don't know what -- to be honest. -
+PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
+PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
+PROGRAM[10:47:03]man? "
+JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
+JUDGE02[10:48:10]from another play the name of which I cannot remember.
+PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
+JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
+PROGRAM[10:49:02]Do you think of yourself as being attractive?
+@end smallexample
+
+@cindex Clinton, Bill
+This program insists on always speaking about the same story around Bill
+Clinton. You see, even a program with a rather narrow mind can behave so
+much like a human being that it can win this prize. It is quite common to
+let these programs talk to each other via network connections. But during the
+competition itself, the program and its computer have to be present at the
+place the competition is held. We all would love to see a @command{gawk}
+program win in such an event. Maybe it is up to you to accomplish this?
+
+Some other ideas for useful networked applications:
+@itemize @bullet
+@item
+Read the file @file{doc/awkforai.txt} in the @command{gawk} distribution.
+It was written by Ronald P.@: Loui (Associate Professor of
+Computer Science, at Washington University in St. Louis,
+@email{loui@@ai.wustl.edu}) and summarizes why
+he teaches @command{gawk} to students of Artificial Intelligence. Here are
+some passages from the text:
+
+@cindex AI
+@cindex PROLOG
+@cindex Loui, Ronald P.
+@cindex agent
+@quotation
+The GAWK manual can
+be consumed in a single lab session and the language can be mastered by
+the next morning by the average student. GAWK's automatic
+initialization, implicit coercion, I/O support and lack of pointers
+forgive many of the mistakes that young programmers are likely to make.
+Those who have seen C but not mastered it are happy to see that GAWK
+retains some of the same sensibilities while adding what must be
+regarded as spoonsful of syntactic sugar.@*
+@dots{}@*
+@cindex robot
+There are further simple answers. Probably the best is the fact that
+increasingly, undergraduate AI programming is involving the Web. Oren
+Etzioni (University of Washington, Seattle) has for a while been arguing
+that the ``softbot'' is replacing the mechanical engineers' robot as the
+most glamorous AI testbed. If the artifact whose behavior needs to be
+controlled in an intelligent way is the software agent, then a language
+that is well-suited to controlling the software environment is the
+appropriate language. That would imply a scripting language. If the
+robot is KAREL, then the right language is ``turn left; turn right.'' If
+the robot is Netscape, then the right language is something that can
+generate @samp{netscape -remote 'openURL(http://cs.wustl.edu/~loui)'} with
+elan.@*
+@dots{}@*
+AI programming requires high-level thinking. There have always been a few
+gifted programmers who can write high-level programs in assembly language.
+Most however need the ambient abstraction to have a higher floor.@*
+@dots{}@*
+Second, inference is merely the expansion of notation. No matter whether
+the logic that underlies an AI program is fuzzy, probabilistic, deontic,
+defeasible, or deductive, the logic merely defines how strings can be
+transformed into other strings. A language that provides the best
+support for string processing in the end provides the best support for
+logic, for the exploration of various logics, and for most forms of
+symbolic processing that AI might choose to call ``reasoning'' instead of
+``logic.'' The implication is that PROLOG, which saves the AI programmer
+from having to write a unifier, saves perhaps two dozen lines of GAWK
+code at the expense of strongly biasing the logic and representational
+expressiveness of any approach.
+@end quotation
+
+Now that @command{gawk} itself can connect to the Internet, it should be obvious
+that it is suitable for writing intelligent web agents.
+
+@item
+@command{awk} is strong at pattern recognition and string processing.
+So, it is well suited to the classic problem of language translation.
+A first try could be a program that knows the 100 most frequent English
+words and their counterparts in German or French. The service could be
+implemented by regularly reading email with the program above, replacing
+each word by its translation and sending the translation back via SMTP.
+Users would send English email to their translation service and get
+back a translated email message in return. As soon as this works,
+more effort can be spent on a real translation program.
+
+@item
+Another dialogue-oriented application (on the verge
+of ridicule) is the email ``support service.'' Troubled customers write an
+email to an automatic @command{gawk} service that reads the email. It looks
+for keywords in the mail and assembles a reply email accordingly. By carefully
+investigating the email header, and repeating these keywords through the
+reply email, it is rather simple to give the customer a feeling that
+someone cares. Ideally, such a service would search a database of previous
+cases for solutions. If none exists, the database could, for example, consist
+of all the newsgroups, mailing lists and FAQs on the Internet.
+@end itemize
+
+@node Some Applications and Techniques, Links, Using Networking, Top
+@comment node-name, next, previous, up
+
+@chapter Some Applications and Techniques
+In this @value{CHAPTER}, we look at a number of self-contained
+scripts, with an emphasis on concise networking. Along the way, we
+work towards creating building blocks that encapsulate often needed
+functions of the networking world, show new techniques that
+broaden the scope of problems that can be solved with @command{gawk}, and
+explore leading edge technology that may shape the future of networking.
+
+We often refer to the site-independent core of the server that
+we built in
+@ref{Simple Server, ,A Simple Web Server}.
+When building new and non-trivial servers, we
+always copy this building block and append new instances of the two
+functions @code{SetUpServer} and @code{HandleGET}.
+
+This makes a lot of sense, since
+this scheme of event-driven
+execution provides @command{gawk} with an interface to the most widely
+accepted standard for GUIs: the web browser. Now, @command{gawk} can even rival
+Tcl/Tk.
+
+@cindex Tcl/Tk
+@cindex JavaScript
+Tcl and @command{gawk} have much in common. Both are simple scripting languages
+that allow us to quickly solve problems with short programs. But Tcl has Tk
+on top of it and @command{gawk} had nothing comparable up to now. While Tcl
+needs a large and ever changing library (Tk, which was bound to the X Window
+System until recently), @command{gawk} needs just the networking interface
+and some kind of browser on the client's side. Besides better portability,
+the most important advantage of this approach (embracing well-established
+standards such HTTP and HTML) is that @emph{we do not need to change the
+language}. We let others do the work of fighting over protocols and standards.
+We can use HTML, JavaScript, VRML, or whatever else comes along to do our work.
+
+@menu
+* PANIC:: An Emergency Web Server.
+* GETURL:: Retrieving Web Pages.
+* REMCONF:: Remote Configuration Of Embedded Systems.
+* URLCHK:: Look For Changed Web Pages.
+* WEBGRAB:: Extract Links From A Page.
+* STATIST:: Graphing A Statistical Distribution.
+* MAZE:: Walking Through A Maze In Virtual Reality.
+* MOBAGWHO:: A Simple Mobile Agent.
+* STOXPRED:: Stock Market Prediction As A Service.
+* PROTBASE:: Searching Through A Protein Database.
+@end menu
+
+@node PANIC, GETURL, Some Applications and Techniques, Some Applications and Techniques
+@section PANIC: an Emergency Web Server
+@cindex PANIC program
+At first glance, the @code{"Hello, world"} example in
+@ref{Primitive Service, ,A Primitive Web Service},
+seems useless. By adding just a few lines, we can turn it into something useful.
+
+The PANIC program tells everyone who connects that the local
+site is not working. When a web server breaks down, it makes a difference
+if customers get a strange ``network unreachable'' message, or a short message
+telling them that the server has a problem. In such an emergency,
+the hard disk and everything on it (including the regular web service) may
+be unavailable. Rebooting the web server off a diskette makes sense in this
+setting.
+
+To use the PANIC program as an emergency web server, all you need are the
+@command{gawk} executable and the program below on a diskette. By default,
+it connects to port 8080. A different value may be supplied on the
+command line:
+
+@example
+@c file eg/network/panic.awk
+BEGIN @{
+ RS = ORS = "\r\n"
+ if (MyPort == 0) MyPort = 8080
+ HttpService = "/inet/tcp/" MyPort "/0/0"
+ Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \
+ "</HEAD><BODY><H1>" \
+ "This site is temporarily out of service." \
+ "</H1></BODY></HTML>"
+ Len = length(Hello) + length(ORS)
+ while ("awk" != "complex") @{
+ print "HTTP/1.0 200 OK" |& HttpService
+ print "Content-Length: " Len ORS |& HttpService
+ print Hello |& HttpService
+ while ((HttpService |& getline) > 0)
+ continue;
+ close(HttpService)
+ @}
+@}
+@c endfile
+@end example
+
+@node GETURL, REMCONF, PANIC, Some Applications and Techniques
+@section GETURL: Retrieving Web Pages
+@cindex GETURL program
+@cindex robot
+GETURL is a versatile building block for shell scripts that need to retrieve
+files from the Internet. It takes a web address as a command-line parameter and
+tries to retrieve the contents of this address. The contents are printed
+to standard output, while the header is printed to @file{/dev/stderr}.
+A surrounding shell script
+could analyze the contents and extract the text or the links. An ASCII
+browser could be written around GETURL. But more interestingly, web robots are
+straightforward to write on top of GETURL. On the Internet, you can find
+several programs of the same name that do the same job. They are usually
+much more complex internally and at least 10 times longer.
+
+At first, GETURL checks if it was called with exactly one web address.
+Then, it checks if the user chose to use a special proxy server whose name
+is handed over in a variable. By default, it is assumed that the local
+machine serves as proxy. GETURL uses the @code{GET} method by default
+to access the web page. By handing over the name of a different method
+(such as @code{HEAD}), it is possible to choose a different behavior. With
+the @code{HEAD} method, the user does not receive the body of the page
+content, but does receive the header:
+
+@example
+@c file eg/network/geturl.awk
+BEGIN @{
+ if (ARGC != 2) @{
+ print "GETURL - retrieve Web page via HTTP 1.0"
+ print "IN:\n the URL as a command-line parameter"
+ print "PARAM(S):\n -v Proxy=MyProxy"
+ print "OUT:\n the page content on stdout"
+ print " the page header on stderr"
+ print "JK 16.05.1997"
+ print "ADR 13.08.2000"
+ exit
+ @}
+ URL = ARGV[1]; ARGV[1] = ""
+ if (Proxy == "") Proxy = "127.0.0.1"
+ if (ProxyPort == 0) ProxyPort = 80
+ if (Method == "") Method = "GET"
+ HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
+ ORS = RS = "\r\n\r\n"
+ print Method " " URL " HTTP/1.0" |& HttpService
+ HttpService |& getline Header
+ print Header > "/dev/stderr"
+ while ((HttpService |& getline) > 0)
+ printf "%s", $0
+ close(HttpService)
+@}
+@c endfile
+@end example
+
+This program can be changed as needed, but be careful with the last lines.
+Make sure transmission of binary data is not corrupted by additional line
+breaks. Even as it is now, the byte sequence @code{"\r\n\r\n"} would
+disappear if it were contained in binary data. Don't get caught in a
+trap when trying a quick fix on this one.
+
+@node REMCONF, URLCHK, GETURL, Some Applications and Techniques
+@section REMCONF: Remote Configuration of Embedded Systems
+@cindex REMCONF program
+@cindex Linux
+@cindex GNU/Linux
+@cindex Yahoo!
+Today, you often find powerful processors in embedded systems. Dedicated
+network routers and controllers for all kinds of machinery are examples
+of embedded systems. Processors like the Intel 80x86 or the AMD Elan are
+able to run multitasking operating systems, such as XINU or GNU/Linux
+in embedded PCs. These systems are small and usually do not have
+a keyboard or a display. Therefore it is difficult to set up their
+configuration. There are several widespread ways to set them up:
+
+@itemize @bullet
+@item
+DIP switches
+
+@item
+Read Only Memories such as EPROMs
+
+@item
+Serial lines or some kind of keyboard
+
+@item
+Network connections via @command{telnet} or SNMP
+
+@item
+HTTP connections with HTML GUIs
+@end itemize
+
+In this @value{SECTION}, we look at a solution that uses HTTP connections
+to control variables of an embedded system that are stored in a file.
+Since embedded systems have tight limits on resources like memory,
+it is difficult to employ advanced techniques such as SNMP and HTTP
+servers. @command{gawk} fits in quite nicely with its single executable
+which needs just a short script to start working.
+The following program stores the variables in a file, and a concurrent
+process in the embedded system may read the file. The program uses the
+site-independent part of the simple web server that we developed in
+@ref{Interacting Service, ,A Web Service with Interaction}.
+As mentioned there, all we have to do is to write two new procedures
+@code{SetUpServer} and @code{HandleGET}:
+
+@smallexample
+@c file eg/network/remconf.awk
+function SetUpServer() @{
+ TopHeader = "<HTML><title>Remote Configuration</title>"
+ TopDoc = "<BODY>\
+ <h2>Please choose one of the following actions:</h2>\
+ <UL>\
+ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
+ <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\
+ <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\
+ <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\
+ <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\
+ </UL>"
+ TopFooter = "</BODY></HTML>"
+ if (ConfigFile == "") ConfigFile = "config.asc"
+@}
+@c endfile
+@end smallexample
+
+The function @code{SetUpServer} initializes the top level HTML texts
+as usual. It also initializes the name of the file that contains the
+configuration parameters and their values. In case the user supplies
+a name from the command line, that name is used. The file is expected to
+contain one parameter per line, with the name of the parameter in
+column one and the value in column two.
+
+The function @code{HandleGET} reflects the structure of the menu
+tree as usual. The first menu choice tells the user what this is all
+about. The second choice reads the configuration file line by line
+and stores the parameters and their values. Notice that the record
+separator for this file is @code{"\n"}, in contrast to the record separator
+for HTTP. The third menu choice builds an HTML table to show
+the contents of the configuration file just read. The fourth choice
+does the real work of changing parameters, and the last one just saves
+the configuration into a file:
+
+@smallexample
+@c file eg/network/remconf.awk
+function HandleGET() @{
+ if(MENU[2] == "AboutServer") @{
+ Document = "This is a GUI for remote configuration of an\
+ embedded system. It is is implemented as one GAWK script."
+ @} else if (MENU[2] == "ReadConfig") @{
+ RS = "\n"
+ while ((getline < ConfigFile) > 0)
+ config[$1] = $2;
+ close(ConfigFile)
+ RS = "\r\n"
+ Document = "Configuration has been read."
+ @} else if (MENU[2] == "CheckConfig") @{
+ Document = "<TABLE BORDER=1 CELLPADDING=5>"
+ for (i in config)
+ Document = Document "<TR><TD>" i "</TD>" \
+ "<TD>" config[i] "</TD></TR>"
+ Document = Document "</TABLE>"
+ @} else if (MENU[2] == "ChangeConfig") @{
+ if ("Param" in GETARG) @{ # any parameter to set?
+ if (GETARG["Param"] in config) @{ # is parameter valid?
+ config[GETARG["Param"]] = GETARG["Value"]
+ Document = (GETARG["Param"] " = " GETARG["Value"] ".")
+ @} else @{
+ Document = "Parameter <b>" GETARG["Param"] "</b> is invalid."
+ @}
+ @} else @{
+ Document = "<FORM method=GET><h4>Change one parameter</h4>\
+ <TABLE BORDER CELLPADDING=5>\
+ <TR><TD>Parameter</TD><TD>Value</TD></TR>\
+ <TR><TD><input type=text name=Param value=\"\" size=20></TD>\
+ <TD><input type=text name=Value value=\"\" size=40></TD>\
+ </TR></TABLE><input type=submit value=\"Set\"></FORM>"
+ @}
+ @} else if (MENU[2] == "SaveConfig") @{
+ for (i in config)
+ printf("%s %s\n", i, config[i]) > ConfigFile
+ close(ConfigFile)
+ Document = "Configuration has been saved."
+ @}
+@}
+@c endfile
+@end smallexample
+
+@cindex MiniSQL
+We could also view the configuration file as a database. From this
+point of view, the previous program acts like a primitive database server.
+Real SQL database systems also make a service available by providing
+a TCP port that clients can connect to. But the application level protocols
+they use are usually proprietary and also change from time to time.
+This is also true for the protocol that
+MiniSQL uses.
+
+@node URLCHK, WEBGRAB, REMCONF, Some Applications and Techniques
+@section URLCHK: Look for Changed Web Pages
+@cindex URLCHK program
+Most people who make heavy use of Internet resources have a large
+bookmark file with pointers to interesting web sites. It is impossible
+to regularly check by hand if any of these sites have changed. A program
+is needed to automatically look at the headers of web pages and tell
+which ones have changed. URLCHK does the comparison after using GETURL
+with the @code{HEAD} method to retrieve the header.
+
+Like GETURL, this program first checks that it is called with exactly
+one command-line parameter. URLCHK also takes the same command-line variables
+@code{Proxy} and @code{ProxyPort} as GETURL,
+because these variables are handed over to GETURL for each URL
+that gets checked. The one and only parameter is the name of a file that
+contains one line for each URL. In the first column, we find the URL, and
+the second and third columns hold the length of the URL's body when checked
+for the two last times. Now, we follow this plan:
+
+@enumerate
+@item
+Read the URLs from the file and remember their most recent lengths
+
+@item
+Delete the contents of the file
+
+@item
+For each URL, check its new length and write it into the file
+
+@item
+If the most recent and the new length differ, tell the user
+@end enumerate
+
+It may seem a bit peculiar to read the URLs from a file together
+with their two most recent lengths, but this approach has several
+advantages. You can call the program again and again with the same
+file. After running the program, you can regenerate the changed URLs
+by extracting those lines that differ in their second and third columns:
+
+@c inspired by URLCHK in iX 5/97 166.
+@smallexample
+@c file eg/network/urlchk.awk
+BEGIN @{
+ if (ARGC != 2) @{
+ print "URLCHK - check if URLs have changed"
+ print "IN:\n the file with URLs as a command-line parameter"
+ print " file contains URL, old length, new length"
+ print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
+ print "OUT:\n same as file with URLs"
+ print "JK 02.03.1998"
+ exit
+ @}
+ URLfile = ARGV[1]; ARGV[1] = ""
+ if (Proxy != "") Proxy = " -v Proxy=" Proxy
+ if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
+ while ((getline < URLfile) > 0)
+ Length[$1] = $3 + 0
+ close(URLfile) # now, URLfile is read in and can be updated
+ GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
+ for (i in Length) @{
+ GetThisHeader = GetHeader i " 2>&1"
+ while ((GetThisHeader | getline) > 0)
+ if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
+ close(GetThisHeader)
+ print i, Length[i], NewLength > URLfile
+ if (Length[i] != NewLength) # report only changed URLs
+ print i, Length[i], NewLength
+ @}
+ close(URLfile)
+@}
+@c endfile
+@end smallexample
+
+Another thing that may look strange is the way GETURL is called.
+Before calling GETURL, we have to check if the proxy variables need
+to be passed on. If so, we prepare strings that will become part
+of the command line later. In @code{GetHeader}, we store these strings
+together with the longest part of the command line. Later, in the loop
+over the URLs, @code{GetHeader} is appended with the URL and a redirection
+operator to form the command that reads the URL's header over the Internet.
+GETURL always produces the headers over @file{/dev/stderr}. That is
+the reason why we need the redirection operator to have the header
+piped in.
+
+This program is not perfect because it assumes that changing URLs
+results in changed lengths, which is not necessarily true. A more
+advanced approach is to look at some other header line that
+holds time information. But, as always when things get a bit more
+complicated, this is left as an exercise to the reader.
+
+@node WEBGRAB, STATIST, URLCHK, Some Applications and Techniques
+@section WEBGRAB: Extract Links from a Page
+@cindex WEBGRAB program
+@c Inspired by iX 1/98 157.
+@cindex robot
+Sometimes it is necessary to extract links from web pages.
+Browsers do it, web robots do it, and sometimes even humans do it.
+Since we have a tool like GETURL at hand, we can solve this problem with
+some help from the Bourne shell:
+
+@example
+@c file eg/network/webgrab.awk
+BEGIN @{ RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" @}
+RT != "" @{
+ command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
+ " > doc" NR ".html")
+ print command
+@}
+@c endfile
+@end example
+
+Notice that the regular expression for URLs is rather crude. A precise
+regular expression is much more complex. But this one works
+rather well. One problem is that it is unable to find internal links of
+an HTML document. Another problem is that
+@samp{ftp}, @samp{telnet}, @samp{news}, @samp{mailto}, and other kinds
+of links are missing in the regular expression.
+However, it is straightforward to add them, if doing so is necessary for other tasks.
+
+This program reads an HTML file and prints all the HTTP links that it finds.
+It relies on @command{gawk}'s ability to use regular expressions as record
+separators. With @code{RS} set to a regular expression that matches links,
+the second action is executed each time a non-empty link is found.
+We can find the matching link itself in @code{RT}.
+
+The action could use the @code{system} function to let another GETURL
+retrieve the page, but here we use a different approach.
+This simple program prints shell commands that can be piped into @command{sh}
+for execution. This way it is possible to first extract
+the links, wrap shell commands around them, and pipe all the shell commands
+into a file. After editing the file, execution of the file retrieves
+exactly those files that we really need. In case we do not want to edit,
+we can retrieve all the pages like this:
+
+@smallexample
+gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
+@end smallexample
+
+@cindex Microsoft Windows
+After this, you will find the contents of all referenced documents in
+files named @file{doc*.html} even if they do not contain HTML code.
+The most annoying thing is that we always have to pass the proxy to
+GETURL. If you do not like to see the headers of the web pages
+appear on the screen, you can redirect them to @file{/dev/null}.
+Watching the headers appear can be quite interesting, because
+it reveals
+interesting details such as which web server the companies use.
+Now, it is clear how the clever marketing people
+use web robots to determine the
+market shares
+of Microsoft and Netscape in the web server market.
+
+Port 80 of any web server is like a small hole in a repellent firewall.
+After attaching a browser to port 80, we usually catch a glimpse
+of the bright side of the server (its home page). With a tool like GETURL
+at hand, we are able to discover some of the more concealed
+or even ``indecent'' services (i.e., lacking conformity to standards of quality).
+It can be exciting to see the fancy CGI scripts that lie
+there, revealing the inner workings of the server, ready to be called:
+
+@itemize @bullet
+@item
+With a command such as:
+
+@example
+gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
+@end example
+
+some servers give you a directory listing of the CGI files.
+Knowing the names, you can try to call some of them and watch
+for useful results. Sometimes there are executables in such directories
+(such as Perl interpreters) that you may call remotely. If there are
+subdirectories with configuration data of the web server, this can also
+be quite interesting to read.
+
+@item
+@cindex apache
+The well-known Apache web server usually has its CGI files in the
+directory @file{/cgi-bin}. There you can often find the scripts
+@file{test-cgi} and @file{printenv}. Both tell you some things
+about the current connection and the installation of the web server.
+Just call:
+
+@smallexample
+gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
+gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
+@end smallexample
+
+@item
+Sometimes it is even possible to retrieve system files like the web
+server's log file---possibly containing customer data---or even the file
+@file{/etc/passwd}.
+(We don't recommend this!)
+@end itemize
+
+@strong{Caution:}
+Although this may sound funny or simply irrelevant, we are talking about
+severe security holes. Try to explore your own system this way and make
+sure that none of the above reveals too much information about your system.
+
+@node STATIST, MAZE, WEBGRAB, Some Applications and Techniques
+@section STATIST: Graphing a Statistical Distribution
+@cindex STATIST program
+
+@cindex GNUPlot utility
+@cindex image format
+@cindex @file{gif} image format
+@cindex @file{png} image format
+@cindex @file{ps} image format
+@cindex Boutell, Thomas
+@iftex
+@image{statist,3in}
+@end iftex
+In the HTTP server examples we've shown thus far, we never present an image
+to the browser and its user. Presenting images is one task. Generating
+images that reflect some user input and presenting these dynamically
+generated images is another. In this @value{SECTION}, we use GNUPlot
+for generating @file{.png}, @file{.ps}, or @file{.gif}
+files.@footnote{Due to licensing problems, the default
+installation of GNUPlot disables the generation of @file{.gif} files.
+If your installed version does not accept @samp{set term gif},
+just download and install the most recent version of GNUPlot and the
+@uref{http://www.boutell.com/gd/, GD library}
+by Thomas Boutell.
+Otherwise you still have the chance to generate some
+ASCII-art style images with GNUPlot by using @samp{set term dumb}.
+(We tried it and it worked.)}
+
+The program we develop takes the statistical parameters of two samples
+and computes the t-test statistics. As a result, we get the probabilities
+that the means and the variances of both samples are the same. In order to
+let the user check plausibility, the program presents an image of the
+distributions. The statistical computation follows
+@cite{Numerical Recipes in C: The Art of Scientific Computing}
+by William H.@: Press, Saul A.@: Teukolsky, William T.@: Vetterling, and Brian P. Flannery.
+Since @command{gawk} does not have a built-in function
+for the computation of the beta function, we use the @code{ibeta} function
+of GNUPlot. As a side effect, we learn how to use GNUPlot as a
+sophisticated calculator. The comparison of means is done as in @code{tutest},
+paragraph 14.2, page 613, and the comparison of variances is done as in @code{ftest},
+page 611 in @cite{Numerical Recipes}.
+@cindex Numerical Recipes
+
+As usual, we take the site-independent code for servers and append
+our own functions @code{SetUpServer} and @code{HandleGET}:
+
+@smallexample
+@c file eg/network/statist.awk
+function SetUpServer() @{
+ TopHeader = "<HTML><title>Statistics with GAWK</title>"
+ TopDoc = "<BODY>\
+ <h2>Please choose one of the following actions:</h2>\
+ <UL>\
+ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
+ <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\
+ </UL>"
+ TopFooter = "</BODY></HTML>"
+ GnuPlot = "gnuplot 2>&1"
+ m1=m2=0; v1=v2=1; n1=n2=10
+@}
+@c endfile
+@end smallexample
+
+Here, you see the menu structure that the user sees. Later, we
+will see how the program structure of the @code{HandleGET} function
+reflects the menu structure. What is missing here is the link for the
+image we generate. In an event-driven environment, request,
+generation, and delivery of images are separated.
+
+Notice the way we initialize the @code{GnuPlot} command string for
+the pipe. By default,
+GNUPlot outputs the generated image via standard output, as well as
+the results of @code{print}(ed) calculations via standard error.
+The redirection causes standard error to be mixed into standard
+output, enabling us to read results of calculations with @code{getline}.
+By initializing the statistical parameters with some meaningful
+defaults, we make sure the user gets an image the first time
+he uses the program.
+
+@cindex JavaScript
+Following is the rather long function @code{HandleGET}, which
+implements the contents of this service by reacting to the different
+kinds of requests from the browser. Before you start playing with
+this script, make sure that your browser supports JavaScript and that it also
+has this option switched on. The script uses a short snippet of
+JavaScript code for delayed opening of a window with an image.
+A more detailed explanation follows:
+
+@smallexample
+@c file eg/network/statist.awk
+function HandleGET() @{
+ if(MENU[2] == "AboutServer") @{
+ Document = "This is a GUI for a statistical computation.\
+ It compares means and variances of two distributions.\
+ It is implemented as one GAWK script and uses GNUPLOT."
+ @} else if (MENU[2] == "EnterParameters") @{
+ Document = ""
+ if ("m1" in GETARG) @{ # are there parameters to compare?
+ Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\
+ setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\
+ "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>"
+ m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
+ m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
+ t = (m1-m2)/sqrt(v1/n1+v2/n2)
+ df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
+ + (v2/n2)*(v2/n2) /(n2-1))
+ if (v1>v2) @{
+ f = v1/v2
+ df1 = n1 - 1
+ df2 = n2 - 1
+ @} else @{
+ f = v2/v1
+ df1 = n2 - 1
+ df2 = n1 - 1
+ @}
+ print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
+ print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
+ df2/(df2+df1*f) ")" |& GnuPlot
+ print "print pt, pF" |& GnuPlot
+ RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
+ print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
+ print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
+ print "set term png small color" |& GnuPlot
+ #print "set term postscript color" |& GnuPlot
+ #print "set term gif medium size 320,240" |& GnuPlot
+ print "set yrange[-0.3:]" |& GnuPlot
+ print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
+ print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
+ print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
+ mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
+ print "quit" |& GnuPlot
+ GnuPlot |& getline Image
+ while ((GnuPlot |& getline) > 0)
+ Image = Image RS $0
+ close(GnuPlot)
+ @}
+ Document = Document "\
+ <h3>Do these samples have the same Gaussian distribution?</h3>\
+ <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\
+ <TR>\
+ <TD>1. Mean </TD>
+ <TD><input type=text name=m1 value=" m1 " size=8></TD>\
+ <TD>1. Variance</TD>
+ <TD><input type=text name=v1 value=" v1 " size=8></TD>\
+ <TD>1. Count </TD>
+ <TD><input type=text name=n1 value=" n1 " size=8></TD>\
+ </TR><TR>\
+ <TD>2. Mean </TD>
+ <TD><input type=text name=m2 value=" m2 " size=8></TD>\
+ <TD>2. Variance</TD>
+ <TD><input type=text name=v2 value=" v2 " size=8></TD>\
+ <TD>2. Count </TD>
+ <TD><input type=text name=n2 value=" n2 " size=8></TD>\
+ </TR> <input type=submit value=\"Compute\">\
+ </TABLE></FORM><BR>"
+ @} else if (MENU[2] ~ "Image") @{
+ Reason = "OK" ORS "Content-type: image/png"
+ #Reason = "OK" ORS "Content-type: application/x-postscript"
+ #Reason = "OK" ORS "Content-type: image/gif"
+ Header = Footer = ""
+ Document = Image
+ @}
+@}
+@c endfile
+@end smallexample
+
+@cindex PostScript
+As usual, we give a short description of the service in the first
+menu choice. The third menu choice shows us that generation and
+presentation of an image are two separate actions. While the latter
+takes place quite instantly in the third menu choice, the former
+takes place in the much longer second choice. Image data passes from the
+generating action to the presenting action via the variable @code{Image}
+that contains a complete @file{.png} image, which is otherwise stored
+in a file. If you prefer @file{.ps} or @file{.gif} images over the
+default @file{.png} images, you may select these options by uncommenting
+the appropriate lines. But remember to do so in two places: when
+telling GNUPlot which kind of images to generate, and when transmitting the
+image at the end of the program.
+
+Looking at the end of the program,
+the way we pass the @samp{Content-type} to the browser is a bit unusual.
+It is appended to the @samp{OK} of the first header line
+to make sure the type information becomes part of the header.
+The other variables that get transmitted across the network are
+made empty, because in this case we do not have an HTML document to
+transmit, but rather raw image data to contain in the body.
+
+Most of the work is done in the second menu choice. It starts with a
+strange JavaScript code snippet. When first implementing this server,
+we used a short @code{@w{"<IMG SRC="} MyPrefix "/Image>"} here. But then
+browsers got smarter and tried to improve on speed by requesting the
+image and the HTML code at the same time. When doing this, the browser
+tries to build up a connection for the image request while the request for
+the HTML text is not yet completed. The browser tries to connect
+to the @command{gawk} server on port 8080 while port 8080 is still in use for
+transmission of the HTML text. The connection for the image cannot be
+built up, so the image appears as ``broken'' in the browser window.
+We solved this problem by telling the browser to open a separate window
+for the image, but only after a delay of 1000 milliseconds.
+By this time, the server should be ready for serving the next request.
+
+But there is one more subtlety in the JavaScript code.
+Each time the JavaScript code opens a window for the image, the
+name of the image is appended with a timestamp (@code{systime}).
+Why this constant change of name for the image? Initially, we always named
+the image @code{Image}, but then the Netscape browser noticed the name
+had @emph{not} changed since the previous request and displayed the
+previous image (caching behavior). The server core
+is implemented so that browsers are told @emph{not} to cache anything.
+Obviously HTTP requests do not always work as expected. One way to
+circumvent the cache of such overly smart browsers is to change the
+name of the image with each request. These three lines of JavaScript
+caused us a lot of trouble.
+
+The rest can be broken
+down into two phases. At first, we check if there are statistical
+parameters. When the program is first started, there usually are no
+parameters because it enters the page coming from the top menu.
+Then, we only have to present the user a form that he can use to change
+statistical parameters and submit them. Subsequently, the submission of
+the form causes the execution of the first phase because @emph{now}
+there @emph{are} parameters to handle.
+
+Now that we have parameters, we know there will be an image available.
+Therefore we insert the JavaScript code here to initiate the opening
+of the image in a separate window. Then,
+we prepare some variables that will be passed to GNUPlot for calculation
+of the probabilities. Prior to reading the results, we must temporarily
+change @code{RS} because GNUPlot separates lines with newlines.
+After instructing GNUPlot to generate a @file{.png} (or @file{.ps} or
+@file{.gif}) image, we initiate the insertion of some text,
+explaining the resulting probabilities. The final @samp{plot} command
+actually generates the image data. This raw binary has to be read in carefully
+without adding, changing, or deleting a single byte. Hence the unusual
+initialization of @code{Image} and completion with a @code{while} loop.
+
+When using this server, it soon becomes clear that it is far from being
+perfect. It mixes source code of six scripting languages or protocols:
+
+@itemize @bullet
+@item GNU @command{awk} implements a server for the protocol:
+@item HTTP which transmits:
+@item HTML text which contains a short piece of:
+@item JavaScript code opening a separate window.
+@item A Bourne shell script is used for piping commands into:
+@item GNUPlot to generate the image to be opened.
+@end itemize
+
+After all this work, the GNUPlot image opens in the JavaScript window
+where it can be viewed by the user.
+
+It is probably better not to mix up so many different languages.
+The result is not very readable. Furthermore, the
+statistical part of the server does not take care of invalid input.
+Among others, using negative variances will cause invalid results.
+
+@node MAZE, MOBAGWHO, STATIST, Some Applications and Techniques
+@section MAZE: Walking Through a Maze In Virtual Reality
+@cindex MAZE
+@cindex VRML
+@c VRML in iX 11/96 134.
+@quotation
+@cindex Perlis, Alan
+@i{In the long run, every program becomes rococo, and then rubble.}@*
+Alan Perlis
+@end quotation
+
+By now, we know how to present arbitrary @samp{Content-type}s to a browser.
+In this @value{SECTION}, our server will present a 3D world to our browser.
+The 3D world is described in a scene description language (VRML,
+Virtual Reality Modeling Language) that allows us to travel through a
+perspective view of a 2D maze with our browser. Browsers with a
+VRML plugin enable exploration of this technology. We could do
+one of those boring @samp{Hello world} examples here, that are usually
+presented when introducing novices to
+VRML. If you have never written
+any VRML code, have a look at
+the VRML FAQ.
+Presenting a static VRML scene is a bit trivial; in order to expose
+@command{gawk}'s new capabilities, we will present a dynamically generated
+VRML scene. The function @code{SetUpServer} is very simple because it
+only sets the default HTML page and initializes the random number
+generator. As usual, the surrounding server lets you browse the maze.
+
+@smallexample
+@c file eg/network/maze.awk
+function SetUpServer() @{
+ TopHeader = "<HTML><title>Walk through a maze</title>"
+ TopDoc = "\
+ <h2>Please choose one of the following actions:</h2>\
+ <UL>\
+ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
+ <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\
+ </UL>"
+ TopFooter = "</HTML>"
+ srand()
+@}
+@c endfile
+@end smallexample
+
+The function @code{HandleGET} is a bit longer because it first computes
+the maze and afterwards generates the VRML code that is sent across
+the network. As shown in the STATIST example
+(@pxref{STATIST}),
+we set the type of the
+content to VRML and then store the VRML representation of the maze as the
+page content. We assume that the maze is stored in a 2D array. Initially,
+the maze consists of walls only. Then, we add an entry and an exit to the
+maze and let the rest of the work be done by the function @code{MakeMaze}.
+Now, only the wall fields are left in the maze. By iterating over the these
+fields, we generate one line of VRML code for each wall field.
+
+@smallexample
+@c file eg/network/maze.awk
+function HandleGET() @{
+ if (MENU[2] == "AboutServer") @{
+ Document = "If your browser has a VRML 2 plugin,\
+ this server shows you a simple VRML scene."
+ @} else if (MENU[2] == "VRMLtest") @{
+ XSIZE = YSIZE = 11 # initially, everything is wall
+ for (y = 0; y < YSIZE; y++)
+ for (x = 0; x < XSIZE; x++)
+ Maze[x, y] = "#"
+ delete Maze[0, 1] # entry is not wall
+ delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
+ MakeMaze(1, 1)
+ Document = "\
+#VRML V2.0 utf8\n\
+Group @{\n\
+ children [\n\
+ PointLight @{\n\
+ ambientIntensity 0.2\n\
+ color 0.7 0.7 0.7\n\
+ location 0.0 8.0 10.0\n\
+ @}\n\
+ DEF B1 Background @{\n\
+ skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
+ skyAngle 1.6\n\
+ groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
+ groundAngle [ 1.2 1.57 ]\n\
+ @}\n\
+ DEF Wall Shape @{\n\
+ geometry Box @{size 1 1 1@}\n\
+ appearance Appearance @{ material Material @{ diffuseColor 0 0 1 @} @}\n\
+ @}\n\
+ DEF Entry Viewpoint @{\n\
+ position 0.5 1.0 5.0\n\
+ orientation 0.0 0.0 -1.0 0.52\n\
+ @}\n"
+ for (i in Maze) @{
+ split(i, t, SUBSEP)
+ Document = Document " Transform @{ translation "
+ Document = Document t[1] " 0 -" t[2] " children USE Wall @}\n"
+ @}
+ Document = Document " ] # end of group for world\n@}"
+ Reason = "OK" ORS "Content-type: model/vrml"
+ Header = Footer = ""
+ @}
+@}
+@c endfile
+@end smallexample
+
+Finally, we have a look at @code{MakeMaze}, the function that generates
+the @code{Maze} array. When entered, this function assumes that the array
+has been initialized so that each element represents a wall element and
+the maze is initially full of wall elements. Only the entrance and the exit
+of the maze should have been left free. The parameters of the function tell
+us which element must be marked as not being a wall. After this, we take
+a look at the four neighbouring elements and remember which we have already
+treated. Of all the neighbouring elements, we take one at random and
+walk in that direction. Therefore, the wall element in that direction has
+to be removed and then, we call the function recursively for that element.
+The maze is only completed if we iterate the above procedure for
+@emph{all} neighbouring elements (in random order) and for our present
+element by recursively calling the function for the present element. This
+last iteration could have been done in a loop,
+but it is done much simpler recursively.
+
+Notice that elements with coordinates that are both odd are assumed to be
+on our way through the maze and the generating process cannot terminate
+as long as there is such an element not being @code{delete}d. All other
+elements are potentially part of the wall.
+
+@smallexample
+@c file eg/network/maze.awk
+function MakeMaze(x, y) @{
+ delete Maze[x, y] # here we are, we have no wall here
+ p = 0 # count unvisited fields in all directions
+ if (x-2 SUBSEP y in Maze) d[p++] = "-x"
+ if (x SUBSEP y-2 in Maze) d[p++] = "-y"
+ if (x+2 SUBSEP y in Maze) d[p++] = "+x"
+ if (x SUBSEP y+2 in Maze) d[p++] = "+y"
+ if (p>0) @{ # if there are univisited fields, go there
+ p = int(p*rand()) # choose one unvisited field at random
+ if (d[p] == "-x") @{ delete Maze[x - 1, y]; MakeMaze(x - 2, y)
+ @} else if (d[p] == "-y") @{ delete Maze[x, y - 1]; MakeMaze(x, y - 2)
+ @} else if (d[p] == "+x") @{ delete Maze[x + 1, y]; MakeMaze(x + 2, y)
+ @} else if (d[p] == "+y") @{ delete Maze[x, y + 1]; MakeMaze(x, y + 2)
+ @} # we are back from recursion
+ MakeMaze(x, y); # try again while there are unvisited fields
+ @}
+@}
+@c endfile
+@end smallexample
+
+@node MOBAGWHO, STOXPRED, MAZE, Some Applications and Techniques
+@section MOBAGWHO: a Simple Mobile Agent
+@cindex MOBAGWHO program
+@cindex agent
+@quotation
+@cindex Hoare, C.A.R.
+@i{There are two ways of constructing a software design: One way is to
+make it so simple that there are obviously no deficiencies, and the
+other way is to make it so complicated that there are no obvious
+deficiencies.} @*
+C. A. R. Hoare
+@end quotation
+
+A @dfn{mobile agent} is a program that can be dispatched from a computer and
+transported to a remote server for execution. This is called @dfn{migration},
+which means that a process on another system is started that is independent
+from its originator. Ideally, it wanders through
+a network while working for its creator or owner. In places like
+the UMBC Agent Web,
+people are quite confident that (mobile) agents are a software engineering
+paradigm that enables us to significantly increase the efficiency
+of our work. Mobile agents could become the mediators between users and
+the networking world. For an unbiased view at this technology,
+see the remarkable paper @cite{Mobile Agents: Are they a good
+idea?}.@footnote{@uref{http://www.research.ibm.com/massive/mobag.ps}}
+
+@ignore
+@c Chuck says to take all of this out.
+@cindex Tcl/Tk
+A good instance of this paradigm is
+@cite{Agent Tcl},@footnote{@uref{http://agent.cs.dartmouth.edu/software/agent2.0/}}
+an extension of the Tcl language. After introducing a typical
+development environment, the aforementioned paper shows a nice little
+example application that we will try to rebuild in @command{gawk}. The
+@command{who} agent takes a list of servers and wanders from one server
+to the next one, always looking to see who is logged in.
+Having reached the last
+one, it sends back a message with a list of all users it found on each
+machine.
+
+But before implementing something that might or might not be a mobile
+agent, let us clarify the concept and some important terms. The agent
+paradigm in general is such a young scientific discipline that it has
+not yet developed a widely-accepted terminology. Some authors try to
+give precise definitions, but their scope is often not wide enough
+to be generally accepted. Franklin and Graesser ask
+@cite{Is it an Agent or just a Program: A Taxonomy for Autonomous
+Agents}@footnote{@uref{http://www.msci.memphis.edu/~franklin/AgentProg.html}}
+and give even better answers than Caglayan and Harrison in their
+@cite{Agent Sourcebook}.@footnote{@uref{http://www.aminda.com/mazzu/sourcebook/}}
+
+@itemize @minus
+@item
+@i{An autonomous agent is a system situated within and a part of
+an environment that senses that environment and acts on it, over time, in
+pursuit of its own agenda and so as to effect what it senses in the future.}
+(Quoted from Franklin and Graesser.)
+@item
+A mobile agent is able to transport itself from one machine to another.
+@item
+The term @dfn{migration} often denotes this process of moving.
+But neither of the two sources above even mentions this term, while others
+use it regularly.
+@end itemize
+
+Before delving into the (rather demanding) details of
+implementation, let us give just one more quotation as a final
+motivation. Steven Farley published an excellent paper called
+@cite{Mobile Agent System Architecture},@footnote{This often
+cited text originally appeared as a conference paper here:
+@uref{http://www.sigs.com/publications/docs/java/9705/farley.html}
+Many bibliographies on the Internet point to this dead link. Meanwhile,
+the paper appeared as a contribution to a book called More Java Gems here:
+@uref{http://uk.cambridge.org/computerscience/object/catalogue/0521774772/default.htm}}
+in which he asks ``Why use an agent architecture?''
+
+@quotation
+If client-server systems are the currently established norm and distributed
+object systems such as CORBA are defining the future standards, why bother
+with agents? Agent architectures have certain advantages over these other
+types. Three of the most important advantages are:
+@cindex CORBA
+
+@enumerate
+@item
+An agent performs much processing at the server where local bandwidth
+is high, thus reducing the amount of network bandwidth consumed and increasing
+overall performance. In contrast, a CORBA client object with the equivalent
+functionality of a given agent must make repeated remote method calls to
+the server object because CORBA objects cannot move across the network
+at runtime.
+
+@item
+An agent operates independently of the application from which the
+agent was invoked. The agent operates asynchronously, meaning that the
+client application does not need to wait for the results. This is especially
+important for mobile users who are not always connected to the network.
+
+@item
+The use of agents allows for the injection of new functionality into
+a system at run time. An agent system essentially contains its own automatic
+software distribution mechanism. Since CORBA has no built-in support for
+mobile code, new functionality generally has to be installed manually.
+
+@end enumerate
+
+Of course a non-agent system can exhibit these same features with some
+work. But the mobile code paradigm supports the transfer of executable
+code to a remote location for asynchronous execution from the start. An
+agent architecture should be considered for systems where the above features
+are primary requirements.
+@end quotation
+@end ignore
+
+When trying to migrate a process from one system to another,
+a server process is needed on the receiving side. Depending on the kind
+of server process, several ways of implementation come to mind.
+How the process is implemented depends upon the kind of server process:
+
+@itemize @bullet
+@item
+HTTP can be used as the protocol for delivery of the migrating
+process. In this case, we use a common web
+server as the receiving server process. A universal CGI script
+mediates between migrating process and web server.
+Each server willing to accept migrating agents makes this universal
+service available. HTTP supplies the @code{POST} method to transfer
+some data to a file on the web server. When a CGI script is called
+remotely with the @code{POST} method instead of the usual @code{GET} method,
+data is transmitted from the client process to the standard input
+of the server's CGI script. So, to implement a mobile agent,
+we must not only write the agent program to start on the client
+side, but also the CGI script to receive the agent on the server side.
+
+@cindex CGI
+@cindex apache
+@item
+The @code{PUT} method can also be used for migration. HTTP does not
+require a CGI script for migration via @code{PUT}. However, with common web
+servers there is no advantage to this solution, because web servers such as
+Apache
+require explicit activation of a special @code{PUT} script.
+
+@item
+@cite{Agent Tcl} pursues a different course; it relies on a dedicated server
+process with a dedicated protocol specialized for receiving mobile agents.
+@end itemize
+
+Our agent example abuses a common web server as a migration tool. So, it needs a
+universal CGI script on the receiving side (the web server). The receiving script is
+activated with a @code{POST} request when placed into a location like
+@file{/httpd/cgi-bin/PostAgent.sh}. Make sure that the server system uses a
+version of @command{gawk} that supports network access (Version 3.1 or later;
+verify with @samp{gawk --version}).
+
+@example
+@c file eg/network/PostAgent.sh
+#!/bin/sh
+MobAg=/tmp/MobileAgent.$$
+# direct script to mobile agent file
+cat > $MobAg
+# execute agent concurrently
+gawk -f $MobAg $MobAg > /dev/null &
+# HTTP header, terminator and body
+gawk 'BEGIN @{ print "\r\nAgent started" @}'
+rm $MobAg # delete script file of agent
+@c endfile
+@end example
+
+By making its process id (@code{$$}) part of the unique @value{FN}, the
+script avoids conflicts between concurrent instances of the script.
+First, all lines
+from standard input (the mobile agent's source code) are copied into
+this unique file. Then, the agent is started as a concurrent process
+and a short message reporting this fact is sent to the submitting client.
+Finally, the script file of the mobile agent is removed because it is
+no longer needed. Although it is a short script, there are several noteworthy
+points:
+
+@table @asis
+@item Security
+@emph{There is none}. In fact, the CGI script should never
+be made available on a server that is part of the Internet because everyone
+would be allowed to execute arbitrary commands with it. This behavior is
+acceptable only when performing rapid prototyping.
+
+@item Self-Reference
+Each migrating instance of an agent is started
+in a way that enables it to read its own source code from standard input
+and use the code for subsequent
+migrations. This is necessary because it needs to treat the agent's code
+as data to transmit. @command{gawk} is not the ideal language for such
+a job. Lisp and Tcl are more suitable because they do not make a distinction
+between program code and data.
+
+@item Independence
+After migration, the agent is not linked to its
+former home in any way. By reporting @samp{Agent started}, it waves
+``Goodbye'' to its origin. The originator may choose to terminate or not.
+@end table
+
+@cindex Lisp
+The originating agent itself is started just like any other command-line
+script, and reports the results on standard output. By letting the name
+of the original host migrate with the agent, the agent that migrates
+to a host far away from its origin can report the result back home.
+Having arrived at the end of the journey, the agent establishes
+a connection and reports the results. This is the reason for
+determining the name of the host with @samp{uname -n} and storing it
+in @code{MyOrigin} for later use. We may also set variables with the
+@option{-v} option from the command line. This interactivity is only
+of importance in the context of starting a mobile agent; therefore this
+@code{BEGIN} pattern and its action do not take part in migration:
+
+@smallexample
+@c file eg/network/mobag.awk
+BEGIN @{
+ if (ARGC != 2) @{
+ print "MOBAG - a simple mobile agent"
+ print "CALL:\n gawk -f mobag.awk mobag.awk"
+ print "IN:\n the name of this script as a command-line parameter"
+ print "PARAM:\n -v MyOrigin=myhost.com"
+ print "OUT:\n the result on stdout"
+ print "JK 29.03.1998 01.04.1998"
+ exit
+ @}
+ if (MyOrigin == "") @{
+ "uname -n" | getline MyOrigin
+ close("uname -n")
+ @}
+@}
+@c endfile
+@end smallexample
+
+Since @command{gawk} cannot manipulate and transmit parts of the program
+directly, the source code is read and stored in strings.
+Therefore, the program scans itself for
+the beginning and the ending of functions.
+Each line in between is appended to the code string until the end of
+the function has been reached. A special case is this part of the program
+itself. It is not a function.
+Placing a similar framework around it causes it to be treated
+like a function. Notice that this mechanism works for all the
+functions of the source code, but it cannot guarantee that the order
+of the functions is preserved during migration:
+
+@smallexample
+@c file eg/network/mobag.awk
+#ReadMySelf
+/^function / @{ FUNC = $2 @}
+/^END/ || /^#ReadMySelf/ @{ FUNC = $1 @}
+FUNC != "" @{ MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 @}
+(FUNC != "") && (/^@}/ || /^#EndOfMySelf/) \
+ @{ FUNC = "" @}
+#EndOfMySelf
+@c endfile
+@end smallexample
+
+The web server code in
+@ref{Interacting Service, ,A Web Service with Interaction},
+was first developed as a site-independent core. Likewise, the
+@command{gawk}-based mobile agent
+starts with an agent-independent core, to which can be appended
+application-dependent functions. What follows is the only
+application-independent function needed for the mobile agent:
+
+@smallexample
+@c file eg/network/mobag.awk
+function migrate(Destination, MobCode, Label) @{
+ MOBVAR["Label"] = Label
+ MOBVAR["Destination"] = Destination
+ RS = ORS = "\r\n"
+ HttpService = "/inet/tcp/0/" Destination
+ for (i in MOBFUN)
+ MobCode = (MobCode "\n" MOBFUN[i])
+ MobCode = MobCode "\n\nBEGIN @{"
+ for (i in MOBVAR)
+ MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
+ MobCode = MobCode "\n@}\n"
+ print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
+ print "Content-length:", length(MobCode) ORS |& HttpService
+ printf "%s", MobCode |& HttpService
+ while ((HttpService |& getline) > 0)
+ print $0
+ close(HttpService)
+@}
+@c endfile
+@end smallexample
+
+The @code{migrate} function prepares the
+aforementioned strings containing the program code and transmits them to a
+server. A consequence of this modular approach is that the @code{migrate}
+function takes some parameters that aren't needed in this application,
+but that will be in future ones. Its mandatory parameter @code{Destination} holds the
+name (or IP address) of the server that the agent wants as a host for its
+code. The optional parameter @code{MobCode} may contain some @command{gawk}
+code that is inserted during migration in front of all other code.
+The optional parameter @code{Label} may contain
+a string that tells the agent what to do in program execution after
+arrival at its new home site. One of the serious obstacles in implementing
+a framework for mobile agents is that it does not suffice to migrate the
+code. It is also necessary to migrate the state of execution of the agent. In
+contrast to @cite{Agent Tcl}, this program does not try to migrate the complete set
+of variables. The following conventions are used:
+
+@itemize @bullet
+@item
+Each variable in an agent program is local to the current host and does
+@emph{not} migrate.
+
+@item
+The array @code{MOBFUN} shown above is an exception. It is handled
+by the function @code{migrate} and does migrate with the application.
+
+@item
+The other exception is the array @code{MOBVAR}. Each variable that
+takes part in migration has to be an element of this array.
+@code{migrate} also takes care of this.
+@end itemize
+
+Now it's clear what happens to the @code{Label} parameter of the
+function @code{migrate}. It is copied into @code{MOBVAR["Label"]} and
+travels alongside the other data. Since travelling takes place via HTTP,
+records must be separated with @code{"\r\n"} in @code{RS} and
+@code{ORS} as usual. The code assembly for migration takes place in
+three steps:
+
+@itemize @bullet
+@item
+Iterate over @code{MOBFUN} to collect all functions verbatim.
+
+@item
+Prepare a @code{BEGIN} pattern and put assignments to mobile
+variables into the action part.
+
+@item
+Transmission itself resembles GETURL: the header with the request
+and the @code{Content-length} is followed by the body. In case there is
+any reply over the network, it is read completely and echoed to
+standard output to avoid irritating the server.
+@end itemize
+
+The application-independent framework is now almost complete. What follows
+is the @code{END} pattern that is executed when the mobile agent has
+finished reading its own code. First, it checks whether it is already
+running on a remote host or not. In case initialization has not yet taken
+place, it starts @code{MyInit}. Otherwise (later, on a remote host), it
+starts @code{MyJob}:
+
+@smallexample
+@c file eg/network/mobag.awk
+END @{
+ if (ARGC != 2) exit # stop when called with wrong parameters
+ if (MyOrigin != "") # is this the originating host?
+ MyInit() # if so, initialize the application
+ else # we are on a host with migrated data
+ MyJob() # so we do our job
+@}
+@c endfile
+@end smallexample
+
+All that's left to extend the framework into a complete application
+is to write two application-specific functions: @code{MyInit} and
+@code{MyJob}. Keep in mind that the former is executed once on the
+originating host, while the latter is executed after each migration:
+
+@smallexample
+@c file eg/network/mobag.awk
+function MyInit() @{
+ MOBVAR["MyOrigin"] = MyOrigin
+ MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
+ split(MOBVAR["Machines"], Machines) # which host is the first?
+ migrate(Machines[1], "", "") # go to the first host
+ while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
+ print $0 # print result
+ close("/inet/tcp/8080/0/0")
+@}
+@c endfile
+@end smallexample
+
+As mentioned earlier, this agent takes the name of its origin
+(@code{MyOrigin}) with it. Then, it takes the name of its first
+destination and goes there for further work. Notice that this name has
+the port number of the web server appended to the name of the server,
+because the function @code{migrate} needs it this way to create
+the @code{HttpService} variable. Finally, it waits for the result to arrive.
+The @code{MyJob} function runs on the remote host:
+
+@smallexample
+@c file eg/network/mobag.awk
+function MyJob() @{
+ # forget this host
+ sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
+ MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
+ while (("who" | getline) > 0) # who is logged in?
+ MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
+ close("who")
+ if (index(MOBVAR["Machines"], "/") > 0) @{ # any more machines to visit?
+ split(MOBVAR["Machines"], Machines) # which host is next?
+ migrate(Machines[1], "", "") # go there
+ @} else @{ # no more machines
+ gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
+ print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
+ close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
+ @}
+@}
+@c endfile
+@end smallexample
+
+After migrating, the first thing to do in @code{MyJob} is to delete
+the name of the current host from the list of hosts to visit. Now, it
+is time to start the real work by appending the host's name to the
+result string, and reading line by line who is logged in on this host.
+A very annoying circumstance is the fact that the elements of
+@code{MOBVAR} cannot hold the newline character (@code{"\n"}). If they
+did, migration of this string did not work because the string didn't
+obey the syntax rule for a string in @command{gawk}.
+@code{SUBSEP} is used as a temporary replacement.
+If the list of hosts to visit holds
+at least one more entry, the agent migrates to that place to go on
+working there. Otherwise, we replace the @code{SUBSEP}s
+with a newline character in the resulting string, and report it to
+the originating host, whose name is stored in @code{MOBVAR["MyOrigin"]}.
+
+@node STOXPRED, PROTBASE, MOBAGWHO, Some Applications and Techniques
+@section STOXPRED: Stock Market Prediction As A Service
+@cindex STOXPRED program
+@cindex Yahoo
+@quotation
+@i{Far out in the uncharted backwaters of the unfashionable end of
+the Western Spiral arm of the Galaxy lies a small unregarded yellow sun.}
+
+@i{Orbiting this at a distance of roughly ninety-two million miles is an
+utterly insignificant little blue-green planet whose ape-descendent life
+forms are so amazingly primitive that they still think digital watches are
+a pretty neat idea.}
+
+@i{This planet has --- or rather had --- a problem, which was this:
+most of the people living on it were unhappy for pretty much of the time.
+Many solutions were suggested for this problem, but most of these were
+largely concerned with the movements of small green pieces of paper,
+which is odd because it wasn't the small green pieces of paper that
+were unhappy.} @*
+Douglas Adams, @cite{The Hitch Hiker's Guide to the Galaxy}
+@end quotation
+
+@cindex @command{cron}
+Valuable services on the Internet are usually @emph{not} implemented
+as mobile agents. There are much simpler ways of implementing services.
+All Unix systems provide, for example, the @command{cron} service.
+Unix system users can write a list of tasks to be done each day, each
+week, twice a day, or just once. The list is entered into a file named
+@file{crontab}. For example, to distribute a newsletter on a daily
+basis this way, use @command{cron} for calling a script each day early
+in the morning.
+
+@example
+# run at 8 am on weekdays, distribute the newsletter
+0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
+@end example
+
+The script first looks for interesting information on the Internet,
+assembles it in a nice form and sends the results via email to
+the customers.
+
+The following is an example of a primitive
+newsletter on stock market prediction. It is a report which first
+tries to predict the change of each share in the Dow Jones Industrial
+Index for the particular day. Then it mentions some especially
+promising shares as well as some shares which look remarkably bad
+on that day. The report ends with the usual disclaimer which tells
+every child @emph{not} to try this at home and hurt anybody.
+@cindex Dow Jones Industrial Index
+
+@smallexample
+Good morning Uncle Scrooge,
+
+This is your daily stock market report for Monday, October 16, 2000.
+Here are the predictions for today:
+
+ AA neutral
+ GE up
+ JNJ down
+ MSFT neutral
+ @dots{}
+ UTX up
+ DD down
+ IBM up
+ MO down
+ WMT up
+ DIS up
+ INTC up
+ MRK down
+ XOM down
+ EK down
+ IP down
+
+The most promising shares for today are these:
+
+ INTC http://biz.yahoo.com/n/i/intc.html
+
+The stock shares to avoid today are these:
+
+ EK http://biz.yahoo.com/n/e/ek.html
+ IP http://biz.yahoo.com/n/i/ip.html
+ DD http://biz.yahoo.com/n/d/dd.html
+ @dots{}
+@end smallexample
+
+@ignore
+@c Chuck suggests removing this paragraph
+If you are not into stock market prediction but want to earn money
+with a more humane service, you might prefer to send out horoscopes
+to your customers. Or, once every refrigerator in every household on this side
+of the Chinese Wall is connected to the Internet, such a service could
+inspect the contents of your customer's refrigerators each day and
+advise them on nutrition. Big Brother is watching them.
+@end ignore
+
+The script as a whole is rather long. In order to ease the pain of
+studying other people's source code, we have broken the script
+up into meaningful parts which are invoked one after the other.
+The basic structure of the script is as follows:
+
+@example
+@c file eg/network/stoxpred.awk
+BEGIN @{
+ Init()
+ ReadQuotes()
+ CleanUp()
+ Prediction()
+ Report()
+ SendMail()
+@}
+@c endfile
+@end example
+
+The earlier parts store data into variables and arrays which are
+subsequently used by later parts of the script. The @code{Init} function
+first checks if the script is invoked correctly (without any parameters).
+If not, it informs the user of the correct usage. What follows are preparations
+for the retrieval of the historical quote data. The names of the 30 stock
+shares are stored in an array @code{name} along with the current date
+in @code{day}, @code{month}, and @code{year}.
+
+All users who are separated
+from the Internet by a firewall and have to direct their Internet accesses
+to a proxy must supply the name of the proxy to this script with the
+@samp{-v Proxy=@var{name}} option. For most users, the default proxy and
+port number should suffice.
+
+@example
+@c file eg/network/stoxpred.awk
+function Init() @{
+ if (ARGC != 1) @{
+ print "STOXPRED - daily stock share prediction"
+ print "IN:\n no parameters, nothing on stdin"
+ print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
+ print "OUT:\n commented predictions as email"
+ print "JK 09.10.2000"
+ exit
+ @}
+ # Remember ticker symbols from Dow Jones Industrial Index
+ StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
+ SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
+ MRK XOM EK IP", name);
+ # Remember the current date as the end of the time series
+ day = strftime("%d")
+ month = strftime("%m")
+ year = strftime("%Y")
+ if (Proxy == "") Proxy = "chart.yahoo.com"
+ if (ProxyPort == 0) ProxyPort = 80
+ YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
+@}
+@c endfile
+@end example
+
+@cindex CSV format
+There are two really interesting parts in the script. One is the
+function which reads the historical stock quotes from an Internet
+server. The other is the one that does the actual prediction. In
+the following function we see how the quotes are read from the
+Yahoo server. The data which comes from the server is in
+CSV format (comma-separated values):
+
+@example
+@c file eg/network/stoxdata.txt
+Date,Open,High,Low,Close,Volume
+9-Oct-00,22.75,22.75,21.375,22.375,7888500
+6-Oct-00,23.8125,24.9375,21.5625,22,10701100
+5-Oct-00,24.4375,24.625,23.125,23.50,5810300
+@c endfile
+@end example
+
+Lines contain values of the same time instant, whereas columns are
+separated by commas and contain the kind of data that is described
+in the header (first) line. At first, @command{gawk} is instructed to
+separate columns by commas (@samp{FS = ","}). In the loop that follows,
+a connection to the Yahoo server is first opened, then a download takes
+place, and finally the connection is closed. All this happens once for
+each ticker symbol. In the body of this loop, an Internet address is
+built up as a string according to the rules of the Yahoo server. The
+starting and ending date are chosen to be exactly the same, but one year
+apart in the past. All the action is initiated within the @code{printf}
+command which transmits the request for data to the Yahoo server.
+
+In the inner loop, the server's data is first read and then scanned
+line by line. Only lines which have six columns and the name of a month
+in the first column contain relevant data. This data is stored
+in the two-dimensional array @code{quote}; one dimension
+being time, the other being the ticker symbol. During retrieval of the
+first stock's data, the calendar names of the time instances are stored
+in the array @code{day} because we need them later.
+
+@smallexample
+@c file eg/network/stoxpred.awk
+function ReadQuotes() @{
+ # Retrieve historical data for each ticker symbol
+ FS = ","
+ for (stock = 1; stock <= StockCount; stock++) @{
+ URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
+ "&a=" month "&b=" day "&c=" year-1 \
+ "&d=" month "&e=" day "&f=" year \
+ "g=d&q=q&y=0&z=" name[stock] "&x=.csv"
+ printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
+ while ((YahooData |& getline) > 0) @{
+ if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) @{
+ if (stock == 1)
+ days[++daycount] = $1;
+ quote[$1, stock] = $5
+ @}
+ @}
+ close(YahooData)
+ @}
+ FS = " "
+@}
+@c endfile
+@end smallexample
+
+Now that we @emph{have} the data, it can be checked once again to make sure
+that no individual stock is missing or invalid, and that all the stock quotes are
+aligned correctly. Furthermore, we renumber the time instances. The
+most recent day gets day number 1 and all other days get consecutive
+numbers. All quotes are rounded toward the nearest whole number in US Dollars.
+
+@smallexample
+@c file eg/network/stoxpred.awk
+function CleanUp() @{
+ # clean up time series; eliminate incomplete data sets
+ for (d = 1; d <= daycount; d++) @{
+ for (stock = 1; stock <= StockCount; stock++)
+ if (! ((days[d], stock) in quote))
+ stock = StockCount + 10
+ if (stock > StockCount + 1)
+ continue
+ datacount++
+ for (stock = 1; stock <= StockCount; stock++)
+ data[datacount, stock] = int(0.5 + quote[days[d], stock])
+ @}
+ delete quote
+ delete days
+@}
+@c endfile
+@end smallexample
+
+Now we have arrived at the second really interesting part of the whole affair.
+What we present here is a very primitive prediction algorithm:
+@emph{If a stock fell yesterday, assume it will also fall today; if
+it rose yesterday, assume it will rise today}. (Feel free to replace this
+algorithm with a smarter one.) If a stock changed in the same direction
+on two consecutive days, this is an indication which should be highlighted.
+Two-day advances are stored in @code{hot} and two-day declines in
+@code{avoid}.
+
+The rest of the function is a sanity check. It counts the number of
+correct predictions in relation to the total number of predictions
+one could have made in the year before.
+
+@smallexample
+@c file eg/network/stoxpred.awk
+function Prediction() @{
+ # Predict each ticker symbol by prolonging yesterday's trend
+ for (stock = 1; stock <= StockCount; stock++) @{
+ if (data[1, stock] > data[2, stock]) @{
+ predict[stock] = "up"
+ @} else if (data[1, stock] < data[2, stock]) @{
+ predict[stock] = "down"
+ @} else @{
+ predict[stock] = "neutral"
+ @}
+ if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
+ hot[stock] = 1
+ if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
+ avoid[stock] = 1
+ @}
+ # Do a plausibility check: how many predictions proved correct?
+ for (s = 1; s <= StockCount; s++) @{
+ for (d = 1; d <= datacount-2; d++) @{
+ if (data[d+1, s] > data[d+2, s]) @{
+ UpCount++
+ @} else if (data[d+1, s] < data[d+2, s]) @{
+ DownCount++
+ @} else @{
+ NeutralCount++
+ @}
+ if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
+ ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
+ ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
+ CorrectCount++
+ @}
+ @}
+@}
+@c endfile
+@end smallexample
+
+At this point the hard work has been done: the array @code{predict}
+contains the predictions for all the ticker symbols. It is up to the
+function @code{Report} to find some nice words to introduce the
+desired information.
+
+@smallexample
+@c file eg/network/stoxpred.awk
+function Report() @{
+ # Generate report
+ report = "\nThis is your daily "
+ report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
+ report = report "Here are the predictions for today:\n\n"
+ for (stock = 1; stock <= StockCount; stock++)
+ report = report "\t" name[stock] "\t" predict[stock] "\n"
+ for (stock in hot) @{
+ if (HotCount++ == 0)
+ report = report "\nThe most promising shares for today are these:\n\n"
+ report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
+ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
+ @}
+ for (stock in avoid) @{
+ if (AvoidCount++ == 0)
+ report = report "\nThe stock shares to avoid today are these:\n\n"
+ report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
+ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
+ @}
+ report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
+ report = report " losers. When using this kind\nof prediction scheme for"
+ report = report " the 12 months which lie behind us,\nwe get " UpCount
+ report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
+ report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
+ report = report " predictions " CorrectCount " proved correct next day.\n"
+ report = report "A success rate of "\
+ int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
+ report = report "Random choice would have produced a 33% success rate.\n"
+ report = report "Disclaimer: Like every other prediction of the stock\n"
+ report = report "market, this report is, of course, complete nonsense.\n"
+ report = report "If you are stupid enough to believe these predictions\n"
+ report = report "you should visit a doctor who can treat your ailment."
+@}
+@c endfile
+@end smallexample
+
+The function @code{SendMail} goes through the list of customers and opens
+a pipe to the @code{mail} command for each of them. Each one receives an
+email message with a proper subject heading and is addressed with his full name.
+
+@smallexample
+@c file eg/network/stoxpred.awk
+function SendMail() @{
+ # send report to customers
+ customer["uncle.scrooge@@ducktown.gov"] = "Uncle Scrooge"
+ customer["more@@utopia.org" ] = "Sir Thomas More"
+ customer["spinoza@@denhaag.nl" ] = "Baruch de Spinoza"
+ customer["marx@@highgate.uk" ] = "Karl Marx"
+ customer["keynes@@the.long.run" ] = "John Maynard Keynes"
+ customer["bierce@@devil.hell.org" ] = "Ambrose Bierce"
+ customer["laplace@@paris.fr" ] = "Pierre Simon de Laplace"
+ for (c in customer) @{
+ MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
+ print "Good morning " customer[c] "," | MailPipe
+ print report "\n.\n" | MailPipe
+ close(MailPipe)
+ @}
+@}
+@c endfile
+@end smallexample
+
+Be patient when running the script by hand.
+Retrieving the data for all the ticker symbols and sending the emails
+may take several minutes to complete, depending upon network traffic
+and the speed of the available Internet link.
+The quality of the prediction algorithm is likely to be disappointing.
+Try to find a better one.
+Should you find one with a success rate of more than 50%, please tell
+us about it! It is only for the sake of curiosity, of course. @code{:-)}
+
+@ignore
+@c chuck says to remove this
+Let us give you one final indication as to what one can expect from
+a prediction of stock data, which is sometimes said to contain much
+randomness. One theory says that all relevant information to be taken
+into account when estimating the price of a stock is contained in the
+stock quotes. Every bit of useful information has influenced the
+fair price. Therefore (the theory says) temporary changes (i.e., fluctuations
+within a minute) have to be purely random. But what is the cause of
+short-term changes in stock prices?
+
+Stock prices are fixed when supply and demand meet each other.
+What people are willing to pay reflects human expectations.
+Human expectations are not necessarily random. On the Internet,
+you can find an elucidating paper about predictability and human
+expectations:
+@uref{http://it.ucsd.edu/IT/Newsletter/archives/meir/05meir.html,
+@cite{Reflections on ``Universal Prediction of Individual Sequences''}}
+The authors (Feder, Merhav, Gutman) introduce the reader to the subject
+by telling a thrilling anecdote.
+@cindex Shannon, Claude
+@quotation
+In the early 50's, at Bell Laboratories, David Hagelbarger built a
+simple ``mind reading'' machine, whose purpose was to play the ``penny
+matching'' game. In this game, a player chooses head or tail, while a
+``mind reading'' machine tries to predict and match his choice.
+Surprisingly, as Robert Lucky tells in his book ``Silicon Dreams'',
+Hagelbarger's simple, 8-state machine, was able to match the ``pennies''
+of its human opponent 5,218 times over the course of 9,795 plays.
+Random guessing would lead to such a high success rate with a probability
+less than one out of 10 billion! Shannon, who was interested in prediction,
+information, and thinking machines, closely followed Hagelbarger's
+machine, and eventually built his own stripped-down version of the machine,
+having the same states, but one that used a simpler strategy at each state.
+As the legend goes, in a duel between the two machines, Shannon's machine
+won by a slight margin! No one knows if this was due to a superior algorithm
+or just a chance happening associated with the specific sequence at that game.
+In any event, the success of both these machines against ``untrained'' human
+opponents was explained by the fact that the human opponents cannot draw
+completely random
+bits.
+@end quotation
+@end ignore
+
+@node PROTBASE, , STOXPRED, Some Applications and Techniques
+@section PROTBASE: Searching Through A Protein Database
+@cindex PROTBASE
+@cindex NCBI, National Center for Biotechnology Information
+@cindex BLAST, Basic Local Alignment Search Tool
+@cindex Hoare, C.A.R.
+@quotation
+@i{Hoare's Law of Large Problems: Inside every large problem is a small
+ problem struggling to get out.}
+@end quotation
+
+Yahoo's database of stock market data is just one among the many large
+databases on the Internet. Another one is located at NCBI
+(National Center for Biotechnology
+Information). Established in 1988 as a national resource for molecular
+biology information, NCBI creates public databases, conducts research
+in computational biology, develops software tools for analyzing genome
+data, and disseminates biomedical information. In this section, we
+look at one of NCBI's public services, which is called BLAST
+(Basic Local Alignment Search Tool).
+
+You probably know that the information necessary for reproducing living
+cells is encoded in the genetic material of the cells. The genetic material
+is a very long chain of four base nucleotides. It is the order of
+appearance (the sequence) of nucleotides which contains the information
+about the substance to be produced. Scientists in biotechnology often
+find a specific fragment, determine the nucleotide sequence, and need
+to know where the sequence at hand comes from. This is where the large
+databases enter the game. At NCBI, databases store the knowledge
+about which sequences have ever been found and where they have been found.
+When the scientist sends his sequence to the BLAST service, the server
+looks for regions of genetic material in its database which
+look the most similar to the delivered nucleotide sequence. After a
+search time of some seconds or minutes the server sends an answer to
+the scientist. In order to make access simple, NCBI chose to offer
+their database service through popular Internet protocols. There are
+four basic ways to use the so-called BLAST services:
+
+@itemize @bullet
+@item
+The easiest way to use BLAST is through the web. Users may simply point
+their browsers at the NCBI home page
+and link to the BLAST pages.
+NCBI provides a stable URL that may be used to perform BLAST searches
+without interactive use of a web browser. This is what we will do later
+in this section.
+A demonstration client
+and a @file{README} file demonstrate how to access this URL.
+
+@item
+Currently,
+@command{blastcl3} is the standard network BLAST client.
+You can download @command{blastcl3} from the
+anonymous FTP location.
+
+@item
+BLAST 2.0 can be run locally as a full executable and can be used to run
+BLAST searches against private local databases, or downloaded copies of the
+NCBI databases. BLAST 2.0 executables may be found on the NCBI
+anonymous FTP server.
+
+@item
+The NCBI BLAST Email server is the best option for people without convenient
+access to the web. A similarity search can be performed by sending a properly
+formatted mail message containing the nucleotide or protein query sequence to
+@email{blast@@ncbi.nlm.nih.gov}. The query sequence is compared against the
+specified database using the BLAST algorithm and the results are returned in
+an email message. For more information on formulating email BLAST searches,
+you can send a message consisting of the word ``HELP'' to the same address,
+@email{blast@@ncbi.nlm.nih.gov}.
+@end itemize
+
+Our starting point is the demonstration client mentioned in the first option.
+The @file{README} file that comes along with the client explains the whole
+process in a nutshell. In the rest of this section, we first show
+what such requests look like. Then we show how to use @command{gawk} to
+implement a client in about 10 lines of code. Finally, we show how to
+interpret the result returned from the service.
+
+Sequences are expected to be represented in the standard
+IUB/IUPAC amino acid and nucleic acid codes,
+with these exceptions: lower-case letters are accepted and are mapped
+into upper-case; a single hyphen or dash can be used to represent a gap
+of indeterminate length; and in amino acid sequences, @samp{U} and @samp{*}
+are acceptable letters (see below). Before submitting a request, any numerical
+digits in the query sequence should either be removed or replaced by
+appropriate letter codes (e.g., @samp{N} for unknown nucleic acid residue
+or @samp{X} for unknown amino acid residue).
+The nucleic acid codes supported are:
+
+@example
+A --> adenosine M --> A C (amino)
+C --> cytidine S --> G C (strong)
+G --> guanine W --> A T (weak)
+T --> thymidine B --> G T C
+U --> uridine D --> G A T
+R --> G A (purine) H --> A C T
+Y --> T C (pyrimidine) V --> G C A
+K --> G T (keto) N --> A G C T (any)
+ - gap of indeterminate length
+@end example
+
+Now you know the alphabet of nucleotide sequences. The last two lines
+of the following example query show you such a sequence, which is obviously
+made up only of elements of the alphabet just described. Store this example
+query into a file named @file{protbase.request}. You are now ready to send
+it to the server with the demonstration client.
+
+@example
+@c file eg/network/protbase.request
+PROGRAM blastn
+DATALIB month
+EXPECT 0.75
+BEGIN
+>GAWK310 the gawking gene GNU AWK
+tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
+caccaccatggacagcaaa
+@c endfile
+@end example
+
+@cindex FASTA/Pearson format
+The actual search request begins with the mandatory parameter @samp{PROGRAM}
+in the first column followed by the value @samp{blastn} (the name of the
+program) for searching nucleic acids. The next line contains the mandatory
+search parameter @samp{DATALIB} with the value @samp{month} for the newest
+nucleic acid sequences. The third line contains an optional @samp{EXPECT}
+parameter and the value desired for it. The fourth line contains the
+mandatory @samp{BEGIN} directive, followed by the query sequence in
+FASTA/Pearson format.
+Each line of information must be less than 80 characters in length.
+
+The ``month'' database contains all new or revised sequences released in the
+last 30 days and is useful for searching against new sequences.
+There are five different blast programs, @command{blastn} being the one that
+compares a nucleotide query sequence against a nucleotide sequence database.
+
+The last server directive that must appear in every request is the
+@samp{BEGIN} directive. The query sequence should immediately follow the
+@samp{BEGIN} directive and must appear in FASTA/Pearson format.
+A sequence in
+FASTA/Pearson format begins with a single-line description.
+The description line, which is required, is distinguished from the lines of
+sequence data that follow it by having a greater-than (@samp{>}) symbol
+in the first column. For the purposes of the BLAST server, the text of
+the description is arbitrary.
+
+If you prefer to use a client written in @command{gawk}, just store the following
+10 lines of code into a file named @file{protbase.awk} and use this client
+instead. Invoke it with @samp{gawk -f protbase.awk protbase.request}.
+Then wait a minute and watch the result coming in. In order to replicate
+the demonstration client's behaviour as closely as possible, this client
+does not use a proxy server. We could also have extended the client program
+in @ref{GETURL, ,Retrieving Web Pages}, to implement the client request from
+@file{protbase.awk} as a special case.
+
+@smallexample
+@c file eg/network/protbase.awk
+@{ request = request "\n" $0 @}
+
+END @{
+ BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
+ printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
+ printf "Content-Length: " length(request) "\n\n" |& BLASTService
+ printf request |& BLASTService
+ while ((BLASTService |& getline) > 0)
+ print $0
+ close(BLASTService)
+@}
+@c endfile
+@end smallexample
+
+The demonstration client from NCBI is 214 lines long (written in C) and
+it is not immediately obvious what it does. Our client is so short that
+it @emph{is} obvious what it does. First it loops over all lines of the
+query and stores the whole query into a variable. Then the script
+establishes an Internet connection to the NCBI server and transmits the
+query by framing it with a proper HTTP request. Finally it receives
+and prints the complete result coming from the server.
+
+Now, let us look at the result. It begins with an HTTP header, which you
+can ignore. Then there are some comments about the query having been
+filtered to avoid spuriously high scores. After this, there is a reference
+to the paper that describes the software being used for searching the data
+base. After a repitition of the original query's description we find the
+list of significant alignments:
+
+@smallexample
+@c file eg/network/protbase.result
+Sequences producing significant alignments: (bits) Value
+
+gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
+gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
+emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
+emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
+emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
+emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
+gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
+@c endfile
+@end smallexample
+
+This means that the query sequence was found in seven human chromosomes.
+But the value 0.20 (20%) means that the probability of an accidental match
+is rather high (20%) in all cases and should be taken into account.
+You may wonder what the first column means. It is a key to the specific
+database in which this occurence was found. The unique sequence identifiers
+reported in the search results can be used as sequence retrieval keys
+via the NCBI server. The syntax of sequence header lines used by the NCBI
+BLAST server depends on the database from which each sequence was obtained.
+The table below lists the identifiers for the databases from which the
+sequences were derived.
+
+@ifinfo
+@example
+Database Name Identifier Syntax
+============================ ========================
+GenBank gb|accession|locus
+EMBL Data Library emb|accession|locus
+DDBJ, DNA Database of Japan dbj|accession|locus
+NBRF PIR pir||entry
+Protein Research Foundation prf||name
+SWISS-PROT sp|accession|entry name
+Brookhaven Protein Data Bank pdb|entry|chain
+Kabat's Sequences of Immuno@dots{} gnl|kabat|identifier
+Patents pat|country|number
+GenInfo Backbone Id bbs|number
+@end example
+@end ifinfo
+
+@ifnotinfo
+@multitable {Kabat's Sequences of Immuno@dots{}} {@code{@w{sp|accession|entry name}}}
+@item GenBank @tab @code{gb|accession|locus}
+@item EMBL Data Library @tab @code{emb|accession|locus}
+@item DDBJ, DNA Database of Japan @tab @code{dbj|accession|locus}
+@item NBRF PIR @tab @code{pir||entry}
+@item Protein Research Foundation @tab @code{prf||name}
+@item SWISS-PROT @tab @code{@w{sp|accession|entry name}}
+@item Brookhaven Protein Data Bank @tab @code{pdb|entry|chain}
+@item Kabat's Sequences of Immuno@dots{} @tab @code{gnl|kabat|identifier}
+@item Patents @tab @code{pat|country|number}
+@item GenInfo Backbone Id @tab @code{bbs|number}
+@end multitable
+@end ifnotinfo
+
+
+For example, an identifier might be @samp{gb|AC021182.14|AC021182}, where the
+@samp{gb} tag indicates that the identifier refers to a GenBank sequence,
+@samp{AC021182.14} is its GenBank ACCESSION, and @samp{AC021182} is the GenBank LOCUS.
+The identifier contains no spaces, so that a space indicates the end of the
+identifier.
+
+Let us continue in the result listing. Each of the seven alignments mentioned
+above is subsequently described in detail. We will have a closer look at
+the first of them.
+
+@smallexample
+>gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
+ unordered pieces
+ Length = 176383
+
+ Score = 38.2 bits (19), Expect = 0.20
+ Identities = 19/19 (100%)
+ Strand = Plus / Plus
+
+Query: 35 tggtgaagtgtgtttcttg 53
+ |||||||||||||||||||
+Sbjct: 69786 tggtgaagtgtgtttcttg 69804
+@end smallexample
+
+This alignment was located on the human chromosome 7. The fragment on which
+part of the query was found had a total length of 176383. Only 19 of the
+nucleotides matched and the matching sequence ran from character 35 to 53
+in the query sequence and from 69786 to 69804 in the fragment on chromosome 7.
+If you are still reading at this point, you are probably interested in finding
+out more about Computational Biology and you might appreciate the following
+hints.
+
+@cindex Computational Biology
+@cindex Bioinformatics
+@enumerate
+@item
+There is a book called @cite{Introduction to Computational Biology}
+by Michael S. Waterman, which is worth reading if you are seriously
+interested. You can find a good
+book review
+on the Internet.
+
+@item
+While Waterman's book can explain to you the algorithms employed internally
+in the database search engines, most practicioners prefer to approach
+the subject differently. The applied side of Computational Biology is
+called Bioinformatics, and emphasizes the tools available for day-to-day
+work as well as how to actually @emph{use} them. One of the very few affordable
+books on Bioinformatics is
+@cite{Developing Bioinformatics Computer Skills}.
+
+@item
+The sequences @emph{gawk} and @emph{gnuawk} are in widespread use in
+the genetic material of virtually every earthly living being. Let us
+take this as a clear indication that the divine creator has intended
+@code{gawk} to prevail over other scripting languages such as @code{perl},
+@code{tcl}, or @code{python} which are not even proper sequences. (:-)
+@end enumerate
+
+@node Links, GNU Free Documentation License, Some Applications and Techniques, Top
+@chapter Related Links
+
+This section lists the URLs for various items discussed in this @value{CHAPTER}.
+They are presented in the order in which they appear.
+
+@table @asis
+
+@item @cite{Internet Programming with Python}
+@uref{http://www.fsbassociates.com/books/python.htm}
+
+@item @cite{Advanced Perl Programming}
+@uref{http://www.oreilly.com/catalog/advperl}
+
+@item @cite{Web Client Programming with Perl}
+@uref{http://www.oreilly.com/catalog/webclient}
+
+@item Richard Stevens's home page and book
+@uref{http://www.kohala.com/~rstevens}
+
+@item The SPAK home page
+@uref{http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html}
+
+@item Volume III of @cite{Internetworking with TCP/IP}, by Comer and Stevens
+@uref{http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html}
+
+@item XBM Graphics File Format
+@uref{http://www.wotsit.org/download.asp?f=xbm}
+
+@item GNUPlot
+@uref{http://www.cs.dartmouth.edu/gnuplot_info.html}
+
+@item Mark Humphrys' Eliza page
+@uref{http://www.compapp.dcu.ie/~humphrys/eliza.html}
+
+@item Yahoo! Eliza Information
+@uref{http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence}
+
+@item Java versions of Eliza
+@uref{http://www.tjhsst.edu/Psych/ch1/eliza.html}
+
+@item Java versions of Eliza with source code
+@uref{http://home.adelphia.net/~lifeisgood/eliza/eliza.htm}
+
+@item Eliza Programs with Explanations
+@uref{http://chayden.net/chayden/eliza/Eliza.shtml}
+
+@item Loebner Contest
+@uref{http://acm.org/~loebner/loebner-prize.htmlx}
+
+@item Tck/Tk Information
+@uref{http://www.scriptics.com/}
+
+@item Intel 80x86 Processors
+@uref{http://developer.intel.com/design/platform/embedpc/what_is.htm}
+
+@item AMD Elan Processors
+@uref{http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html}
+
+@item XINU
+@uref{http://willow.canberra.edu.au/~chrisc/xinu.html }
+
+@item GNU/Linux
+@uref{http://uclinux.lineo.com/}
+
+@item Embedded PCs
+@uref{http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/}
+
+@item MiniSQL
+@uref{http://www.hughes.com.au/library/}
+
+@item Market Share Surveys
+@uref{http://www.netcraft.com/survey}
+
+@item @cite{Numerical Recipes in C: The Art of Scientific Computing}
+@uref{http://www.nr.com}
+
+@item VRML
+@uref{http://www.vrml.org}
+
+@item The VRML FAQ
+@uref{http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ}
+
+@item The UMBC Agent Web
+@uref{http://www.cs.umbc.edu/agents }
+
+@item Apache Web Server
+@uref{http://www.apache.org}
+
+@item National Center for Biotechnology Information (NCBI)
+@uref{http://www.ncbi.nlm.nih.gov}
+
+@item Basic Local Alignment Search Tool (BLAST)
+@uref{http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html}
+
+@item NCBI Home Page
+@uref{http://www.ncbi.nlm.nih.gov}
+
+@item BLAST Pages
+@uref{http://www.ncbi.nlm.nih.gov/BLAST}
+
+@item BLAST Demonstration Client
+@uref{ftp://ncbi.nlm.nih.gov/blast/blasturl/}
+
+@item BLAST anonymous FTP location
+@uref{ftp://ncbi.nlm.nih.gov/blast/network/netblast/}
+
+@item BLAST 2.0 Executables
+@uref{ftp://ncbi.nlm.nih.gov/blast/executables/}
+
+@item IUB/IUPAC Amino Acid and Nucleic Acid Codes
+@uref{http://www.uthscsa.edu/geninfo/blastmail.html#item6}
+
+@item FASTA/Pearson Format
+@uref{http://www.ncbi.nlm.nih.gov/BLAST/fasta.html}
+
+@item Fasta/Pearson Sequence in Java
+@uref{http://www.kazusa.or.jp/java/codon_table_java/}
+
+@item Book Review of @cite{Introduction to Computational Biology}
+@uref{http://www.acm.org/crossroads/xrds5-1/introcb.html}
+
+@item @cite{Developing Bioinformatics Computer Skills}
+@uref{http://www.oreilly.com/catalog/bioskills/}
+
+@end table
+
+@node GNU Free Documentation License, Index, Links, Top
+@unnumbered GNU Free Documentation License
+@center Version 1.1, March 2000
+
+@display
+Copyright (C) 2000 Free Software Foundation, Inc.
+59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+Everyone is permitted to copy and distribute verbatim copies
+of this license document, but changing it is not allowed.
+@end display
+@sp 1
+@enumerate 0
+@item
+PREAMBLE
+
+The purpose of this License is to make a manual, textbook, or other
+written document ``free'' in the sense of freedom: to assure everyone
+the effective freedom to copy and redistribute it, with or without
+modifying it, either commercially or noncommercially. Secondarily,
+this License preserves for the author and publisher a way to get
+credit for their work, while not being considered responsible for
+modifications made by others.
+
+This License is a kind of ``copyleft'', which means that derivative
+works of the document must themselves be free in the same sense. It
+complements the GNU General Public License, which is a copyleft
+license designed for free software.
+
+We have designed this License in order to use it for manuals for free
+software, because free software needs free documentation: a free
+program should come with manuals providing the same freedoms that the
+software does. But this License is not limited to software manuals;
+it can be used for any textual work, regardless of subject matter or
+whether it is published as a printed book. We recommend this License
+principally for works whose purpose is instruction or reference.
+
+@sp 1
+@item
+APPLICABILITY AND DEFINITIONS
+
+This License applies to any manual or other work that contains a
+notice placed by the copyright holder saying it can be distributed
+under the terms of this License. The ``Document'', below, refers to any
+such manual or work. Any member of the public is a licensee, and is
+addressed as ``you''.
+
+A ``Modified Version'' of the Document means any work containing the
+Document or a portion of it, either copied verbatim, or with
+modifications and/or translated into another language.
+
+A ``Secondary Section'' is a named appendix or a front-matter section of
+the Document that deals exclusively with the relationship of the
+publishers or authors of the Document to the Document's overall subject
+(or to related matters) and contains nothing that could fall directly
+within that overall subject. (For example, if the Document is in part a
+textbook of mathematics, a Secondary Section may not explain any
+mathematics.) The relationship could be a matter of historical
+connection with the subject or with related matters, or of legal,
+commercial, philosophical, ethical or political position regarding
+them.
+
+The ``Invariant Sections'' are certain Secondary Sections whose titles
+are designated, as being those of Invariant Sections, in the notice
+that says that the Document is released under this License.
+
+The ``Cover Texts'' are certain short passages of text that are listed,
+as Front-Cover Texts or Back-Cover Texts, in the notice that says that
+the Document is released under this License.
+
+A ``Transparent'' copy of the Document means a machine-readable copy,
+represented in a format whose specification is available to the
+general public, whose contents can be viewed and edited directly and
+straightforwardly with generic text editors or (for images composed of
+pixels) generic paint programs or (for drawings) some widely available
+drawing editor, and that is suitable for input to text formatters or
+for automatic translation to a variety of formats suitable for input
+to text formatters. A copy made in an otherwise Transparent file
+format whose markup has been designed to thwart or discourage
+subsequent modification by readers is not Transparent. A copy that is
+not ``Transparent'' is called ``Opaque''.
+
+Examples of suitable formats for Transparent copies include plain
+ASCII without markup, Texinfo input format, LaTeX input format, SGML
+or XML using a publicly available DTD, and standard-conforming simple
+HTML designed for human modification. Opaque formats include
+PostScript, PDF, proprietary formats that can be read and edited only
+by proprietary word processors, SGML or XML for which the DTD and/or
+processing tools are not generally available, and the
+machine-generated HTML produced by some word processors for output
+purposes only.
+
+The ``Title Page'' means, for a printed book, the title page itself,
+plus such following pages as are needed to hold, legibly, the material
+this License requires to appear in the title page. For works in
+formats which do not have any title page as such, ``Title Page'' means
+the text near the most prominent appearance of the work's title,
+preceding the beginning of the body of the text.
+@sp 1
+@item
+VERBATIM COPYING
+
+You may copy and distribute the Document in any medium, either
+commercially or noncommercially, provided that this License, the
+copyright notices, and the license notice saying this License applies
+to the Document are reproduced in all copies, and that you add no other
+conditions whatsoever to those of this License. You may not use
+technical measures to obstruct or control the reading or further
+copying of the copies you make or distribute. However, you may accept
+compensation in exchange for copies. If you distribute a large enough
+number of copies you must also follow the conditions in section 3.
+
+You may also lend copies, under the same conditions stated above, and
+you may publicly display copies.
+@sp 1
+@item
+COPYING IN QUANTITY
+
+If you publish printed copies of the Document numbering more than 100,
+and the Document's license notice requires Cover Texts, you must enclose
+the copies in covers that carry, clearly and legibly, all these Cover
+Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on
+the back cover. Both covers must also clearly and legibly identify
+you as the publisher of these copies. The front cover must present
+the full title with all words of the title equally prominent and
+visible. You may add other material on the covers in addition.
+Copying with changes limited to the covers, as long as they preserve
+the title of the Document and satisfy these conditions, can be treated
+as verbatim copying in other respects.
+
+If the required texts for either cover are too voluminous to fit
+legibly, you should put the first ones listed (as many as fit
+reasonably) on the actual cover, and continue the rest onto adjacent
+pages.
+
+If you publish or distribute Opaque copies of the Document numbering
+more than 100, you must either include a machine-readable Transparent
+copy along with each Opaque copy, or state in or with each Opaque copy
+a publicly-accessible computer-network location containing a complete
+Transparent copy of the Document, free of added material, which the
+general network-using public has access to download anonymously at no
+charge using public-standard network protocols. If you use the latter
+option, you must take reasonably prudent steps, when you begin
+distribution of Opaque copies in quantity, to ensure that this
+Transparent copy will remain thus accessible at the stated location
+until at least one year after the last time you distribute an Opaque
+copy (directly or through your agents or retailers) of that edition to
+the public.
+
+It is requested, but not required, that you contact the authors of the
+Document well before redistributing any large number of copies, to give
+them a chance to provide you with an updated version of the Document.
+@sp 1
+@item
+MODIFICATIONS
+
+You may copy and distribute a Modified Version of the Document under
+the conditions of sections 2 and 3 above, provided that you release
+the Modified Version under precisely this License, with the Modified
+Version filling the role of the Document, thus licensing distribution
+and modification of the Modified Version to whoever possesses a copy
+of it. In addition, you must do these things in the Modified Version:
+
+@enumerate A
+@item
+Use in the Title Page (and on the covers, if any) a title distinct
+from that of the Document, and from those of previous versions
+(which should, if there were any, be listed in the History section
+of the Document). You may use the same title as a previous version
+if the original publisher of that version gives permission.
+
+@item
+List on the Title Page, as authors, one or more persons or entities
+responsible for authorship of the modifications in the Modified
+Version, together with at least five of the principal authors of the
+Document (all of its principal authors, if it has less than five).
+
+@item
+State on the Title page the name of the publisher of the
+Modified Version, as the publisher.
+
+@item
+Preserve all the copyright notices of the Document.
+
+@item
+Add an appropriate copyright notice for your modifications
+adjacent to the other copyright notices.
+
+@item
+Include, immediately after the copyright notices, a license notice
+giving the public permission to use the Modified Version under the
+terms of this License, in the form shown in the Addendum below.
+
+@item
+Preserve in that license notice the full lists of Invariant Sections
+and required Cover Texts given in the Document's license notice.
+
+@item
+Include an unaltered copy of this License.
+
+@item
+Preserve the section entitled ``History'', and its title, and add to
+it an item stating at least the title, year, new authors, and
+publisher of the Modified Version as given on the Title Page. If
+there is no section entitled ``History'' in the Document, create one
+stating the title, year, authors, and publisher of the Document as
+given on its Title Page, then add an item describing the Modified
+Version as stated in the previous sentence.
+
+@item
+Preserve the network location, if any, given in the Document for
+public access to a Transparent copy of the Document, and likewise
+the network locations given in the Document for previous versions
+it was based on. These may be placed in the ``History'' section.
+You may omit a network location for a work that was published at
+least four years before the Document itself, or if the original
+publisher of the version it refers to gives permission.
+
+@item
+In any section entitled ``Acknowledgements'' or ``Dedications'',
+preserve the section's title, and preserve in the section all the
+substance and tone of each of the contributor acknowledgements
+and/or dedications given therein.
+
+@item
+Preserve all the Invariant Sections of the Document,
+unaltered in their text and in their titles. Section numbers
+or the equivalent are not considered part of the section titles.
+
+@item
+Delete any section entitled ``Endorsements''. Such a section
+may not be included in the Modified Version.
+
+@item
+Do not retitle any existing section as ``Endorsements''
+or to conflict in title with any Invariant Section.
+@end enumerate
+
+If the Modified Version includes new front-matter sections or
+appendices that qualify as Secondary Sections and contain no material
+copied from the Document, you may at your option designate some or all
+of these sections as invariant. To do this, add their titles to the
+list of Invariant Sections in the Modified Version's license notice.
+These titles must be distinct from any other section titles.
+
+You may add a section entitled ``Endorsements'', provided it contains
+nothing but endorsements of your Modified Version by various
+parties--for example, statements of peer review or that the text has
+been approved by an organization as the authoritative definition of a
+standard.
+
+You may add a passage of up to five words as a Front-Cover Text, and a
+passage of up to 25 words as a Back-Cover Text, to the end of the list
+of Cover Texts in the Modified Version. Only one passage of
+Front-Cover Text and one of Back-Cover Text may be added by (or
+through arrangements made by) any one entity. If the Document already
+includes a cover text for the same cover, previously added by you or
+by arrangement made by the same entity you are acting on behalf of,
+you may not add another; but you may replace the old one, on explicit
+permission from the previous publisher that added the old one.
+
+The author(s) and publisher(s) of the Document do not by this License
+give permission to use their names for publicity for or to assert or
+imply endorsement of any Modified Version.
+@sp 1
+@item
+COMBINING DOCUMENTS
+
+You may combine the Document with other documents released under this
+License, under the terms defined in section 4 above for modified
+versions, provided that you include in the combination all of the
+Invariant Sections of all of the original documents, unmodified, and
+list them all as Invariant Sections of your combined work in its
+license notice.
+
+The combined work need only contain one copy of this License, and
+multiple identical Invariant Sections may be replaced with a single
+copy. If there are multiple Invariant Sections with the same name but
+different contents, make the title of each such section unique by
+adding at the end of it, in parentheses, the name of the original
+author or publisher of that section if known, or else a unique number.
+Make the same adjustment to the section titles in the list of
+Invariant Sections in the license notice of the combined work.
+
+In the combination, you must combine any sections entitled ``History''
+in the various original documents, forming one section entitled
+``History''; likewise combine any sections entitled ``Acknowledgements'',
+and any sections entitled ``Dedications''. You must delete all sections
+entitled ``Endorsements.''
+@sp 1
+@item
+COLLECTIONS OF DOCUMENTS
+
+You may make a collection consisting of the Document and other documents
+released under this License, and replace the individual copies of this
+License in the various documents with a single copy that is included in
+the collection, provided that you follow the rules of this License for
+verbatim copying of each of the documents in all other respects.
+
+You may extract a single document from such a collection, and distribute
+it individually under this License, provided you insert a copy of this
+License into the extracted document, and follow this License in all
+other respects regarding verbatim copying of that document.
+@sp 1
+@item
+AGGREGATION WITH INDEPENDENT WORKS
+
+A compilation of the Document or its derivatives with other separate
+and independent documents or works, in or on a volume of a storage or
+distribution medium, does not as a whole count as a Modified Version
+of the Document, provided no compilation copyright is claimed for the
+compilation. Such a compilation is called an ``aggregate'', and this
+License does not apply to the other self-contained works thus compiled
+with the Document, on account of their being thus compiled, if they
+are not themselves derivative works of the Document.
+
+If the Cover Text requirement of section 3 is applicable to these
+copies of the Document, then if the Document is less than one quarter
+of the entire aggregate, the Document's Cover Texts may be placed on
+covers that surround only the Document within the aggregate.
+Otherwise they must appear on covers around the whole aggregate.
+@sp 1
+@item
+TRANSLATION
+
+Translation is considered a kind of modification, so you may
+distribute translations of the Document under the terms of section 4.
+Replacing Invariant Sections with translations requires special
+permission from their copyright holders, but you may include
+translations of some or all Invariant Sections in addition to the
+original versions of these Invariant Sections. You may include a
+translation of this License provided that you also include the
+original English version of this License. In case of a disagreement
+between the translation and the original English version of this
+License, the original English version will prevail.
+@sp 1
+@item
+TERMINATION
+
+You may not copy, modify, sublicense, or distribute the Document except
+as expressly provided for under this License. Any other attempt to
+copy, modify, sublicense or distribute the Document is void, and will
+automatically terminate your rights under this License. However,
+parties who have received copies, or rights, from you under this
+License will not have their licenses terminated so long as such
+parties remain in full compliance.
+@sp 1
+@item
+FUTURE REVISIONS OF THIS LICENSE
+
+The Free Software Foundation may publish new, revised versions
+of the GNU Free Documentation License from time to time. Such new
+versions will be similar in spirit to the present version, but may
+differ in detail to address new problems or concerns. See
+@uref{http://www.gnu.org/copyleft/}.
+
+Each version of the License is given a distinguishing version number.
+If the Document specifies that a particular numbered version of this
+License ``or any later version'' applies to it, you have the option of
+following the terms and conditions either of that specified version or
+of any later version that has been published (not as a draft) by the
+Free Software Foundation. If the Document does not specify a version
+number of this License, you may choose any version ever published (not
+as a draft) by the Free Software Foundation.
+
+@end enumerate
+
+@c fakenode --- for prepinfo
+@unnumberedsec ADDENDUM: How to use this License for your documents
+
+To use this License in a document you have written, include a copy of
+the License in the document and put the following copyright and
+license notices just after the title page:
+
+@smallexample
+@group
+
+ Copyright (C) @var{year} @var{your name}.
+ Permission is granted to copy, distribute and/or modify this document
+ under the terms of the GNU Free Documentation License, Version 1.1
+ or any later version published by the Free Software Foundation;
+ with the Invariant Sections being @var{list their titles}, with the
+ Front-Cover Texts being @var{list}, and with the Back-Cover Texts being @var{list}.
+ A copy of the license is included in the section entitled ``GNU
+ Free Documentation License''.
+@end group
+@end smallexample
+If you have no Invariant Sections, write ``with no Invariant Sections''
+instead of saying which ones are invariant. If you have no
+Front-Cover Texts, write ``no Front-Cover Texts'' instead of
+``Front-Cover Texts being @var{list}''; likewise for Back-Cover Texts.
+
+If your document contains nontrivial examples of program code, we
+recommend releasing these examples in parallel under your choice of
+free software license, such as the GNU General Public License,
+to permit their use in free software.
+
+@node Index, , GNU Free Documentation License, Top
+@comment node-name, next, previous, up
+
+@unnumbered Index
+@printindex cp
+@bye
+
+Conventions:
+1. Functions, built-in or otherwise, do NOT have () after them.
+2. Gawk built-in vars and functions are in @code. Also program vars and
+ functions.
+3. HTTP method names are in @code.
+4. Protocols such as echo, ftp, etc are in @samp.
+5. URLs are in @url.
+6. All RFC's in the index. Put a space between `RFC' and the number.
diff --git a/contrib/awk/doc/no.colors b/contrib/awk/doc/no.colors
index 974f985..d5fb038 100644
--- a/contrib/awk/doc/no.colors
+++ b/contrib/awk/doc/no.colors
@@ -1,6 +1,6 @@
.\" AWK Reference Card --- Arnold Robbins, arnold@gnu.org
.\" This file is for troff which does not know what to do
-.\" with a literal Poscript and cannot use macros from 'colors'.
+.\" with literal Poscript and cannot use the macros from 'colors'.
.\"
.\" Copyright (C) 1996 Free Software Foundation, Inc.
.\"
diff --git a/contrib/awk/doc/texinfo.tex b/contrib/awk/doc/texinfo.tex
index ebf58d8..0b5b903 100644
--- a/contrib/awk/doc/texinfo.tex
+++ b/contrib/awk/doc/texinfo.tex
@@ -3,10 +3,10 @@
% Load plain if necessary, i.e., if running under initex.
\expandafter\ifx\csname fmtname\endcsname\relax\input plain\fi
%
-\def\texinfoversion{1999-10-01.07}
+\def\texinfoversion{2001-03-28.08}
%
-% Copyright (C) 1985, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99
-% Free Software Foundation, Inc.
+% Copyright (C) 1985, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
+% 2000, 01 Free Software Foundation, Inc.
%
% This texinfo.tex file is free software; you can redistribute it and/or
% modify it under the terms of the GNU General Public License as
@@ -214,6 +214,9 @@
\normalturnoffactive % \ in index entries must not stay \, e.g., if
% the page break happens to be in the middle of an example.
\shipout\vbox{%
+ % Do this early so pdf references go to the beginning of the page.
+ \ifpdfmakepagedest \pdfmkdest{\the\pageno} \fi
+ %
\ifcropmarks \vbox to \outervsize\bgroup
\hsize = \outerhsize
\vskip-\topandbottommargin
@@ -243,8 +246,6 @@
\unvbox\footlinebox
\fi
%
- \ifpdfmakepagedest \pdfmkdest{\the\pageno} \fi
- %
\ifcropmarks
\egroup % end of \vbox\bgroup
\hfil\egroup % end of (centering) \line\bgroup
@@ -687,16 +688,54 @@ where each line of input produces a line of output.}
\def\nofillexdentyyy #1{{\advance \leftskip by -\exdentamount
\leftline{\hskip\leftskip{\rm#1}}}}
-% @inmargin{TEXT} puts TEXT in the margin next to the current paragraph.
-
-\def\inmargin#1{%
-\strut\vadjust{\nobreak\kern-\strutdepth
- \vtop to \strutdepth{\baselineskip\strutdepth\vss
- \llap{\rightskip=\inmarginspacing \vbox{\noindent #1}}\null}}}
+% @inmargin{WHICH}{TEXT} puts TEXT in the WHICH margin next to the current
+% paragraph. For more general purposes, use the \margin insertion
+% class. WHICH is `l' or `r'.
+%
\newskip\inmarginspacing \inmarginspacing=1cm
\def\strutdepth{\dp\strutbox}
-
-%\hbox{{\rm#1}}\hfil\break}}
+%
+\def\doinmargin#1#2{\strut\vadjust{%
+ \nobreak
+ \kern-\strutdepth
+ \vtop to \strutdepth{%
+ \baselineskip=\strutdepth
+ \vss
+ % if you have multiple lines of stuff to put here, you'll need to
+ % make the vbox yourself of the appropriate size.
+ \ifx#1l%
+ \llap{\ignorespaces #2\hskip\inmarginspacing}%
+ \else
+ \rlap{\hskip\hsize \hskip\inmarginspacing \ignorespaces #2}%
+ \fi
+ \null
+ }%
+}}
+\def\inleftmargin{\doinmargin l}
+\def\inrightmargin{\doinmargin r}
+%
+% @inmargin{TEXT [, RIGHT-TEXT]}
+% (if RIGHT-TEXT is given, use TEXT for left page, RIGHT-TEXT for right;
+% else use TEXT for both).
+%
+\def\inmargin#1{\parseinmargin #1,,\finish}
+\def\parseinmargin#1,#2,#3\finish{% not perfect, but better than nothing.
+ \setbox0 = \hbox{\ignorespaces #2}%
+ \ifdim\wd0 > 0pt
+ \def\lefttext{#1}% have both texts
+ \def\righttext{#2}%
+ \else
+ \def\lefttext{#1}% have only one text
+ \def\righttext{#1}%
+ \fi
+ %
+ \ifodd\pageno
+ \def\temp{\inrightmargin\righttext}% odd page -> outside is right margin
+ \else
+ \def\temp{\inleftmargin\lefttext}%
+ \fi
+ \temp
+}
% @include file insert text of that file as input.
% Allow normal characters that we make active in the argument (a file name).
@@ -885,13 +924,17 @@ where each line of input produces a line of output.}
\fi
\ifx\empty\imagewidth\else width \imagewidth \fi
\ifx\empty\imageheight\else height \imageheight \fi
- {#1.pdf}%
+ \ifnum\pdftexversion<13
+ #1.pdf%
+ \else
+ {#1.pdf}%
+ \fi
\ifnum\pdftexversion < 14 \else
\pdfrefximage \pdflastximage
\fi}
- \def\pdfmkdest#1{\pdfdest name{#1@} xyz}
+ \def\pdfmkdest#1{\pdfdest name{#1} xyz}
\def\pdfmkpgn#1{#1@}
- \let\linkcolor = \Cyan
+ \let\linkcolor = \Blue % was Cyan, but that seems light?
\def\endlink{\Black\pdfendlink}
% Adding outlines to PDF; macros for calculating structure of outlines
% come from Petr Olsak
@@ -906,7 +949,8 @@ where each line of input produces a line of output.}
\closein 1
\indexnofonts
\def\tt{}
- % thanh's hack / proper braces in bookmarks
+ \let\_ = \normalunderscore
+ % Thanh's hack / proper braces in bookmarks
\edef\mylbrace{\iftrue \string{\else}\fi}\let\{=\mylbrace
\edef\myrbrace{\iffalse{\else\string}\fi}\let\}=\myrbrace
%
@@ -1670,7 +1714,10 @@ where each line of input produces a line of output.}
}
% Subroutines used in generating headings
-% Produces Day Month Year style of output.
+% This produces Day Month Year style of output.
+% Only define if not already defined, in case a txi-??.tex file has set
+% up a different format (e.g., txi-cs.tex does this).
+\ifx\today\undefined
\def\today{%
\number\day\space
\ifcase\month
@@ -1679,6 +1726,7 @@ where each line of input produces a line of output.}
\or\putwordMSep\or\putwordMOct\or\putwordMNov\or\putwordMDec
\fi
\space\number\year}
+\fi
% @settitle line... specifies the title of the document, for headings.
% It generates no output of its own.
@@ -2587,42 +2635,48 @@ width0pt\relax} \fi
}
% @defindex foo == \newindex{foo}
-
+%
\def\defindex{\parsearg\newindex}
% Define @defcodeindex, like @defindex except put all entries in @code.
-
+%
+\def\defcodeindex{\parsearg\newcodeindex}
+%
\def\newcodeindex#1{%
\iflinks
\expandafter\newwrite \csname#1indfile\endcsname
\openout \csname#1indfile\endcsname \jobname.#1
\fi
\expandafter\xdef\csname#1index\endcsname{%
- \noexpand\docodeindex{#1}}
+ \noexpand\docodeindex{#1}}%
}
-\def\defcodeindex{\parsearg\newcodeindex}
% @synindex foo bar makes index foo feed into index bar.
% Do this instead of @defindex foo if you don't want it as a separate index.
-% The \closeout helps reduce unnecessary open files; the limit on the
-% Acorn RISC OS is a mere 16 files.
-\def\synindex#1 #2 {%
- \expandafter\let\expandafter\synindexfoo\expandafter=\csname#2indfile\endcsname
- \expandafter\closeout\csname#1indfile\endcsname
- \expandafter\let\csname#1indfile\endcsname=\synindexfoo
- \expandafter\xdef\csname#1index\endcsname{% define \xxxindex
- \noexpand\doindex{#2}}%
-}
-
+%
% @syncodeindex foo bar similar, but put all entries made for index foo
% inside @code.
-\def\syncodeindex#1 #2 {%
- \expandafter\let\expandafter\synindexfoo\expandafter=\csname#2indfile\endcsname
- \expandafter\closeout\csname#1indfile\endcsname
- \expandafter\let\csname#1indfile\endcsname=\synindexfoo
- \expandafter\xdef\csname#1index\endcsname{% define \xxxindex
- \noexpand\docodeindex{#2}}%
+%
+\def\synindex#1 #2 {\dosynindex\doindex{#1}{#2}}
+\def\syncodeindex#1 #2 {\dosynindex\docodeindex{#1}{#2}}
+
+% #1 is \doindex or \docodeindex, #2 the index getting redefined (foo),
+% #3 the target index (bar).
+\def\dosynindex#1#2#3{%
+ % Only do \closeout if we haven't already done it, else we'll end up
+ % closing the target index.
+ \expandafter \ifx\csname donesynindex#2\endcsname \undefined
+ % The \closeout helps reduce unnecessary open files; the limit on the
+ % Acorn RISC OS is a mere 16 files.
+ \expandafter\closeout\csname#2indfile\endcsname
+ \expandafter\let\csname\donesynindex#2\endcsname = 1
+ \fi
+ % redefine \fooindfile:
+ \expandafter\let\expandafter\temp\expandafter=\csname#3indfile\endcsname
+ \expandafter\let\csname#2indfile\endcsname=\temp
+ % redefine \fooindex:
+ \expandafter\xdef\csname#2index\endcsname{\noexpand#1{#3}}%
}
% Define \doindex, the driver for all \fooindex macros.
@@ -2854,16 +2908,17 @@ width0pt\relax} \fi
% Now the real index entry with the fonts.
\toks0 = {#2}%
%
- % If third (subentry) arg is present, add it to the index
- % string. And include a space.
+ % If the third (subentry) arg is present, add it to the index
+ % line to write.
\ifx\thirdarg\emptymacro \else
- \toks0 = \expandafter{\the\toks0 \space #3}%
+ \toks0 = \expandafter{\the\toks0{#3}}%
\fi
%
- % Set up the complete index entry, with both the sort key
- % and the original text, including any font commands. We write
- % three arguments to \entry to the .?? file, texindex reduces to
- % two when writing the .??s sorted result.
+ % Set up the complete index entry, with both the sort key and
+ % the original text, including any font commands. We write
+ % three arguments to \entry to the .?? file (four in the
+ % subentry case), texindex reduces to two when writing the .??s
+ % sorted result.
\edef\temp{%
\write\csname#1indfile\endcsname{%
\realbackslash entry{\indexsorttmp}{\folio}{\the\toks0}}%
@@ -3085,11 +3140,18 @@ width0pt\relax} \fi
\def\primary #1{\line{#1\hfil}}
\newskip\secondaryindent \secondaryindent=0.5cm
-
-\def\secondary #1#2{
-{\parfillskip=0in \parskip=0in
-\hangindent =1in \hangafter=1
-\noindent\hskip\secondaryindent\hbox{#1}\indexdotfill #2\par
+\def\secondary#1#2{{%
+ \parfillskip=0in
+ \parskip=0in
+ \hangindent=1in
+ \hangafter=1
+ \noindent\hskip\secondaryindent\hbox{#1}\indexdotfill
+ \ifpdf
+ \pdfgettoks#2.\ \the\toksA % The page number ends the paragraph.
+ \else
+ #2
+ \fi
+ \par
}}
% Define two-column mode, which we use to typeset indexes.
@@ -3149,7 +3211,6 @@ width0pt\relax} \fi
%
% Double the \vsize as well. (We don't need a separate register here,
% since nobody clobbers \vsize.)
- \advance\vsize by -\ht\partialpage
\vsize = 2\vsize
}
@@ -3163,6 +3224,7 @@ width0pt\relax} \fi
% previous page.
\dimen@ = \vsize
\divide\dimen@ by 2
+ \advance\dimen@ by -\ht\partialpage
%
% box0 will be the left-hand column, box2 the right.
\setbox0=\vsplit255 to\dimen@ \setbox2=\vsplit255 to\dimen@
@@ -3170,15 +3232,18 @@ width0pt\relax} \fi
\unvbox255
\penalty\outputpenalty
}
+%
+% Re-output the contents of the output page -- any previous material,
+% followed by the two boxes we just split, in box0 and box2.
\def\pagesofar{%
- % Re-output the contents of the output page -- any previous material,
- % followed by the two boxes we just split, in box0 and box2.
\unvbox\partialpage
%
\hsize = \doublecolumnhsize
\wd0=\hsize \wd2=\hsize
\hbox to\pagewidth{\box0\hfil\box2}%
}
+%
+% All done with double columns.
\def\enddoublecolumns{%
\output = {%
% Split the last of the double-column material. Leave it on the
@@ -3203,8 +3268,9 @@ width0pt\relax} \fi
% \endgroup where \vsize got restored).
\pagegoal = \vsize
}
+%
+% Called at the end of the double column material.
\def\balancecolumns{%
- % Called at the end of the double column material.
\setbox0 = \vbox{\unvbox255}% like \box255 but more efficient, see p.120.
\dimen@ = \ht0
\advance\dimen@ by \topskip
@@ -4265,6 +4331,7 @@ width0pt\relax} \fi
\gobble
}
+
% @quotation does normal linebreaking (hence we can't use \nonfillstart)
% and narrows the margins.
%
@@ -4287,6 +4354,158 @@ width0pt\relax} \fi
}
+% LaTeX-like @verbatim...@end verbatim and @verb{<char>...<char>}
+% If we want to allow any <char> as delimiter,
+% we need the curly braces so that makeinfo sees the @verb command, eg:
+% `@verbx...x' would look like the '@verbx' command. --janneke@gnu.org
+%
+% [Knuth]: Donald Ervin Knuth, 1996. The TeXbook.
+%
+% [Knuth] p. 344; only we need to do '@' too
+\def\dospecials{%
+ \do\ \do\\\do\@\do\{\do\}\do\$\do\&%
+ \do\#\do\^\do\^^K\do\_\do\^^A\do\%\do\~}
+%
+% [Knuth] p. 380
+\def\uncatcodespecials{%
+ \def\do##1{\catcode`##1=12}\dospecials}
+%
+% [Knuth] pp. 380,381,391
+% Disable Spanish ligatures ?` and !` of \tt font
+\begingroup
+ \catcode`\`=\active\gdef`{\relax\lq}
+\endgroup
+%
+% Setup for the @verb command.
+%
+% Eight spaces for a tab
+\begingroup
+ \catcode`\^^I=\active
+ \gdef\tabeightspaces{\catcode`\^^I=\active\def^^I{\ \ \ \ \ \ \ \ }}
+\endgroup
+%
+\def\setupverb{%
+ \tt % easiest (and conventionally used) font for verbatim
+ \def\par{\leavevmode\endgraf}%
+ \catcode`\`=\active
+ \tabeightspaces
+ % Respect line breaks,
+ % print special symbols as themselves, and
+ % make each space count
+ % must do in this order:
+ \obeylines \uncatcodespecials \sepspaces
+}
+
+% Setup for the @verbatim environment
+%
+% Real tab expansion
+\newdimen\tabw \setbox0=\hbox{\tt\space} \tabw=8\wd0 % tab amount
+%
+\def\starttabbox{\setbox0=\hbox\bgroup}
+\begingroup
+ \catcode`\^^I=\active
+ \gdef\tabexpand{%
+ \catcode`\^^I=\active
+ \def^^I{\leavevmode\egroup
+ \dimen0=\wd0 % the width so far, or since the previous tab
+ \divide\dimen0 by\tabw
+ \multiply\dimen0 by\tabw % compute previous multiple of \tabw
+ \advance\dimen0 by\tabw % advance to next multiple of \tabw
+ \wd0=\dimen0 \box0 \starttabbox
+ }%
+ }
+\endgroup
+\def\setupverbatim{%
+ % Easiest (and conventionally used) font for verbatim
+ \tt
+ \def\par{\leavevmode\egroup\box0\endgraf}%
+ \catcode`\`=\active
+ \tabexpand
+ % Respect line breaks,
+ % print special symbols as themselves, and
+ % make each space count
+ % must do in this order:
+ \obeylines \uncatcodespecials \sepspaces
+ \everypar{\starttabbox}%
+}
+
+% Do the @verb magic: verbatim text is quoted by unique
+% delimiter characters. Before first delimiter expect a
+% right brace, after last delimiter expect closing brace:
+%
+% \def\doverb'{'<char>#1<char>'}'{#1}
+%
+% [Knuth] p. 382; only eat outer {}
+\begingroup
+ \catcode`[=1\catcode`]=2\catcode`\{=12\catcode`\}=12
+ \gdef\doverb{#1[\def\next##1#1}[##1\endgroup]\next]
+\endgroup
+%
+\def\verb{\begingroup\setupverb\doverb}
+%
+%
+% Do the @verbatim magic: define the macro \doverbatim so that
+% the (first) argument ends when '@end verbatim' is reached, ie:
+%
+% \def\doverbatim#1@end verbatim{#1}
+%
+% For Texinfo it's a lot easier than for LaTeX,
+% because texinfo's \verbatim doesn't stop at '\end{verbatim}':
+% we need not redefine '\', '{' and '}'
+%
+% Inspired by LaTeX's verbatim command set [latex.ltx]
+%% Include LaTeX hack for completeness -- never know
+%% \begingroup
+%% \catcode`|=0 \catcode`[=1
+%% \catcode`]=2\catcode`\{=12\catcode`\}=12\catcode`\ =\active
+%% \catcode`\\=12|gdef|doverbatim#1@end verbatim[
+%% #1|endgroup|def|Everbatim[]|end[verbatim]]
+%% |endgroup
+\begingroup
+ \catcode`\ =\active
+ \gdef\doverbatim#1@end verbatim{#1\end{verbatim}}
+\endgroup
+%
+\def\verbatim{%
+ \def\Everbatim{\nonfillfinish\endgroup}%
+ \begingroup
+ \nonfillstart
+ \advance\leftskip by -\defbodyindent
+ \begingroup\setupverbatim\doverbatim
+}
+
+% @verbatiminclude FILE - insert text of file in verbatim environment.
+%
+% Allow normal characters that we make active in the argument (a file name).
+\def\verbatiminclude{%
+ \begingroup
+ \catcode`\\=12
+ \catcode`~=12
+ \catcode`^=12
+ \catcode`_=12
+ \catcode`|=12
+ \catcode`<=12
+ \catcode`>=12
+ \catcode`+=12
+ \parsearg\doverbatiminclude
+}
+\def\setupverbatiminclude{%
+ \begingroup
+ \nonfillstart
+ \advance\leftskip by -\defbodyindent
+ \begingroup\setupverbatim
+}
+%
+\def\doverbatiminclude#1{%
+ % Restore active chars for included file.
+ \endgroup
+ \begingroup
+ \def\thisfile{#1}%
+ \expandafter\expandafter\setupverbatiminclude\input\thisfile
+ \endgroup\nonfillfinish\endgroup
+}
+
+
\message{defuns,}
% @defun etc.
@@ -4710,7 +4929,8 @@ width0pt\relax} \fi
\def\deftypeivarheader#1#2#3{%
\dosubind{vr}{\code{#3}}{\putwordof\ \code{#1}}% entry in variable index
\begingroup
- \defname{#3}{\putwordInstanceVariableof\ \code{#1}}%
+ \defname{\defheaderxcond#2\relax$$$#3}
+ {\putwordInstanceVariableof\ \code{#1}}%
\defvarargs{#3}%
\endgroup
}
@@ -5628,7 +5848,8 @@ width0pt\relax} \fi
\setbox0 = \hbox{\ignorespaces #2}\ifdim\wd0 > 0pt \epsfxsize=#2\relax \fi
\setbox0 = \hbox{\ignorespaces #3}\ifdim\wd0 > 0pt \epsfysize=#3\relax \fi
\begingroup
- \catcode`\^^M = 5 % in case we're inside an example
+ \catcode`\^^M = 5 % in case we're inside an example
+ \normalturnoffactive % allow _ et al. in names
% If the image is by itself, center it.
\ifvmode
\nobreak\bigskip
@@ -5740,6 +5961,15 @@ should work if nowhere else does.}
\setemergencystretch
}
+% Use `small' versions.
+%
+\def\smallenvironments{%
+ \let\smalldisplay = \smalldisplayx
+ \let\smallexample = \smalllispx
+ \let\smallformat = \smallformatx
+ \let\smalllisp = \smalllispx
+}
+
% @letterpaper (the default).
\def\letterpaper{{\globaldefs = 1
\parskip = 3pt plus 2pt minus 1pt
@@ -5762,11 +5992,7 @@ should work if nowhere else does.}
\contentsrightmargin = 0pt
\deftypemargin = 0pt
\defbodyindent = .5cm
- %
- \let\smalldisplay = \smalldisplayx
- \let\smallexample = \smalllispx
- \let\smallformat = \smallformatx
- \let\smalllisp = \smalllispx
+ \smallenvironments
}}
% Use @afourpaper to print on European A4 paper.
@@ -5780,6 +6006,26 @@ should work if nowhere else does.}
\hfuzz = 1pt
}}
+% Use @afivepaper to print on European A5 paper.
+% From romildo@urano.iceb.ufop.br, 2 July 2000.
+% He also recommends making @example and @lisp be small.
+\def\afivepaper{{\globaldefs = 1
+ \setleading{12.5pt}%
+ \parskip = 2pt plus 1pt minus 0.1pt
+ %
+ \internalpagesizes{166mm}{120mm}{\voffset}{-8mm}{\bindingoffset}{8pt}%
+ %
+ \lispnarrowing = 0.2in
+ \tolerance = 800
+ \hfuzz = 1.2pt
+ \contentsrightmargin = 0mm
+ \deftypemargin = 0pt
+ \defbodyindent = 2mm
+ \tableindent = 12mm
+ %
+ \smallenvironments
+}}
+
% A specific text layout, 24x15cm overall, intended for A4 paper. Top margin
% 29mm, hence bottom margin 28mm, nominal side margin 3cm.
\def\afourlatex{{\globaldefs = 1
OpenPOWER on IntegriCloud